--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_trimmer.xml	Wed Jul 10 06:13:48 2013 -0400
@@ -0,0 +1,85 @@
+<tool id="cshl_fastx_trimmer" name="Trim sequences">
+	<description>to fixed length</description>
+	<command>
+cat '$input' |
+fastx_trimmer
+#if $input.ext == "fastqsanger":
+ -Q 33
+#elif $input.ext == "fastq":
+ -Q 64
+#end if
+ -v -f $first -l $last -o '$output'
+</command>
+	<inputs>
+		<param format="fasta,fastq,fastqsanger" name="input" type="data" label="Library to clip" />
+
+		<param name="first" size="4" type="integer" value="1">
+			<label>First base to keep</label>
+		</param>
+
+		<param name="last" size="4" type="integer" value="21">
+			<label>Last base to keep</label>
+		</param>
+	</inputs>
+
+	<tests>
+		<test>
+			<!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
+			<param name="input" value="fastx_trimmer1.fasta" />
+			<param name="first" value="5"/>
+			<param name="last" value="36"/>
+			<output name="output" file="fastx_trimmer1.out" />
+		</test>
+		<test>
+			<!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
+			<param name="input" value="fastx_trimmer2.fastq" />
+			<param name="first" value="1"/>
+			<param name="last" value="27"/>
+			<output name="output" file="fastx_trimmer2.out" />
+		</test>
+	</tests>
+
+	<outputs>
+		<data format="input" name="output" metadata_source="input"
+		/>
+	</outputs>
+	<help>
+**What it does**
+
+This tool trims (cut nucleotides from) sequences in a FASTA/Q file.
+  
+--------
+
+**Example**
+
+Input Fasta file (with 36 bases in each sequences)::
+
+    >1-1
+    TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
+    >2-1
+    CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
+    
+
+Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
+
+    >1-1
+    TATGGTCAGAAACCATATGCA
+    >2-1
+    CAGCGAGGCTTTAATGCCATT
+
+Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::
+
+    >1-1
+    TCAGA
+    >2-1
+    AGGCT
+    
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+    
+</help>
+</tool>
+<!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->