Mercurial > repos > idot > fastx_toolkit2
view fastx_clipper.xml @ 1:e7c65e398bdd draft default tip
Deleted selected files
author | idot |
---|---|
date | Wed, 10 Jul 2013 06:16:21 -0400 |
parents | 78a7d28f2a15 |
children |
line wrap: on
line source
<tool id="cshl_fastx_clipper_ng" name="Clip" version="1.0.1" > <description>adapter sequences</description> <command> cat '$input' | fastx_clipper #if $input.ext == "fastqsanger": -Q 33 #elif $input.ext == "fastq": -Q 64 #end if -l $minlength -a '$clip_source.clip_sequence' -d $keepdelta -o '$output' -v $KEEP_N $DISCARD_OPTIONS </command> <inputs> <param format="fasta,fastq,fastqsanger" name="input" type="data" label="Library to clip" /> <param name="minlength" size="4" type="integer" value="15"> <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label> </param> <conditional name="clip_source"> <param name="clip_source_list" type="select" label="Source"> <option value="prebuilt" selected="true">Standard (select from the list below)</option> <option value="user">Enter custom sequence</option> </param> <when value="user"> <param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" /> </when> <when value="prebuilt"> <param name="clip_sequence" type="select" label="Choose Adapter"> <options from_file="fastx_clipper_sequences.txt"> <column name="name" index="1"/> <column name="value" index="0"/> </options> </param> </when> </conditional> <param name="keepdelta" size="2" type="integer" value="0"> <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label> <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help> </param> <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases"> <option value="">Yes</option> <option value="-n">No</option> </param> <param name="DISCARD_OPTIONS" type="select" label="Output options"> <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option> <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option> <option value="">Output both clipped and non-clipped sequences</option> </param> </inputs> <tests> <test> <param name="input" value="fastx_clipper1.fastq" /> <param name="maxmismatches" value="2" /> <param name="minlength" value="15" /> <param name="clip_source_list" value="user" /> <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" /> <param name="keepdelta" value="0" /> <param name="KEEP_N" value="No" /> <param name="DISCARD_OPTIONS" value="Output only clipped sequences (i.e. sequences which contained the adapter)" /> <output name="output" file="fastx_clipper1a.out" /> </test> </tests> <outputs> <data format="input" name="output" metadata_source="input" /> </outputs> <help> **What it does** This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. -------- **Clipping Illustration:** .. image:: ../static/fastx_icons/fastx_clipper_illustration.png **Clipping Example:** .. image:: ../static/fastx_icons/fastx_clipper_example.png **In the above example:** * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> </tool> <!-- FASTX-Clipper is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->