# HG changeset patch
# User iuc
# Date 1764663740 0
# Node ID 9a260f6fab939cf1c4f4a0e4cd0c3a4076a8acba
# Parent  8aa352093d7312401c68a684cc97a68896f4db46
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/bcftools commit f6efda26965eb73c9107d367fd5ffdf246ed0dbc

diff -r 8aa352093d73 -r 9a260f6fab93 bcftools_consensus.xml
--- a/bcftools_consensus.xml	Sun Aug 18 10:23:11 2024 +0000
+++ b/bcftools_consensus.xml	Tue Dec 02 08:22:20 2025 +0000
@@ -1,136 +1,219 @@
-<?xml version='1.0' encoding='utf-8'?>
 <tool name="bcftools @EXECUTABLE@" id="bcftools_@EXECUTABLE@" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
     <description>Create consensus sequence by applying VCF variants to a reference fasta file</description>
     <macros>
         <token name="@EXECUTABLE@">consensus</token>
         <import>macros.xml</import>
     </macros>
-    <expand macro="bio_tools" />
+    <expand macro="bio_tools"/>
     <expand macro="requirements">
         <expand macro="samtools_requirement"/>
-        <requirement type="package" version="5.0.1">gawk</requirement>
+        <requirement type="package" version="5.3.0">gawk</requirement>
     </expand>
-    <expand macro="version_command" />
+    <expand macro="version_command"/>
     <command detect_errors="aggressive"><![CDATA[
-@PREPARE_ENV@
 @PREPARE_INPUT_FILE@
 #set $section = $reference_source
 @PREPARE_FASTA_REF@
 
+#set $section = $sec_restrict
+#if $section.regions.regions_src != '__none__':
+  samtools faidx
+  #if $section.regions.regions_src == 'regions':
+    #set $intervals = $section.regions.region_specs
+    @PARSE_INTERVALS@
+    #set $ref_regions_spec = " ".join("'" + c + "'" for c in $components)
+    '$input_fa_ref' $ref_regions_spec |
+  #else if $section.regions.regions_src == 'regions_file':
+    -r '$section.regions.regions_file' '$input_fa_ref' |
+  #end if
+  #set $input_fa_ref = "-"
+#end if
+
 bcftools @EXECUTABLE@
 
+#if $section.regions.regions_src != '__none__':
+  --regions-overlap $section.regions_overlap
+#end if
+
+#set $section = $reference_source
 @FASTA_REF@
 
-## Default section
-#set $section = $sec_default
-
-${section.iupac_codes}
-
-#if $section.mask:
-  --mask '${section.mask}'
+$mode.select
+#if not str($mode.select):
+  $mode.specify_samples.how
+  #if str($mode.specify_samples.how) in ["-s", "-S"]:
+    '${mode.specify_samples.invert_samples}${mode.specify_samples.samples_spec}'
+  #end if
+#else if str($mode.select) == "-H":
+  #if str(mode.haplotype.rule) in ["", "pIu"]:
+    #set haplotype_option = str(mode.haplotype.allele_n) + str(mode.haplotype.rule)
+  #else:
+    #set haplotype_option = str(mode.haplotype.rule)
+  #end if
+  $haplotype_option
+  #if $mode.sample:
+    --sample '$mode.sample'
+  #end if
 #end if
 
-#if $section.mark_del
-    --mark-del '$section.mark_del'
-#end if
+#set $masks = []
+#for $m in $masking_options.mask:
+  #if $m:
+    #silent $masks.append($m)
+  #end if
+#end for
 
-#if $section.mark_ins
-    --mark-ins $section.mark_ins
+#if $masks:
+  #if $masking_options.mask_with:
+    #set $masking_instructions = []
+    #for $i in str($masking_options.mask_with).split(",", maxsplit=len($masks)-1):
+      #silent $masking_instructions.append("--mask-with '" + $i + "'")
+    #end for
+  #else:
+    #set $masking_instructions = [""]
+  #end if
+  #if len($masking_instructions) == 1:
+    ## use same masking instruction for all masks
+    #set $masking_instructions = [""] * (len($masks) - 1) + $masking_instructions
+  #else if len($masking_instructions) < len($masks):
+    ## fill in empty masking instructions for missing ones, which will make bcftools complain about them
+    #silent $masking_instructions.extend(["--mask-with ''"] * (len($masks) - len($masking_instructions)))
+  #end if
+
+  #for $m, $i in zip($masks, $masking_instructions):
+    --mask '$m' $i
+  #end for
 #end if
 
-#if $section.mark_snv
-    --mark-snv $section.mark_snv
+#if $masking_options.absent:
+--absent '$masking_options.absent'
+#end if
+
+#if $masking_options.mark_del:
+  --mark-del '$masking_options.mark_del'
 #end if
 
-#if $section.select_haplotype:
-  --haplotype '${section.select_haplotype}'
+$masking_options.insertions.mark_ins
+#if str($masking_options.insertions.mark_ins) == "--mark-ins":
+  '$masking_options.insertions.ins_custom'
 #end if
-@SAMPLE@
+
+$masking_options.snvs.mark_snv
+#if str($masking_options.snvs.mark_snv) == "--mark-snv":
+  '$masking_options.snvs.snv_custom'
+#end if
 
