Mercurial > repos > idot > fastx_toolkit2
diff fastx_trimmer.xml @ 0:78a7d28f2a15 draft
Uploaded
author | idot |
---|---|
date | Wed, 10 Jul 2013 06:13:48 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_trimmer.xml Wed Jul 10 06:13:48 2013 -0400 @@ -0,0 +1,85 @@ +<tool id="cshl_fastx_trimmer" name="Trim sequences"> + <description>to fixed length</description> + <command> +cat '$input' | +fastx_trimmer +#if $input.ext == "fastqsanger": + -Q 33 +#elif $input.ext == "fastq": + -Q 64 +#end if + -v -f $first -l $last -o '$output' +</command> + <inputs> + <param format="fasta,fastq,fastqsanger" name="input" type="data" label="Library to clip" /> + + <param name="first" size="4" type="integer" value="1"> + <label>First base to keep</label> + </param> + + <param name="last" size="4" type="integer" value="21"> + <label>Last base to keep</label> + </param> + </inputs> + + <tests> + <test> + <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) --> + <param name="input" value="fastx_trimmer1.fasta" /> + <param name="first" value="5"/> + <param name="last" value="36"/> + <output name="output" file="fastx_trimmer1.out" /> + </test> + <test> + <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) --> + <param name="input" value="fastx_trimmer2.fastq" /> + <param name="first" value="1"/> + <param name="last" value="27"/> + <output name="output" file="fastx_trimmer2.out" /> + </test> + </tests> + + <outputs> + <data format="input" name="output" metadata_source="input" + /> + </outputs> + <help> +**What it does** + +This tool trims (cut nucleotides from) sequences in a FASTA/Q file. + +-------- + +**Example** + +Input Fasta file (with 36 bases in each sequences):: + + >1-1 + TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC + >2-1 + CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA + + +Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: + + >1-1 + TATGGTCAGAAACCATATGCA + >2-1 + CAGCGAGGCTTTAATGCCATT + +Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences:: + + >1-1 + TCAGA + >2-1 + AGGCT + +------ + +This tool is based on `FASTX-toolkit`__ by Assaf Gordon. + + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + +</help> +</tool> +<!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->