Mercurial > repos > iuc > bcftools_consensus
view bcftools_consensus.xml @ 13:d6dc477167f8 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit 8ad854180e3be0934cdb1f0021886199a2edf9c3"
author | iuc |
---|---|
date | Fri, 05 Feb 2021 19:48:42 +0000 |
parents | e522022137f6 |
children | 92182c270ce4 |
line wrap: on
line source
<?xml version='1.0' encoding='utf-8'?> <tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy1"> <description>Create consensus sequence by applying VCF variants to a reference fasta file</description> <macros> <token name="@EXECUTABLE@">consensus</token> <import>macros.xml</import> </macros> <expand macro="requirements"> <expand macro="samtools_requirement"/> <requirement type="package" version="5.0.1">gawk</requirement> </expand> <expand macro="version_command" /> <command detect_errors="aggressive"><![CDATA[ @PREPARE_ENV@ @PREPARE_INPUT_FILE@ #set $section = $reference_source @PREPARE_FASTA_REF@ bcftools @EXECUTABLE@ @FASTA_REF@ ## Default section #set $section = $sec_default ${section.iupac_codes} #if $section.mask: --mask '${section.mask}' #end if #if $section.select_haplotype: --haplotype '${section.select_haplotype}' #end if @SAMPLE@ #set $section = $sec_restrict @INCLUDE@ @EXCLUDE@ #if $chain: --chain '$chain_file' #end if ## Primary Input/Outputs #if str($rename) == "no" --output '$output_file' #end if @INPUT_FILE@ #if str($rename) == "yes": #set basename=$input_file.element_identifier | awk 'BEGIN {i=1} {if (match($0, /^>/)) {if (i==1) {name="${basename}"} else {name=sprintf("%s-%d","${basename}",i);} print(gensub(/>[^ ]+( ?.*)/, ">" name "\\1", 1)); i=i+1;} else {print}}' > '$output_file' #end if ]]> </command> <inputs> <expand macro="macro_input" /> <expand macro="macro_fasta_ref" /> <section name="sec_default" expanded="true" title="Default Options"> <param name="mask" type="data" format="tabular" label="Mask" optional="True" help="Replace regions with N" /> <param name="iupac_codes" type="boolean" truevalue="--iupac-codes" falsevalue="" label="Iupac Codes" help="Output variants in the form of IUPAC ambiguity codes" /> <expand macro="macro_sample" /> <param name="select_haplotype" type="select" optional="true"> <option value="1">1</option> <option value="2">2</option> </param> </section> <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" /> <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" /> <section name="sec_restrict" expanded="false" title="Restrict to"> <expand macro="macro_include" /> <expand macro="macro_exclude" /> </section> </inputs> <outputs> <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/> <data name="chain_file" format="txt" label="${tool.name} on ${on_string}: chain"> <filter>chain</filter> </data> </outputs> <tests> <test> <expand macro="test_using_reference" ref="consensus.fa" /> <param name="input_file" ftype="vcf" value="consensus.vcf" /> <param name="mask" ftype="tabular" value="consensus.tab" /> <param name="chain" value="True" /> <output name="output_file"> <assert_contents> <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" /> </assert_contents> </output> <output name="chain_file"> <assert_contents> <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" /> </assert_contents> </output> </test> <test> <expand macro="test_using_reference" select_from="cached" ref="consensus" /> <param name="input_file" ftype="vcf" dbkey="?" value="consensus.vcf" /> <param name="mask" ftype="tabular" value="consensus.tab" /> <param name="chain" value="True" /> <output name="output_file"> <assert_contents> <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" /> </assert_contents> </output> <output name="chain_file"> <assert_contents> <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" /> </assert_contents> </output> </test> <test> <expand macro="test_using_reference" ref="consensus.fa" /> <param name="input_file" ftype="vcf" value="consensus.vcf" /> <param name="mask" ftype="tabular" value="consensus.tab" /> <param name="chain" value="False" /> <param name="rename" value="True" /> <output name="output_file"> <assert_contents> <has_text text=">consensus.vcf" /> </assert_contents> <assert_contents> <has_text text=">consensus.vcf-2" /> </assert_contents> </output> </test> <test> <expand macro="test_using_reference" ref="consensus.fa" /> <param name="input_file" ftype="vcf" value="consensus.vcf" /> <section name="sec_restrict"> <param name="include" value='TYPE="snp"' /> </section> <output name="output_file"> <assert_contents> <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" /> </assert_contents> </output> </test> </tests> <help><![CDATA[ ===================================== bcftools @EXECUTABLE@ plugin ===================================== Create consensus sequence by applying VCF variants to a reference fasta file. @BCFTOOLS_MANPAGE@#@EXECUTABLE@ @BCFTOOLS_WIKI@ The option to set the new consensus' FASTA ID from the name of the VCF is provided by post-processing the bcftools consensus output. It is primarily intended for use when the VCF is coming from a list collection where the elements of the list are named meaningfully (e.g. named after sample names). This is useful when consensus sequences are being prepared for, for example, feeding a multiple sequence alignment to a phylogeny program. ]]> </help> <expand macro="citations" /> </tool>