 #set $section = $sec_restrict
 @INCLUDE@
 @EXCLUDE@
 
 #if $chain:
-    --chain '$chain_file'
-#end if
-
-#if $absent
-    --absent '$absent'
+  --chain '$chain_file'
 #end if
 
 ## Primary Input/Outputs
 #if str($rename) == "no"
-    --output '$output_file'
+  --output '$output_file'
 #end if
 @INPUT_FILE@
 #if str($rename) == "yes":
-    #set basename=$input_file.element_identifier
-    | awk 'BEGIN {i=1} {if (match($0, /^>/)) {if (i==1) {name="${basename}"} else {name=sprintf("%s-%d","${basename}",i);} print(gensub(/>[^ ]+( ?.*)/, ">" name "\\1", 1)); i=i+1;} else {print}}' > '$output_file'
+  #set basename=$input_file.element_identifier
+  | awk 'BEGIN {i=1} {if (match($0, /^>/)) {if (i==1) {name="${basename}"} else {name=sprintf("%s-%d","${basename}",i);} print(gensub(/>[^ ]+( ?.*)/, ">" name "\\1", 1)); i=i+1;} else {print}}' > '$output_file'
 #end if
 ]]>
     </command>
     <inputs>
-        <expand macro="macro_input" />
-        <expand macro="macro_fasta_ref" />
-        <section name="sec_default" expanded="true" title="Default Options">
-            <param name="mask" type="data" format="tabular" label="Mask" optional="True" help="Replace regions with N" />
-            <param name="iupac_codes" type="boolean" truevalue="--iupac-codes" falsevalue="" label="Iupac Codes" 
-                   help="Output variants in the form of IUPAC ambiguity codes" />
-            <expand macro="macro_sample" />
-            <param name="select_haplotype" type="select" optional="true">
-                <option value="1">1</option>
-                <option value="2">2</option>
-            </param>
-            <param argument="--mark-del" type="text" value="" optional="true" label="Mark deletions" help="Instead of removing sequence, insert CHAR for deletions">
-                <sanitizer invalid_char="">
-                    <valid initial="string.letters,string.digits">
-                        <add value="_" />
-                    </valid>
-                </sanitizer>
-                <validator type="regex">[0-9a-zA-Z_]+</validator>
+        <expand macro="macro_input"/>
+        <expand macro="macro_fasta_ref"/>
+        <conditional name="mode">
+            <param name="select" type="select" label="Consensus building mode; at each variant site ...">
+                <option value="-s -">ignore any sample genotypes; incorporate first allele from ALT column (-s -)</option>
+                <option value="-I -s -">ignore any sample genotypes; incorporate IUPAC code representing all alleles from REF/ALT coulmns (-I -s -)</option>
+                <option value="" selected="true">incorporate IUPAC code representing the genotypes of all selected samples (default)</option>
+                <option value="-H">incorporate specific haplotype allele of one selected sample</option>
             </param>
-            <param argument="--mark-ins" type="select" optional="true" label="Mark insertions" help="Highlight insertions in uppercase (uc) or lowercase (lc), leaving the rest as is">
-                <option value="uc">Uppercase</option>
-                <option value="lc">Lowercase</option>
-            </param>
-            <param argument="--mark-snv" type="select" optional="true" label="Mark substitutions" help="Highlight substitutions in uppercase (uc) or lowercase (lc), leaving the rest as is">
-                <option value="uc">Uppercase</option>
-                <option value="lc">Lowercase</option>
+            <when value="-s -" />
+            <when value="-I -s -" />
+            <when value="">
+                <expand macro="macro_samples_enhanced" />
+            </when>
+            <when value="-H">
+                <expand macro="macro_sample" help="The name of the single sample alleles of which should get used for the consensus sequence. This field is optional only if your input VCF dataset specifies exactly one sample."/>
+                <conditional name="haplotype">
+                    <param name="rule" type="select" label="From the selected sample's genotype use ...'">
+                        <option value="">the Nth allele (for both phased and unphased genotypes) (-H N)</option>
+                        <option value="pIu">the Nth allele if the genotype is phased, the IUPAC code representing the genotype if it's unphased (-H NpIu)</option>
+                        <option value="R">the ALT allele where the sample is homozygous, the REF allele otherwise (-H R)</option>
+                        <option value="A">the ALT allele where the sample is homozygous or heterozygous (-H A)</option>
+                        <option value="LR">the ALT allele where the sample is homozygous, the REF allele where it's heterozygous unless the ALT allele is longer (-H LR)</option>
+                        <option value="LA">the ALT allele where the sample is homozygous, the ALT allele where it's heterozygous unless the REF allele is longer (-H LA)</option>
+                        <option value="SR">the ALT allele where the sample is homozygous, the REF allele where it's heterozygous unless the ALT allele is shorter (-H SR</option>
+                        <option value="SA">the ALT allele where the sample is homozygous, the ALT allele where it's heterozygous unless the REF allele is shorter (-H SA)</option>
+                    </param>
+                    <when value="">
+                        <param name="allele_n" type="integer" min="1" value="1" label="where N is" />
+                    </when>
+                    <when value="pIu">
+                        <param name="allele_n" type="integer" min="1" value="1" label="where N is" />
+                    </when>
+                    <when value="R" />
+                    <when value="A" />
+                    <when value="LR" />
+                    <when value="LA" />
+                    <when value="SR" />
+                    <when value="SA" />
+                </conditional>
+            </when>
+        </conditional>
+        <section name="masking_options" expanded="false" title="Masking and marking options" help="The various options in this section are applied in the order they appear, i.e. 1) masking, 2) marking of absent sites, 3) SNV/indel marking.">
+            <param argument="--mask" type="data" format="tabular" multiple="true" optional="true" label="Mask" help="Replace regions according to the next --mask-with option"/>
+            <param argument="--mask-with" type="text" value="" optional="true" label="Mask with" help="Replace with CHAR (skips overlapping variants; default: N); use &quot;uc&quot; or &quot;lc&quot; to change to uppercase or lowercase, respectively. If you have provided more than one Mask dataset and you would like to apply a unique mask for the regions in each of them, then you can specify a comma-separated list of masking instructions (as many as mask datasets)." />
+            <param argument="--absent" type="text" value="" optional="true" label="Mark absent" help="Replace reference bases at positions absent from the VCF input with a custom character.">
+                <validator type="regex">^.$</validator>
             </param>
-            <conditional name="conditional_mask">
-                <param name="selector" type="select" label="Mask file option">
-                    <option value="disabled">Disabled</option>
-                    <option value="enabled">Enabled</option>
