<tool id="cshl_fastx_end_trimmer" name="Trim End">
	<description>of sequences</description>
	<command>
cat '$input' |
fastx_trimmer
#if $input.ext == "fastqsanger":
 -Q 33
#elif $input.ext == "fastq":
 -Q 64
#end if
 -v -t $trimnum -m $minlen -o '$output'
</command>
	<inputs>
		<param format="fasta,fastq,fastqsanger" name="input" type="data" label="Library to clip" />

		<param name="trimnum" size="4" type="integer" value="5">
			<label>Number of nucleotides to be trimmed</label>
			<help>This will trim from the end of the sequences</help>
		</param>

		<param name="minlen" size="4" type="integer" value="10">
			<label>Minimum sequence length</label>
			<help>Sequences shorter than this length will be discarded</help>
		</param>
	</inputs>

	<tests>
		<test>
			<param name="input" value="fastx_trimmer_from_end1.fasta" />
			<param name="trimnum" value="2"/>
			<param name="minlen" value="16"/>
			<output name="output" file="fastx_trimmer_from_end1.out" />
		</test>
	</tests>

	<outputs>
		<data format="input" name="output" metadata_source="input"
		/>
	</outputs>
	<help>
**What it does**

This tool trims (cut nucleotides from) sequences in a FASTQ/FASTA file from the 3' end.

.. class:: infomark

When trimming a FASTQ file, the quality scores will be trimmed appropriately (to the same length of the corresponding sequence).
  
--------

**Example**

Input Fasta file::

    >1-1
    TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
    >2-1
    CAGCGAGGCTTTAATGCCATT
    

Trimming 5 nucleotides from the end, and discarding sequences shorter than 10 , we get the following FASTA file::

    >1-1
    TATGGTCAGAAACCATATGCAGAGCCTGTAG
    >2-1
    CAGCGAGGCTTTAATG

Trimming 10 nucleotides from the end, and discarding sequences shorter than 15 , we get the following FASTA file::

    >1-1
    TATGGTCAGAAACCATATGCAGAGCC
    
------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
    
</help>
</tool>
<!-- FASTX-Trimmer-End is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->