Mercurial > repos > iuc > bcftools_consensus

comparison bcftools_consensus.xml @ 17:95c6f3f4c77f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit db275932cbb485cb44ae91e0b421d6f57698db49
author iuc
date Tue, 20 Sep 2022 12:48:09 +0000
parents edc3d484b99a
children 1171446da5db
comparison
equal deleted inserted replaced
16:d37e313a41be 17:95c6f3f4c77f
1 <?xml version='1.0' encoding='utf-8'?> 1 <?xml version='1.0' encoding='utf-8'?>
2 <tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy1"> 2 <tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
3 <description>Create consensus sequence by applying VCF variants to a reference fasta file</description> 3 <description>Create consensus sequence by applying VCF variants to a reference fasta file</description>
4 <macros> 4 <macros>
5 <token name="@EXECUTABLE@">consensus</token> 5 <token name="@EXECUTABLE@">consensus</token>
6 <import>macros.xml</import> 6 <import>macros.xml</import>
7 </macros> 7 </macros>
28 28
29 #if $section.mask: 29 #if $section.mask:
30 --mask '${section.mask}' 30 --mask '${section.mask}'
31 #end if 31 #end if
32 32
33 #if $section.mark_del
34 --mark-del '$section.mark_del'
35 #end if
36
37 #if $section.mark_ins
38 --mark-ins $section.mark_ins
39 #end if
40
41 #if $section.mark_snv
42 --mark-snv $section.mark_snv
43 #end if
44
33 #if $section.select_haplotype: 45 #if $section.select_haplotype:
34 --haplotype '${section.select_haplotype}' 46 --haplotype '${section.select_haplotype}'
35 #end if 47 #end if
36 @SAMPLE@ 48 @SAMPLE@
37 49
38 #set $section = $sec_restrict 50 #set $section = $sec_restrict
39 @INCLUDE@ 51 @INCLUDE@
40 @EXCLUDE@ 52 @EXCLUDE@
41 53
42 #if $chain: 54 #if $chain:
43 --chain '$chain_file' 55 --chain '$chain_file'
56 #end if
57
58 #if $absent
59 --absent '$absent'
44 #end if 60 #end if
45 61
46 ## Primary Input/Outputs 62 ## Primary Input/Outputs
47 #if str($rename) == "no" 63 #if str($rename) == "no"
48 --output '$output_file' 64 --output '$output_file'
64 <expand macro="macro_sample" /> 80 <expand macro="macro_sample" />
65 <param name="select_haplotype" type="select" optional="true"> 81 <param name="select_haplotype" type="select" optional="true">
66 <option value="1">1</option> 82 <option value="1">1</option>
67 <option value="2">2</option> 83 <option value="2">2</option>
68 </param> 84 </param>
85 <param argument="--mark-del" type="text" value="" optional="true" label="Mark deletions" help="Instead of removing sequence, insert CHAR for deletions">
86 <sanitizer invalid_char="">
87 <valid initial="string.letters,string.digits">
88 <add value="_" />
89 </valid>
90 </sanitizer>
91 <validator type="regex">[0-9a-zA-Z_]+</validator>
92 </param>
93 <param argument="--mark-ins" type="select" optional="true" label="Mark insertions" help="Highlight insertions in uppercase (uc) or lowercase (lc), leaving the rest as is">
94 <option value="uc">Uppercase</option>
95 <option value="lc">Lowercase</option>
96 </param>
97 <param argument="--mark-snv" type="select" optional="true" label="Mark substitutions" help="Highlight substitutions in uppercase (uc) or lowercase (lc), leaving the rest as is">
98 <option value="uc">Uppercase</option>
99 <option value="lc">Lowercase</option>
100 </param>
101 <conditional name="conditional_mask">
102 <param name="selector" type="select" label="Mask file option">
103 <option value="disabled">Disabled</option>
104 <option value="enabled">Enabled</option>
105 </param>
106 <when value="disabled"/>
107 <when value="enabled">
108 <param argument="--mask" type="data" format="tabular" label="Mask" help="Replace regions according to the next --mask-with option" />
109 <param argument="--mask-with" type="text" value="N" optional="true" label="Mask with" help="Replace with CHAR (skips overlapping variants); change to uppercase (uc) or lowercase (lc)">
110 <sanitizer invalid_char="">
111 <valid initial="string.letters,string.digits">
112 <add value="_" />
113 </valid>
114 </sanitizer>
115 <validator type="regex">[0-9a-zA-Z_]+</validator>
116 </param>
117 </when>
118 </conditional>
69 </section> 119 </section>
70 <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" /> 120 <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" />
71 <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" /> 121 <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" />
122 <param argument="--absent" type="text" value="" label="Absent" optional="true" help="It allows to set positions with no supporting evidence to N (or any other character)">
123 <sanitizer invalid_char="">
124 <valid initial="string.letters,string.digits,string.punctuation">
125 <remove value="@" />
126 <remove value="'" />
127 </valid>
128 </sanitizer>
129 </param>
72 <section name="sec_restrict" expanded="false" title="Restrict to"> 130 <section name="sec_restrict" expanded="false" title="Restrict to">
73 <expand macro="macro_include" /> 131 <expand macro="macro_include" />
74 <expand macro="macro_exclude" /> 132 <expand macro="macro_exclude" />
75 </section> 133 </section>
76 </inputs> 134 </inputs>
138 <assert_contents> 196 <assert_contents>
139 <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" /> 197 <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" />
140 </assert_contents> 198 </assert_contents>
141 </output> 199 </output>
142 </test> 200 </test>
201 <!--Test absent option-->
202 <test>
203 <expand macro="test_using_reference" ref="consensus.fa" />
204 <param name="input_file" ftype="vcf" value="consensus.vcf" />
205 <section name="sec_restrict">
206 <param name="include" value='TYPE="snp"' />
207 </section>
208 <param name="absent" value="W"/>
209 <output name="output_file">
210 <assert_contents>
211 <has_text text="WWWAWAWWAWWWWWWWWCWWWWWWWW" />
212 </assert_contents>
213 </output>
214 <assert_command>
215 <has_text text="--absent" />
216 </assert_command>
217 </test>
218 <!--Test mask options -->
219 <test>
220 <expand macro="test_using_reference" ref="consensus.fa" />
221 <param name="input_file" ftype="vcf" value="consensus.vcf" />
222 <section name="sec_restrict">
223 <param name="include" value='TYPE="snp"' />
224 </section>
225 <section name="sec_default">
226 <param name="mark_del" value="DEL"/>
227 <param name="mark_ins" value="uc"/>
228 <param name="mark_snv" value="uc"/>
229 </section>
230 <output name="output_file">
231 <assert_contents>
232 <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" />
233 </assert_contents>
234 </output>
235 <assert_command>
236 <has_text text="--mark-del" />
237 <has_text text="--mark-ins" />
238 <has_text text="--mark-snv" />
239 </assert_command>
240 </test>
143 </tests> 241 </tests>
144 <help><![CDATA[ 242 <help><![CDATA[
145 ===================================== 243 =====================================
146 bcftools @EXECUTABLE@ plugin 244 bcftools @EXECUTABLE@ plugin
147 ===================================== 245 =====================================