+            <param argument="--mark-del" type="text" value="" optional="true" label="Mark deletions" help="Instead of removing the reference base at deleted positions, replace the base with a custom character.">
+                <validator type="regex">^.$</validator>
+            </param>
+            <conditional name="insertions">
+                <param argument="--mark-ins" type="select" label="Mark insertions" help="Highlight insertions in uppercase or lowercase, or by using a fixed character instead of inserted bases, leaving the rest as is">
+                    <option value="">Do not mark insertions</option>
+                    <option value="--mark-ins uc">Uppercase (uc)</option>
+                    <option value="--mark-ins lc">Lowercase (lc)</option>
+                    <option value="--mark-ins">Custom character</option>
                 </param>
-                <when value="disabled"/>
-                <when value="enabled">
-                    <param argument="--mask" type="data" format="tabular" label="Mask" help="Replace regions according to the next --mask-with option" />
-                    <param argument="--mask-with" type="text" value="N" optional="true" label="Mask with" help="Replace with CHAR (skips overlapping variants); change to uppercase (uc) or lowercase (lc)">
-                        <sanitizer invalid_char="">
-                            <valid initial="string.letters,string.digits">
-                                <add value="_" />
-                            </valid>
-                        </sanitizer>
-                        <validator type="regex">[0-9a-zA-Z_]+</validator>
+                <when value="" />
+                <when value="--mark-ins uc" />
+                <when value="--mark-ins lc" />
+                <when value="--mark-ins">
+                    <param name="ins_cutom" type="text" optional="false" label="Character to use instead of an inserted base">
+                        <validator type="empty_field"/>
+                    </param>
+                </when>
+            </conditional>
+            <conditional name="snvs">
+                <param argument="--mark-snv" type="select" label="Mark substitutions" help="Highlight substitutions in uppercase or lowercase, or by using a fixed character instead of substituted bases, leaving the rest as is">
+                    <option value="">Do not mark substitutions</option>
+                    <option value="--mark-snv uc">Uppercase (uc)</option>
+                    <option value="--mark-snv lc">Lowercase (lc)</option>
+                    <option value="--mark-snv">Custom character</option>
+                </param>
+                <when value="" />
+                <when value="--mark-snv uc" />
+                <when value="--mark-snv lc" />
+                <when value="--mark-snv">
+                    <param name="snv_custom" type="text" optional="false" label="Character to use instead of a subtituted base">
+                        <validator type="empty_field"/>
                     </param>
                 </when>
             </conditional>
         </section>
-        <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover" />
-        <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF" />
-        <param argument="--absent" type="text" value="" label="Absent" optional="true" help="It allows to set positions with no supporting evidence to N (or any other character)">
-            <sanitizer invalid_char="">
-                <valid initial="string.letters,string.digits,string.punctuation">
-                    <remove value="@" />
-                    <remove value="'" />
-                </valid>
-            </sanitizer>
-        </param>
-        <section name="sec_restrict" expanded="false" title="Restrict to">    
-            <expand macro="macro_include" />
-            <expand macro="macro_exclude" />
+        <section name="sec_restrict" expanded="false" title="Restrict to">
+            <expand macro="macro_include"/>
+            <expand macro="macro_exclude"/>
+            <expand macro="macro_region_restrict" label_select="Restrict consensus building to only specified regions of reference?"/>
         </section>
+        <param name="chain" type="boolean" truevalue="yes" falsevalue="no" label="Write a chain file for liftover"/>
+        <param name="rename" type="boolean" truevalue="yes" falsevalue="no" label="Set output FASTA ID from name of VCF"/>
     </inputs>
     <outputs>
         <data name="output_file" format="fasta" label="${tool.name} on ${on_string}: consensus fasta"/>
@@ -140,103 +223,172 @@
     </outputs>
     <tests>
         <test expect_num_outputs="2">
-            <expand macro="test_using_reference" ref="consensus.fa" />
-            <param name="input_file" ftype="vcf" value="consensus.vcf" />
-            <param name="mask" ftype="tabular" value="consensus.tab" />
-            <param name="chain" value="True" />
+            <expand macro="test_using_reference" ref="consensus.fa"/>
+            <param name="input_file" ftype="vcf" value="consensus.vcf"/>
+            <section name="masking_options">
+                <param name="mask" ftype="tabular" value="consensus.tab"/>
+            </section>
+            <param name="chain" value="true"/>
             <output name="output_file">
                 <assert_contents>
-                    <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" />
+                    <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN"/>
                 </assert_contents>
             </output>
             <output name="chain_file">
                 <assert_contents>
-                    <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" />
+                    <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1"/>
                 </assert_contents>
             </output>
         </test>
         <test expect_num_outputs="2">
-            <expand macro="test_using_reference" select_from="cached" ref="consensus" />
-            <param name="input_file" ftype="vcf" dbkey="?" value="consensus.vcf" />
-            <param name="mask" ftype="tabular" value="consensus.tab" />
-            <param name="chain" value="True" />
+            <expand macro="test_using_reference" select_from="cached" ref="consensus"/>
+            <param name="input_file" ftype="vcf" dbkey="?" value="consensus.vcf"/>
+            <section name="masking_options">
+                <param name="mask" ftype="tabular" value="consensus.tab"/>
+            </section>
+            <param name="chain" value="true"/>
             <output name="output_file">
                 <assert_contents>
-                    <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN" />
+                    <has_text text="NNNNNNNNNNNNNNNNNNNNNNNNNN"/>
                 </assert_contents>
             </output>
             <output name="chain_file">
                 <assert_contents>
-                    <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1" />
+                    <has_text text="chain 497 1 501 + 1 501 1 502 + 1 502 1"/>
                 </assert_contents>
             </output>
         </test>
         <test expect_num_outputs="1">
-            <expand macro="test_using_reference" ref="consensus.fa" />
-            <param name="input_file" ftype="vcf" value="consensus.vcf" />
-            <param name="mask" ftype="tabular" value="consensus.tab" />
-            <param name="chain" value="False" />
-            <param name="rename" value="True" />
+            <expand macro="test_using_reference" ref="consensus.fa"/>
+            <param name="input_file" ftype="vcf" value="consensus.vcf"/>
+            <section name="masking_options">
+                <param name="mask" ftype="tabular" value="consensus.tab"/>
+            </section>
+            <param name="chain" value="false"/>
+            <param name="rename" value="true"/>
             <output name="output_file">
                 <assert_contents>
-                    <has_text text=">consensus.vcf" />
+                    <has_text text="&gt;consensus.vcf"/>
                 </assert_contents>
                 <assert_contents>
-                    <has_text text=">consensus.vcf-2" />
+                    <has_text text="&gt;consensus.vcf-2"/>
                 </assert_contents>
             </output>
         </test>
         <test expect_num_outputs="1">
-            <expand macro="test_using_reference" ref="consensus.fa" />
-            <param name="input_file" ftype="vcf" value="consensus.vcf" />
+            <expand macro="test_using_reference" ref="consensus.fa"/>
+            <param name="input_file" ftype="vcf" value="consensus.vcf"/>
+            <conditional name="mode">
+                <param name="select" value="-s -"/>
+            </conditional>
             <section name="sec_restrict">
-                <param name="include" value='TYPE="snp"' />
+                <param name="include" value="TYPE=&quot;snp&quot;"/>
             </section>
             <output name="output_file">
                 <assert_contents>
-                    <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" />
+                    <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA"/>
                 </assert_contents>
             </output>
         </test>
         <!--Test absent option-->
         <test expect_num_outputs="1">
-            <expand macro="test_using_reference" ref="consensus.fa" />
-            <param name="input_file" ftype="vcf" value="consensus.vcf" />
+            <expand macro="test_using_reference" ref="consensus.fa"/>
+            <param name="input_file" ftype="vcf" value="consensus.vcf"/>
+            <conditional name="mode">
+                <param name="select" value="-s -"/>
+            </conditional>
+            <section name="masking_options">
+                <param name="absent" value="W"/>
+            </section>
             <section name="sec_restrict">
-                <param name="include" value='TYPE="snp"' />
+                <param name="include" value="TYPE=&quot;snp&quot;"/>
             </section>
-            <param name="absent" value="W"/>
             <output name="output_file">
                 <assert_contents>
-                    <has_text text="WWWAWAWWAWWWWWWWWCWWWWWWWW" />
+                    <has_text text="WWWAWAWWAWWWWWWWWCWWWWWWWW"/>
+                </assert_contents>
+            </output>
+            <assert_command>
+                <has_text text="--absent"/>
+            </assert_command>
+        </test>
+        <test expect_num_outputs="1">
+            <expand macro="test_using_reference" ref="consensus.fa"/>
+            <param name="input_file" ftype="vcf" value="consensus.vcf"/>
+            <conditional name="mode">
+                <param name="select" value="-s -"/>
+            </conditional>
+            <section name="masking_options">
+                <param name="mark_del" value="-"/>
+                <conditional name="insertions">
+                    <param name="mark_ins" value="--mark-ins uc"/>
+                </conditional>
+                <conditional name="snvs">
+                    <param name="mark_snv" value="--mark-snv uc"/>
+                </conditional>
+            </section>
+            <section name="sec_restrict">
+                <param name="include" value="TYPE=&quot;snp&quot;"/>
+            </section>
+            <output name="output_file">
+                <assert_contents>
+                    <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA"/>
                 </assert_contents>
             </output>
             <assert_command>
-                <has_text text="--absent" />
+                <has_text text="--mark-del"/>
+                <has_text text="--mark-ins"/>
+                <has_text text="--mark-snv"/>
             </assert_command>
         </test>
-        <!--Test mask options -->
         <test expect_num_outputs="1">
-            <expand macro="test_using_reference" ref="consensus.fa" />
-            <param name="input_file" ftype="vcf" value="consensus.vcf" />
+            <expand macro="test_using_reference" ref="csq.fa"/>
+            <param name="input_file" ftype="vcf" value="csq.vcf"/>
+            <section name="masking_options">
+                <param name="absent" value="."/>
+                <param name="mark_del" value="-"/>
+            </section>
             <section name="sec_restrict">
-                <param name="include" value='TYPE="snp"' />
-            </section>
-            <section name="sec_default">
-                <param name="mark_del" value="DEL"/>
-                <param name="mark_ins" value="uc"/>
-                <param name="mark_snv" value="uc"/>
+                <conditional name="regions">
+                    <param name="regions_src" value="regions"/>
+                    <repeat name="region_specs">
+                        <param name="chrom" value="1"/>
+                        <param name="start" value="161"/>
+                        <param name="stop" value="190"/>
+                    </repeat>
+                </conditional>
             </section>
             <output name="output_file">
                 <assert_contents>
-                    <has_text text="TACAAAATATGACATATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGA" />
+                    <has_line line="&gt;1:161-190"/>
+                    <has_line line="-............................Y"/>
                 </assert_contents>
             </output>
-            <assert_command>
-                <has_text text="--mark-del" />
-                <has_text text="--mark-ins" />
-                <has_text text="--mark-snv" />
-            </assert_command>
+        </test>
+        <test expect_num_outputs="1">
+            <expand macro="test_using_reference" ref="csq.fa"/>
+            <param name="input_file" ftype="vcf" value="csq.vcf"/>
+            <section name="masking_options">
+                <param name="absent" value="."/>
+                <param name="mark_del" value="-"/>
+            </section>
+            <section name="sec_restrict">
+                <conditional name="regions">
+                    <param name="regions_src" value="regions"/>
+                    <repeat name="region_specs">
+                        <param name="chrom" value="1"/>
+                        <param name="start" value="161"/>
+                        <param name="stop" value="190"/>
+                    </repeat>
+                    <param name="regions_overlap" value="0"/>
+                </conditional>
+            </section>
+            <output name="output_file">
+                <assert_contents>
+                    <has_line line="&gt;1:161-190"/>
+                    <has_line line=".............................Y"/>
+                </assert_contents>
+            </output>
         </test>
     </tests>
     <help><![CDATA[
@@ -249,7 +401,7 @@
 
 @BCFTOOLS_MANPAGE@#@EXECUTABLE@
 
-@BCFTOOLS_WIKI@
+@BCFTOOLS_HOWTOS@
 
 The option to set the new consensus' FASTA ID from the name of the VCF is provided by post-processing
 the bcftools consensus output. It is primarily intended for use when the VCF is coming from a list
@@ -258,5 +410,5 @@
 alignment to a phylogeny program.
 ]]>
     </help>
-    <expand macro="citations" />
+    <expand macro="citations"/>
 </tool>
diff -r 8aa352093d73 -r 9a260f6fab93 macros.xml
--- a/macros.xml	Sun Aug 18 10:23:11 2024 +0000
+++ b/macros.xml	Tue Dec 02 08:22:20 2025 +0000
@@ -1,7 +1,7 @@
 <macros>
-  <token name="@TOOL_VERSION@">1.15.1</token>
-  <token name="@VERSION_SUFFIX@">4</token>
-  <token name="@PROFILE@">20.01</token>
+  <token name="@TOOL_VERSION@">1.22</token>
+  <token name="@VERSION_SUFFIX@">0</token>
+  <token name="@PROFILE@">24.1</token>
   <xml name="bio_tools">
       <xrefs>
           <xref type="bio.tools">bcftools</xref>
@@ -10,15 +10,15 @@
   <xml name="requirements">
     <requirements>
       <requirement type="package" version="@TOOL_VERSION@">bcftools</requirement>
-      <requirement type="package" version="1.15.1">htslib</requirement>
+      <requirement type="package" version="1.22.1">htslib</requirement>
       <yield />
     </requirements>
   </xml>
   <xml name="samtools_requirement">
-      <requirement type="package" version="1.15.1">samtools</requirement>
+      <requirement type="package" version="1.22.1">samtools</requirement>
   </xml>
   <xml name="matplotlib_requirement">
-      <requirement type="package" version="3.5.3">matplotlib</requirement>
+      <requirement type="package" version="3.10.7">matplotlib</requirement>
   </xml>
   <xml name="version_command">
     <version_command>bcftools 2&gt;&amp;1 | grep 'Version:'</version_command>
@@ -30,16 +30,11 @@
       <yield />
     </citations>
   </xml>
-  <token name="@BCFTOOLS_WIKI@">https://github.com/samtools/bcftools/wiki</token>
-  <token name="@BCFTOOLS_MANPAGE@">http://samtools.github.io/bcftools/bcftools.html</token>
+  <token name="@BCFTOOLS_HOWTOS@">https://samtools.github.io/bcftools/howtos/index.html</token>
+  <token name="@BCFTOOLS_MANPAGE@">https://www.htslib.org/doc/bcftools.html</token>
   <token name="@THREADS@">
   --threads \${GALAXY_SLOTS:-4}
   </token>
-  <token name="@PREPARE_ENV@">
-<![CDATA[
-export BCFTOOLS_PLUGINS=`which bcftools | sed 's,bin/bcftools,libexec/bcftools,'`;
-]]>
-  </token>
   <xml name="macro_input">
     <!-- 
     REQUIRES https://github.com/galaxyproject/galaxy/pull/14605/files
@@ -294,8 +289,8 @@
     help="inverts the query/filtering applied by the targets" />
   </xml>
 
-  <xml name="macro_restriction_spec" token_type="region" token_label_type="Region">
-    <repeat name="@TYPE@s" title="@LABEL_TYPE@ Filter" default="1" min="1">
+  <xml name="macro_restriction_spec" tokens="type,label_type">
+    <repeat name="@TYPE@_specs" title="@LABEL_TYPE@ Filter" default="1" min="1">
         <param name="chrom" type="text" label="@LABEL_TYPE@ chromosome">
             <validator type="expression" message="A chromosome identifier is required when specifying a @LABEL_TYPE@ filter">value.strip()</validator>
         </param>
@@ -305,36 +300,85 @@
         <param name="stop" type="text" label="@LABEL_TYPE@ end position">
             <validator type="expression" message="an integer number is required">not value or value.isdigit()</validator>
         </param>
-        <yield />
     </repeat>
   </xml>
 
-  <xml name="macro_restrictions_file" token_type="region" token_label_type="Region">
+  <xml name="macro_restrictions_file" tokens="type,label_type">
     <param name="@TYPE@s_file" type="data" format="tabular" label="@LABEL_TYPE@s File" help="restrict to @LABEL_TYPE@s listed in a file" />
   </xml>
 
-  <xml name="macro_restrict" token_type="region" token_label_type="Region" >
+  <xml name="__macro_restrict__" tokens="type,label_select,label_type,pos_is_default,rec_is_default">
     <conditional name="@TYPE@s">
-        <param name="@TYPE@s_src" type="select" label="@LABEL_TYPE@s">
-            <option value="__none__">Do not restrict to @LABEL_TYPE@s</option>
-            <option value="@TYPE@s">Specify one or more @LABEL_TYPE@(s) directly</option>
-            <option value="@TYPE@s_file">Operate on @LABEL_TYPE@s specified in a history dataset</option>
+      <param name="@TYPE@s_src" type="select" label="@LABEL_SELECT@">
+        <option value="__none__">Do not restrict to @LABEL_TYPE@s</option>
+        <option value="@TYPE@s">Specify one or more @LABEL_TYPE@(s) directly</option>
+        <option value="@TYPE@s_file">Operate on @LABEL_TYPE@s specified in a history dataset</option>
+      </param>
+      <when value="__none__"/>
+      <when value="@TYPE@s">
+        <expand macro="macro_restriction_spec" type="@TYPE@" label_type="@LABEL_TYPE@" />
+        <yield />
+        <param argument="--@TYPE@s-overlap" type="select" label="Consider variant calls with partial overlap with @LABEL_TYPE@(s) if ..." help="Set to 0 if the record has to have POS inside a region; set to 1 if also overlapping records with POS outside a region should be included (this includes indels with POS at the end of a region, which are technically outside the region); or set to 2 to include only true overlapping variation (compare the full VCF representation 'TA>T-' vs the true sequence variation 'A>-').">
+          <option value="0" selected="@POS_IS_DEFAULT@">0: the variant's POS falls in the region</option>
+          <option value="1" selected="@REC_IS_DEFAULT@">1: any part of the variant's representation overlaps the region</option>
+          <option value="2">2: the variant's actual sequence change falls in the region</option>
+        </param>
+      </when>
+      <when value="@TYPE@s_file">
+        <expand macro="macro_restrictions_file" type="@TYPE@" label_type="@LABEL_TYPE@" />
+        <yield />
+        <param argument="--@TYPE@s-overlap" type="select" label="@LABEL_TYPE@ overlap" help="Include if POS in the region (0), record overlaps (1), variant overlaps (2)">
+          <option value="0" selected="@POS_IS_DEFAULT@">0: POS in the region</option>
+          <option value="1" selected="@REC_IS_DEFAULT@">1: Record overlaps</option>
+          <option value="2">2: Variant overlaps</option>
         </param>
-        <when value="__none__"/>
-        <when value="@TYPE@s">
-            <expand macro="macro_restriction_spec" type="@TYPE@" label_type="@LABEL_TYPE@" />
-            <yield />
-        </when>
-        <when value="@TYPE@s_file">
-            <expand macro="macro_restrictions_file" type="@TYPE@" label_type="@LABEL_TYPE@" />
-            <yield />
-        </when>        
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="__macro_restrict_simple__" tokens="type,label_select,label_type">
+    <conditional name="@TYPE@s">
+      <param name="@TYPE@s_src" type="select" label="@LABEL_SELECT@">
+        <option value="__none__">Do not restrict to @LABEL_TYPE@s</option>
+        <option value="@TYPE@s">Specify one or more @LABEL_TYPE@(s) directly</option>
+        <option value="@TYPE@s_file">Operate on @LABEL_TYPE@s specified in a history dataset</option>
+      </param>
+      <when value="__none__"/>
+      <when value="@TYPE@s">
+        <expand macro="macro_restriction_spec" type="@TYPE@" label_type="@LABEL_TYPE@" />
+        <yield />
+      </when>
+      <when value="@TYPE@s_file">
+        <expand macro="macro_restrictions_file" type="@TYPE@" label_type="@LABEL_TYPE@" />
+        <yield />
+      </when>
     </conditional>
-    <param argument="--@TYPE@s-overlap" type="select" optional="true" label="@LABEL_TYPE@ overlap" help="Include if POS in the region (0), record overlaps (1), variant overlaps (2)">
-        <option value="0">0: POS in the region</option>
-        <option value="1">1: Record overlaps</option>
-        <option value="2">2: Variant overlaps</option>
-    </param>
+  </xml>
+
+  <xml name="macro_region_restrict" token_label_select="Regions">
+    <expand macro="__macro_restrict__" type="region" label_select="@LABEL_SELECT@" label_type="Region" pos_is_default="false" rec_is_default="true" />
+  </xml>
+
+  <xml name="macro_region_restrict_simple" token_label_select="Regions">
+    <!-- To be used with subcommands that don't support the 'regions-overlap' option. Currently only mpileup? -->
+    <expand macro="__macro_restrict_simple__" type="region" label_select="@LABEL_SELECT@" label_type="Region" />
+  </xml>
+
+  <xml name="macro_target_restrict">
+    <expand macro="__macro_restrict__" type="target" label_select="Target" label_type="Target" pos_is_default="true" rec_is_default="false">
+      <expand macro="macro_invert_targets" />
+    </expand>
+  </xml>
+
+  <xml name="macro_target_restrict_simple">
+    <!-- To be used with subcommands that don't support the 'regions-overlap' option. Currently only mpileup and call? -->
+    <expand macro="__macro_restrict_simple__" type="target" label_select="Target" label_type="Target">
+      <expand macro="macro_invert_targets" />
+    </expand>
+  </xml>
+
+  <xml name="macro_mask_restrict">
+    <expand macro="__macro_restrict__" type="mask" label_select="Mask" label_type="Mask" pos_is_default="false" rec_is_default="true" />
   </xml>
 
   <token name="@PARSE_INTERVALS@">
@@ -345,7 +389,7 @@
   #set $start = str($i.start).strip()
   #set $stop = str($i.stop).strip()
   #if $start or $stop:
-    $components.append($chrom + ':' + ($start or '0') + '-' + $stop)
+    $components.append($chrom + ':' + ($start or '1') + '-' + $stop)
   #else:
     $components.append($chrom)
   #end if
@@ -357,18 +401,14 @@
   <token name="@MASK@">
 <![CDATA[
 #if $section.conditional_soft_filter.selector == 'enabled' and $section.conditional_soft_filter.soft_filter
-  #if $section.conditional_soft_filter.masks.masks_src == 'regions':
-    #set $intervals = $section.conditional_soft_filter.masks.masks
-    @PARSE_INTERVALS@
-    --mask '$intervals_spec'
-  #elif $section.conditional_soft_filter.masks.masks_src == 'masks_file' and $section.conditional_soft_filter.masks.masks_file:
-    #if $masks_path is not None:
-      --mask-file '$masks_path'
-    #else:
+  #if $section.conditional_soft_filter.masks.masks_src != '__none__':
+    #if $section.conditional_soft_filter.masks.masks_src == 'masks':
+      #set $intervals = $section.conditional_soft_filter.masks.mask_specs
+      @PARSE_INTERVALS@
+      --mask '$intervals_spec'
+    #elif $section.conditional_soft_filter.masks.masks_src == 'masks_file':
       --mask-file '$section.conditional_soft_filter.masks.masks_file'
     #end if
-  #end if
-  #if $section.conditional_soft_filter.masks_overlap
     --mask-overlap $section.conditional_soft_filter.masks_overlap
   #end if
 #end if
@@ -378,37 +418,42 @@
 
   <token name="@REGIONS@">
 <![CDATA[
-#if $section.regions.regions_src == 'regions':
-  #set $intervals = $section.regions.regions
-  @PARSE_INTERVALS@
-  --regions '$intervals_spec'
-#elif $section.regions.regions_src == 'regions_file' and $section.regions.regions_file:
-  #if $regions_path is not None:
-    --regions-file '$regions_path'
-  #else:
-    --regions-file '$section.regions.regions_file'
+#if $section.regions.regions_src != '__none__':
+  #if $section.regions.regions_src == 'regions':
+    #set $intervals = $section.regions.region_specs
+    @PARSE_INTERVALS@
+    --regions '$intervals_spec'
+  #elif $section.regions.regions_src == 'regions_file':
+    #if $regions_path is not None:
+      --regions-file '$regions_path'
+    #else:
+      --regions-file '$section.regions.regions_file'
+    #end if
+  #end if
+  #if 'regions_overlap' in $section.regions:
+    --regions-overlap $section.regions.regions_overlap
   #end if
 #end if
-#if $section.regions_overlap
-  --regions-overlap $section.regions_overlap
-#end if
-
 ]]>
   </token>
   
   <token name="@TARGETS@">
 <![CDATA[
-#if $targets_path:
-  --targets-file "${section.targets.invert_targets_file}${targets_path}"
-#elif $section.targets.targets_src == 'targets':
-  #set $intervals = $section.targets.targets
-  @PARSE_INTERVALS@
-  --targets '${section.targets.invert_targets_file}$intervals_spec'
-#elif $section.targets.targets_src == 'targets_file' and $section.targets.targets_file:
-  --targets-file "${section.targets.invert_targets_file}${section.targets.targets_file}"
-#end if
-#if $section.targets_overlap
-  --targets-overlap $section.targets_overlap
+#if $section.targets.targets_src != '__none__':
+  #if $section.targets.targets_src == 'targets':
+    #set $intervals = $section.targets.target_specs
+    @PARSE_INTERVALS@
+    --targets '${section.targets.invert_targets_file}$intervals_spec'
+  #elif $section.targets.targets_src == 'targets_file':
+    #if $targets_path:
+      --targets-file '${section.targets.invert_targets_file}${targets_path}'
+    #else:
+      --targets-file '${section.targets.invert_targets_file}${section.targets.targets_file}'
+    #end if
+  #end if
+  #if 'targets_overlap' in $section.targets:
+    --targets-overlap $section.targets.targets_overlap
+  #end if
 #end if
 ]]>
   </token>
@@ -417,7 +462,7 @@
 <![CDATA[
 #set $regions_path = None
 #if 'regions' in $section
-  #if $section.regions.regions_src == 'regions_file' and $section.regions.regions_file:
+  #if $section.regions.regions_src == 'regions_file':
     #if $section.regions.regions_file.ext.startswith('bed'):
       #set $regions_path = 'regions_file.bed'
       ln -s '$section.regions.regions_file' $regions_path &&
@@ -461,11 +506,31 @@
       </param>
       <param name="invert_samples" type="boolean" truevalue="^" falsevalue="" checked="false" label="Invert Samples"
              help="Inverts the query/filtering applied by Samples (adds &quot;^&quot; prefix to exclude)" />
-      <param argument="--samples_file" type="data" format="tabular" optional="true" label="Samples file"
-             help="File of samples to include" />
+      <param argument="--samples_file" type="data" format="tabular" optional="true" label="Samples file" help="File of samples to include" />
       <param name="invert_samples_file" type="boolean" truevalue="^" falsevalue="" checked="false" label="Invert Samples file"
              help="inverts the query/filtering applied by Samples file" />
   </xml>
+
+  <xml name="macro_samples_enhanced" token_all_samples="" token_file_help="File listing samples to include one per line.">
+      <conditional name="specify_samples">
+          <param name="how" type="select" label="How do you want to select samples?">
+              <option value="-s">Specify samples manually</option>
+              <option value="-S">Provide sample file</option>
+              <option value="@ALL_SAMPLES@" selected="true">No selection; just use all samples found in input</option>
+          </param>
+          <when value="-s">
+              <param argument="--samples" name="samples_spec" type="text" optional="false" label="Sample(s)" help="Specify a single sample by name or a comma-separated list of sample names.">
+                <validator type="expression" message="Please specify a single sample by name or a comma-separated list of sample names">value.strip() and value[0] not in "^," and ",," not in value</validator>
+              </param>
+              <param name="invert_samples" type="boolean" truevalue="^" falsevalue="" label="Exclude these samples instead of including them?" help="Equivalent to prefixing the list of samples with &quot;^&quot; on the command line."/>
+          </when>
+          <when value="-S">
+              <param argument="--samples_file" type="data" format="tabular" optional="@IS_OPTIONAL@" label="Samples file" help="@FILE_HELP@" />
+              <param name="invert_samples" type="boolean" truevalue="^" falsevalue="" label="Exclude the samples listed in the file instead of including them?" help="Equivalent to prefixing the file with &quot;^&quot; on the command line."/>
+          </when>
+          <when value="@ALL_SAMPLES@" />
+      </conditional>
+  </xml>
   <token name="@SAMPLES@">
 #set $samples_defined = False
 #if str($section.samples) != '':
@@ -478,8 +543,8 @@
 #end if
   </token>
 
-  <xml name="macro_sample">
-      <param name="sample" type="text" optional="true" label="Sample" help="Apply variants of the given sample" />
+  <xml name="macro_sample" token_help="Apply variants of the given sample">
+      <param name="sample" type="text" optional="true" label="Sample" help="@HELP@" />
   </xml>
   <token name="@SAMPLE@">
 #if $section.sample: