Mercurial > repos > iuc > bedtools
changeset 1:82aac94b06c3 draft
Uploaded
line wrap: on
line diff
--- a/Bed12ToBed6.xml Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,28 +0,0 @@ -<tool id="bedtools_bed12tobed6" name="Convert from BED12 to BED6" version="@WRAPPER_VERSION@.0"> - <description></description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements" /> - <expand macro="stdio" /> - <command> - bed12ToBed16 - -i '$input' - > '$output' - </command> - <inputs> - <param format="bed" name="input" type="data" label="Convert the following BED12 file to BED6"/> - </inputs> - <outputs> - <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED6)"/> - </outputs> - <help> - -**What it does** - -bed12ToBed6 is a convenience tool that converts BED features in BED12 (a.k.a. “blocked” BED features such as genes) to discrete BED6 features. For example, in the case of a gene with six exons, bed12ToBed6 would create six separate BED6 features (i.e., one for each exon). - -@REFERENCES@ - </help> - <expand macro="citations" /> -</tool>
--- a/BedToBam.xml Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,34 +0,0 @@ -<tool id="bedtools_bedtobam" name="Convert from BED to BAM" version="@WRAPPER_VERSION@.0"> - <description></description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements" /> - <expand macro="stdio" /> - <command> - bedtools bedtobam - $ubam - $bed12 - -mapq $mapq - -i '$input' - > '$output' - </command> - <inputs> - <param format="bed" name="input" type="data" label="Convert the following BED file to BAM"/> - <param name="bed12" type="boolean" label="Indicate that the input BED file is in BED12 (a.k.a “blocked” BED) format" truevalue="-bed12" falsevalue="" checked="false" help="If Selected, bedToBam will convert blocked BED features (e.g., gene annotaions) into “spliced” BAM alignments by creating an appropriate CIGAR string.."/> - <param name="mapq" type="integer" label="Set a mapping quality (SAM MAPQ field) value for all BED entries" value="255" /> - <param name="ubam" type="boolean" label="Write uncompressed BAM output." truevalue="-ubam" falsevalue="" checked="false"/> - </inputs> - <outputs> - <data format="bam" name="output" metadata_source="input" label="${input.name} (as BAM)"/> - </outputs> - <help> - -**What it does** - -bedToBam converts features in a feature file to BAM format. This is useful as an efficient means of storing large genome annotations in a compact, indexed format for visualization purposes. - -@REFERENCES@ - </help> - <expand macro="citations" /> -</tool>
--- a/annotateBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/annotateBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,23 +6,28 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools annotate - -i $inputA - -files - #for $bed in $names.beds: - $bed.input - #end for + -i "${inputA}" + #if $names.names_select == 'yes': + -files + #for $bed in $names.beds: + "${bed.input}" + #end for - #if $names.names_select == 'yes': -names #for $bed in $names.beds: - $bed.inputName + "${bed.inputName}" #end for + #else: + #set files = '" "'.join( [ str( $file ) for $file in $names.beds ] ) + -files "${files}" #end if $strand $counts $both - > $output + > "${output}" +]]> </command> <inputs> <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file" /> @@ -39,28 +44,36 @@ </repeat> </when> <when value="no"> - <repeat name="beds" title="Add BED files" > - <param name="input" format="bed" type="data" label="BED file" /> - </repeat> + <param name="beds" format="bed" multiple="True" type="data" label="BED file" /> </when> </conditional> - <expand macro="strand2" /> - <param name="counts" type="boolean" checked="false" truevalue="-counts" falsevalue="" label="Report the count of features followed by the % coverage for each annotation file. Default is to report solely the fraction of -i covered by each file." /> - <param name="both" type="boolean" checked="false" truevalue="-both" falsevalue="" label="Report the count of features followed by the % coverage for each annotation file. Default is to report solely the fraction of the input file covered by each file." /> + <param name="counts" type="boolean" checked="false" truevalue="-counts" falsevalue="" + label="Report the count of features followed by the % coverage for each annotation file" + help="Default is to report solely the fraction of -i covered by each file." /> + <param name="both" type="boolean" checked="false" truevalue="-both" falsevalue="" + label="Report the count of features followed by the % coverage for each annotation file" + help="Default is to report solely the fraction of the input file covered by each file." /> </inputs> - <outputs> - <data format="bed" name="output" label="" /> + <data format="bed" name="output" /> </outputs> + <tests> + <test> + <param name="inputA" value="annotateBed1.bed" ftype="bed" /> + <param name="names_select" value="no" /> + <param name="beds" value="annotateBed2.bed,annotateBed3.bed,annotateBed4.bed" /> + <output name="output" file="annotateBed_result.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools annotate, well, annotates one BED/VCF/GFF file with the coverage and number of overlaps observed from multiple other BED/VCF/GFF files. In this way, it allows one to ask to what degree one feature coincides with multiple other feature types with a single command. @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/bamToBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/bamToBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,14 +6,17 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - bedtools bamtobed - $option +<![CDATA[ + bedtools bamtobed + $option $ed_score - -i '$input' - > '$output' - #if str($tag): - -tag $tag + $split + #if $tag and str($tag).strip(): + -tag "${tag}" #end if + -i "${input}" + > "${output}" +]]> </command> <inputs> <param format="bam" name="input" type="data" label="Convert the following BAM file to BED"/> @@ -22,15 +25,31 @@ <option value="-bed12">Create a full, 12-column "blocked" BED file.</option> <option value="-bedpe">Create a paired-end, BEDPE format.</option> </param> - <param name="split" type="boolean" label="Report each portion of a split BAM alignment" truevalue="-split" falsevalue="" checked="false" help="(i.e., having an 'N' CIGAR operation) as a distinct BED intervals."/> - <param name="ed_score" type="boolean" label="Use alignment's edit-distance for BED score" truevalue="-ed" falsevalue="" checked="false"/> - <param name="tag" type="text" optional="true" label="Use other NUMERIC BAM alignment tag as the BED score"/> + <expand macro="split" /> + <param name="ed_score" type="boolean" truevalue="-ed" falsevalue="" checked="false" + label="Use alignment's edit-distance for BED score" /> + <param name="tag" type="text" optional="true" label="Use other NUMERIC BAM alignment tag as the BED score" + help="(-tag)"/> </inputs> <outputs> <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED)"/> </outputs> -<help> - + <tests> + <test> + <param name="input" value="srma_in3.bam" ftype="bam" /> + <param name="option" value="" /> + <param name="tag" value="" /> + <output name="output" file="bamToBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="input" value="srma_in3.bam" ftype="bam" /> + <param name="option" value="" /> + <param name="tag" value="NM" /> + <output name="output" file="bamToBed_result2.bed" ftype="bed" /> + </test> + </tests> + <help> +<![CDATA[ **What it does** bedtools bamtobed is a conversion utility that converts sequence alignments in BAM format into BED, BED12, and/or BEDPE records. @@ -49,7 +68,7 @@ If creating a BEDPE output (see output formatting options), the BAM file should be sorted by query name. @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/bamToFastq.xml Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,33 +0,0 @@ -<tool id="bedtools_bamtofastq" name="Convert from BAM to FastQ" version="@WRAPPER_VERSION@.0"> - <description></description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements" /> - <expand macro="stdio" /> - <command> - bedtools bamtofastq - $tags - $fq2 - -i '$input' - -fq '$output' - </command> - <inputs> - <param format="bam" name="input" type="data" label="Convert the following BAM file to FASTQ"/> - <param name="tags" type="boolean" truevalue="-tags" falsevalue="" selected="False" label="Create FASTQ based on the mate info in the BAM R2 and Q2 tags."/> - <param name="fq2" type="boolean" truevalue="-fq2" falsevalue="" selected="False" label="ASTQ for second end. Used if BAM contains paired-end data. BAM should be sorted by query name if creating paired FASTQ with this option."/> - </inputs> - <outputs> - <data format="fastq" name="output" metadata_source="input" label="${input.name} (as FASTQ)"/> - </outputs> -<help> - -**What it does** - -bedtools bamtofastq is a conversion utility for extracting FASTQ records from sequence alignments in BAM format. - -@REFERENCES@ - - </help> - <expand macro="citations" /> -</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bed12ToBed6.xml Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,37 @@ +<tool id="bedtools_bed12tobed6" name="BED12 to BED6" version="@WRAPPER_VERSION@.0"> + <description>converter</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + bed12ToBed6 + -i '$input' + > '$output' +]]> + </command> + <inputs> + <param format="bed" name="input" type="data" label="Convert the following BED12 file to BED6"/> + </inputs> + <outputs> + <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED6)"/> + </outputs> + <tests> + <test> + <param name="input" value="bed12.bed" ftype="bed" /> + <output name="output" file="bed12ToBed6_result1.bed" ftype="bed" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +bed12ToBed6 is a convenience tool that converts BED features in BED12 (a.k.a. “blocked” BED features such as genes) to discrete BED6 features. For example, in the case of a gene with six exons, bed12ToBed6 would create six separate BED6 features (i.e., one for each exon). + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bedToBam.xml Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,47 @@ +<tool id="bedtools_bedtobam" name="Convert from BED to BAM" version="@WRAPPER_VERSION@.0"> + <description></description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + bedtools bedtobam + $bed12 + -mapq $mapq + -g $genome + -i '$input' + > '$output' +]]> + </command> + <inputs> + <param format="bed" name="input" type="data" label="Convert the following BED file to BAM"/> + <param name="bed12" type="boolean" truevalue="-bed12" falsevalue="" checked="false" + label="Indicate that the input BED file is in BED12 (a.k.a 'blocked' BED) format" + help="If Selected, bedToBam will convert blocked BED features (e.g., gene annotaions) into 'spliced' BAM alignments by creating an appropriate CIGAR string. (-bed12)"/> + <expand macro="genome" /> + <param name="mapq" type="integer" value="255" + label="Set a mapping quality (SAM MAPQ field) value for all BED entries" help="(-mapq)"/> + </inputs> + <outputs> + <data format="bam" name="output" metadata_source="input" label="${input.name} (as BAM)"/> + </outputs> + <tests> + <test> + <param name="input" value="bedToBam1.bed" ftype="bed" /> + <param name="genome" value="mm9_chr1.len" ftype="tabular" /> + <output name="output" file="bedToBam_result.bam" lines_diff="2" ftype="bam" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +bedToBam converts features in a feature file to BAM format. This is useful as an efficient means of storing large genome annotations in a compact, indexed format for visualization purposes. + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- a/bedpeToBam.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/bedpeToBam.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,24 +6,33 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools bedpetobam - $ubam - -mapq $mapq - -i '$input' - -g $genome - > '$output' + -mapq $mapq + -i '$input' + -g $genome + > '$output' +]]> </command> <inputs> - <param format="bed,gff,vcf" name="input" type="data" label="BED/VCF/GFF file"/> + <param name="input" format="bed,gff,vcf" type="data" label="BED/VCF/GFF file"/> <expand macro="genome" /> - <param name="mapq" type="integer" label="Set a mapping quality (SAM MAPQ field) value for all BED entries" value="255" /> - <param name="ubam" type="boolean" label="Write uncompressed BAM output." truevalue="-ubam" falsevalue="" checked="false"/> + <param name="mapq" type="integer" value="255" + label="Set a mapping quality (SAM MAPQ field) value for all BED entries" + help="(-mapq)" /> </inputs> <outputs> - <data format="bam" name="output" metadata_source="input" label="${input.name} (as BAM)"/> + <data format="bam" name="output" metadata_source="input"/> </outputs> + <tests> + <test> + <param name="input" value="bedpeToBamBed1.bed" ftype="bed" /> + <param name="genome" value="mm9.len"/> + <output name="output" file="bedpeToBam_result1.bam" lines_diff="72" ftype="bam" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Converts feature records to BAM format. @@ -33,6 +42,7 @@ BED files must be at least BED4 to create BAM (needs name field). @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/closestBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/closestBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,37 +6,138 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ + #set inputBs = ' '.join( [ str( $file ) for $file in $inputB ] ) + closestBed $strand $addition + #if $addition2.addition2_select: + -D $addition2.addition2_select + $addition2.iu + $addition2.id + #end if + $io + -mdb $mdb -t $ties -a $inputA - -b $inputB - > $output + -b $inputBs + > $output +]]> </command> <inputs> <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="overlap intervals in this BED/VCF/GFF file?"/> + <param format="bed,gff,vcf,gff3" name="inputB" type="data" multiple="True" label="overlap intervals in this BED/VCF/GFF file?"/> - <param name="ties" type="select" label="How ties for closest feature should be handled" help="This occurs when two features in B have exactly the same overlap with a feature in A."> + <param name="ties" type="select" + label="How ties for closest feature should be handled" + help="This occurs when two features in B have exactly the same overlap with a feature in A."> <option value="all" selected="True">all - Report all ties (default)</option> <option value="first">first - Report the first tie that occurred in the B file</option> <option value="last">last - Report the last tie that occurred in the B file</option> </param> - <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Force strandedness" help="That is, find the closest feature in B overlaps A on the same strand. By default, this is disabled" /> - <param name="addition" type="boolean" checked="false" truevalue="-d" falsevalue="" label="In addition to the closest feature in B, report its distance to A as an extra column. The reported distance for overlapping features will be 0" /> + <expand macro="strand2" /> + + <param name="addition" type="boolean" checked="false" truevalue="-d" falsevalue="" + label="In addition to the closest feature in B, report its distance to A as an extra column" + help="The reported distance for overlapping features will be 0. (-d)" /> + + <conditional name="addition2"> + <param name="addition2_select" type="select" optional="True" + label="Add additional columns to report distance to upstream feature. Distance defintion" + help="Like -d, report the closest feature in B, and its distance to A as an extra column. However unlike -d, use negative distances to report upstream features. (-D)"> + <option value="" selected="True">Do not report the distance et all.</option> + <option value="ref">Report distance with respect to the reference genome. B features with a lower (start, stop) are upstream. (-ref)</option> + <option value="a">Report distance with respect to A. When A is on the - strand, "upstream" means B has a higher (start,stop). (-a)</option> + <option value="b">Report distance with respect to B. When B is on the - strand, "upstream" means A has a higher (start,stop). (-b)</option> + </param> + <when value="ref"> + <param name="iu" type="boolean" checked="false" truevalue="-iu" falsevalue="" + label="Ignore features in B that are upstream of features in A" + help="This option requires -D and follows its orientation rules for determining what is 'upstream'. (-iu)" /> + + <param name="id" type="boolean" checked="false" truevalue="-id" falsevalue="" + label="Ignore features in B that are downstream of features in A" + help="This option requires -D and follows its orientation rules for determining what is 'downstream'. (-id)" /> + </when> + <when value="a"> + <param name="iu" type="boolean" checked="false" truevalue="-iu" falsevalue="" + label="Ignore features in B that are upstream of features in A" + help="This option requires -D and follows its orientation rules for determining what is 'upstream'. (-iu)" /> + + <param name="id" type="boolean" checked="false" truevalue="-id" falsevalue="" + label="Ignore features in B that are downstream of features in A" + help="This option requires -D and follows its orientation rules for determining what is 'downstream'. (-id)" /> + </when> + <when value="b"> + <param name="iu" type="boolean" checked="false" truevalue="-iu" falsevalue="" + label="Ignore features in B that are upstream of features in A" + help="This option requires -D and follows its orientation rules for determining what is 'upstream'. (-iu)" /> + + <param name="id" type="boolean" checked="false" truevalue="-id" falsevalue="" + label="Ignore features in B that are downstream of features in A" + help="This option requires -D and follows its orientation rules for determining what is 'downstream'. (-id)" /> + </when> + </conditional> + + <param name="io" type="boolean" checked="false" truevalue="-io" falsevalue="" + label="Ignore features in B that overlap A" + help="That is, we want close, yet not touching features only. (-io)" /> + + <param name="mdb" type="select" optional="True" + label="How multiple databases are resolved" + help="(-mdb)"> + <option value="each" selected="True">Report closest records for each database. (-each)</option> + <option value="all">Report closest records among all databases. (-all)</option> + </param> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}"/> + <data format_source="inputA" name="output" metadata_source="inputA" label="Clostest region of ${inputA} in ${inputB}"/> </outputs> + <tests> + <test> + <param name="inputA" value="closestBedA.bed" ftype="bed" /> + <param name="inputB" value="closestBedB.bed" ftype="bed" /> + <output name="output" file="closestBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="closestBed_a.bed" ftype="bed" /> + <param name="inputB" value="closestBed_b1.bed,closestBed_b2.bed" ftype="bed" /> + <param name="addition" value="True" /> + <output name="output" file="closestBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="closestBed_a.bed" ftype="bed" /> + <param name="inputB" value="closestBed_b1.bed,closestBed_b2.bed" ftype="bed" /> + <param name="addition" value="True" /> + <param name="mdb" value="all" /> + <output name="output" file="closestBed_result3.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="closestBed_c.bed" ftype="bed" /> + <param name="inputB" value="closestBed_d.bed" ftype="bed" /> + <param name="addition2_select" value="ref" /> + <output name="output" file="closestBed_result4.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="closestBed_c.bed" ftype="bed" /> + <param name="inputB" value="closestBed_d.bed" ftype="bed" /> + <param name="addition2_select" value="a" /> + <output name="output" file="closestBed_result5.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Similar to intersectBed, closestBed searches for overlapping features in A and B. In the event that no feature in B overlaps the current feature in A, closestBed will report the closest (that is, least genomic distance from the start or end of A) feature in B. For example, one might want to find which is the closest gene to a significant GWAS polymorphism. Note that closestBed will report an overlapping feature as the closest—that is, it does not restrict to closest non-overlapping feature. +.. image:: $PATH_TO_IMAGES/closest-glyph.png + + @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/clusterBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/clusterBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,11 +6,13 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools cluster $strand -d $distance -i $inputA - > $output + > $output +]]> </command> <inputs> <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> @@ -21,10 +23,16 @@ help="Default is 0. That is, overlapping and/or book-ended features are clustered." /> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label=""/> + <data format_source="inputA" name="output" metadata_source="inputA"/> </outputs> + <tests> + <test> + <param name="inputA" value="mergedBed1.bed" ftype="bed" /> + <output name="output" file="clusterBed_result.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Similar to merge, cluster report each set of overlapping or “book-ended” features in an interval file. In contrast to merge, cluster does not flatten the cluster of intervals into a new meta-interval; instead, it assigns an unique cluster ID to each record in each cluster. This is useful for having fine control over how sets of overlapping intervals in a single interval file are combined. @@ -36,6 +44,7 @@ bedtools cluster requires that you presort your data by chromosome and then by start position (e.g., sort -k1,1 -k2,2n in.bed > in.sorted.bed for BED files). @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/complementBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/complementBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,20 +6,29 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ complementBed - -d $distance - -g genome - > $output + -i "$input" + -g "$genome" + > "$output" +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> <expand macro="genome" /> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label="Complemen of ${inputA.name}"/> + <data format_source="input" name="output" metadata_source="input" label="Complemen of ${input.name}"/> </outputs> + <tests> + <test> + <param name="input" value="a.bed" ftype="bed" /> + <param name="genome" value="mm9_chr1.len" /> + <output name="output" file="complementBed_result1.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools complement returns all intervals in a genome that are not covered by at least one interval in the input BED/GFF/VCF file. @@ -27,6 +36,7 @@ .. image:: $PATH_TO_IMAGES/complement-glyph.png @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/coverageBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/coverageBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,6 +6,7 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ coverageBed #if $inputA.ext == "bam" -abam '$inputA' @@ -18,30 +19,34 @@ $split $strandedness | sort -k1,1 -k2,2n - > '$output' + > '$output' +]]> </command> <inputs> - <param format="bed,bam,gff,gg3,vcf" name="inputA" type="data" label="Count how many intervals in this BED/VCF/GFF/BAM file (source)"> - <validator type="unspecified_build" /> - </param> - <param format="bed,gff,gff3,vcf" name="inputB" type="data" label="overlap the intervals in this BED file (target)"> - <validator type="unspecified_build" /> - </param> - <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage" - help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data. (-split)" /> + <param format="bed,bam,gff,gg3,vcf" name="inputA" type="data" label="Count how many intervals in this BED/VCF/GFF/BAM file (source)" /> + <param format="bed,gff,gff3,vcf" name="inputB" type="data" label="overlap the intervals in this BED file (target)" /> + <expand macro="split" /> <param name="strandedness" type="boolean" label="Force strandedness" truevalue="-s" falsevalue="" checked="false" help="That is, only features in A are only counted towards coverage in B if they are the same strand. (-s)"/> - <param name="d" type="boolean" checked="false" truevalue="-d" falsevalue="" label="Report the depth at each position in each B feature" + <param name="d" type="boolean" checked="false" truevalue="-d" falsevalue="" + label="Report the depth at each position in each B feature" help="Positions reported are one based. Each position and depth follow the complete B feature. (-d)" /> - <param name="hist" type="boolean" checked="false" truevalue="-hist" falsevalue="" label="Report a histogram of coverage for each feature in B as well as a summary histogram for all features in B" + <param name="hist" type="boolean" checked="false" truevalue="-hist" falsevalue="" + label="Report a histogram of coverage for each feature in B as well as a summary histogram for all features in B" help="Additonal columns after each feature in B: 1) depth 2) # bases at depth 3) size of B 4) % of B at depth. (-hist)" /> </inputs> - <outputs> - <data format="bed" name="output" metadata_source="inputB" label="count of overlaps in ${inputA.name} on ${inputB.name}"/> + <data format="bed" name="output" metadata_source="inputB" label="Count of overlaps in ${inputA.name} on ${inputB.name}"/> </outputs> + <tests> + <test> + <param name="inputA" value="coverageBedA.bed" ftype="bed" /> + <param name="genome" value="coverageBedB.bed" ftype="bed" /> + <output name="output" file="coverageBed_result1.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** coverageBed_ computes both the depth and breadth of coverage of features in @@ -58,7 +63,7 @@ The output file will be comprised of each interval from your original target BED file, plus an additional column indicating the number of intervals in your source file that overlapped that target interval. @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/expandBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/expandBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,25 +6,40 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools expand - -c $cols - -i $inputA - > $output + -c "${cols}" + -i "${input}" + > "${output}" +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - <param name="cols" type="text" value="" label="Specify the column(s) (comma separated) that should be summarized" /> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> + <expand macro="choose_columns" /> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label=""/> + <data name="output" metadata_source="input" format_source="input" /> </outputs> + <tests> + <test> + <param name="input" value="expandBed1.bed" ftype="bed" /> + <param name="cols" value="5"/> + <output name="output" file="expandBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="input" value="expandBed1.bed" ftype="bed" /> + <param name="cols" value="4,5"/> + <output name="output" file="expandBed_result2.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Replicate lines in a file based on columns of comma-separated values. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fisherBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,54 @@ +<tool id="bedtools_fisher" name="FisherBed" version="@WRAPPER_VERSION@.0"> + <description></description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + bedtools fisher + $strand + $split + -a $inputA + -b $inputB + -f $overlap + -g $genome + $reciprocal + $m + > $output +]]> + </command> + <inputs> + <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> + <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/> + <expand macro="genome" /> + <expand macro="strand2" /> + <expand macro="split" /> + <expand macro="overlap" /> + <expand macro="reciprocal" /> + <param name="m" type="boolean" checked="False" truevalue="-m" falsevalue="" + label="Merge overlapping intervals before looking at overlap" help="(-m)" /> + </inputs> + <outputs> + <data name="output" metadata_source="inputA" format_source="inputA" label="Fisher Test on ${inputA.name} and ${inputB.name}"/> + </outputs> + <tests> + <test> + <param name="inputA" value="fisherBed1.bed" ftype="bed" /> + <param name="inputB" value="fisherBed2.bed" ftype="bed" /> + <param name="genome" value="fisherBed.len" ftype="tabular" /> + <output name="output" file="fisherBed_result1.bed" ftype="bed" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +Perform fisher’s exact test on the number of overlaps/unique intervals between 2 files. + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/flankBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,72 @@ +<tool id="bedtools_flankbed" name="FlankBed" version="@WRAPPER_VERSION@.0"> + <description></description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + flankBed + $pct + $strand + -g $genome + -i $input + + #if $addition.addition_select == 'b': + -b $addition.b + #else: + -l $addition.l + -r $addition.r + #end if + > $output +]]> + </command> + <inputs> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> + <expand macro="genome" /> + <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue="" + label="Define -l and -r as a fraction of the feature’s length" + help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" /> + <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" + label="Define -l and -r based on strand" + help="For example. if used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" /> + <expand macro="addition" /> + </inputs> + <outputs> + <data metadata_source="input" format_source="input" name="output" /> + </outputs> + <tests> + <test> + <param name="input" value="a.bed" ftype="bed" /> + <param name="genome" value="mm9_chr1.len"/> + <param name="addition_select" value="b"/> + <param name="b" value="5"/> + <output name="output" file="flankBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="input" value="a.bed" ftype="bed" /> + <param name="genome" value="mm9_chr1.len"/> + <param name="addition_select" value="lr"/> + <param name="l" value="2"/> + <param name="r" value="3"/> + <output name="output" file="flankBed_result2.bed" ftype="bed" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +bedtools flank will optionally create flanking intervals whose size is user-specified fraction of the original interval. + +.. image:: $PATH_TO_IMAGES/flank-glyph.png + +.. class:: warningmark + +In order to prevent creating intervals that violate chromosome boundaries, bedtools flank requires a genome file defining the length of each chromosome or contig. + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- a/flankbed.xml Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,49 +0,0 @@ -<tool id="bedtools_flankbed" name="FlankBed" version="@WRAPPER_VERSION@.0"> - <description></description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements" /> - <expand macro="stdio" /> - <command> - flankBed - $pct - $strand - -g $genome - -i $inputA - - #if $addition.addition_select == 'b': - -b $addition.b - #else: - -l $addition.l - -r $addition.r - #end if - - > $output - </command> - <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - <expand macro="genome" /> - <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue="" label="Define -l and -r as a fraction of the feature’s length" help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" /> - <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Define -l and -r based on strand" help="For example. if used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" /> - <expand macro="addition" /> - </inputs> - <outputs> - <data format="bed" name="output" label=""/> - </outputs> - <help> - -**What it does** - -bedtools flank will optionally create flanking intervals whose size is user-specified fraction of the original interval. - -.. image:: $PATH_TO_IMAGES/flank-glyph.png - -.. class:: warningmark - -In order to prevent creating intervals that violate chromosome boundaries, bedtools flank requires a genome file defining the length of each chromosome or contig. - -@REFERENCES@ - </help> - <expand macro="citations" /> -</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/genomeCoverageBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,168 @@ +<tool id="bedtools_genomecoveragebed" name="Genome Coverage" version="@WRAPPER_VERSION@.0"> + <description>in bedGraph or histogram format</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + bedtools genomecov + #if $input.ext == "bam" + -ibam '$input' + #else + -i '$input' + -g $genome + #end if + + $split + $strand + + #if str($report.report_select) == "bg": + #if $zero_regions.value: + $zero_regions + #else: + -bg + #end if + + #if str($scale): + -scale $scale + #end if + #else: + #if str($report.max): + -max $report.max + #end if + #end if + $d + $dz + $five + $three + + > '$output' +]]> + </command> + <inputs> + <param format="bed,bam" name="input" type="data" label="The BAM or BED file from which coverage should be computed"> + <validator type="unspecified_build" /> + </param> + <conditional name="report"> + <param name="report_select" type="select" label="Output type"> + <option value="bg" selected="true">BedGraph coverage file</option> + <option value="hist">Data suiteable for Histogram</option> + </param> + <when value="bg"> + <param name="zero_regions" type="boolean" checked="False" truevalue="-bga" falsevalue="" + label="Report regions with zero coverage" help="If set, regions without any coverage will also be reported. (-bga)" /> + <param name="scale" type="float" value="1.0" + label="Scale the coverage by a constant factor" + help="Each bedGraph coverage value is multiplied by this factor before being reported. Useful for normalizing coverage by, e.g., reads per million (RPM). (-scale)"/> + </when> + <when value="hist"> + <param name="max" type="integer" label="Specify max depth" value="0" + help="Combine all positions with a depth >= max into a single bin in the histogram. (-max)"/> + </when> + </conditional> + <expand macro="genome" /> + <expand macro="split" /> + <param name="strand" type="select" label="Calculate coverage based on" help="(-strand)"> + <option value="">both strands combined</option> + <option value="-strand +">positive strand only</option> + <option value="-strand -">negative strand only</option> + </param> + + <param name="d" type="boolean" checked="False" truevalue="-d" falsevalue="" + label="Report the depth at each genome position with 1-based coordinates" help="(-d)" /> + <param name="dz" type="boolean" checked="False" truevalue="-dz" falsevalue="" + label="Report the depth at each genome position with 0-based coordinatess" help="(-dz)" /> + <param name="five" type="boolean" checked="False" truevalue="-d" falsevalue="" + label="Calculate coverage of 5’ positions" help="Instead of entire interval. (-5)" /> + <param name="three" type="boolean" checked="False" truevalue="-3" falsevalue="" + label="Calculate coverage of 3’ positions" help="Instead of entire interval. (-3)" /> + </inputs> + <outputs> + <data format="bedgraph" name="output"> + <change_format> + <when input="report.report_select" value="hist" format="tabular" /> + </change_format> + </data> + </outputs> + <tests> + <test> + <param name="input" value="genomeCoverageBed1.bed" ftype="bed" /> + <param name="genome" value="genomeCoverageBed1.len" /> + <param name="report_select" value="hist" /> + <output name="output" file="genomeCoverageBed_result1.bed" ftype="tabular" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +This tool calculates the genome-wide coverage of intervals defined in a BAM or BED file and reports them in BedGraph format. + +.. image:: $PATH_TO_IMAGES/genomecov-glyph.png + +.. class:: warningmark + +The input BED or BAM file must be sorted by chromosome name (but doesn't necessarily have to be sorted by start position). + +----- + +**Example 1** + +Input (BED format)- +Overlapping, un-sorted intervals:: + + chr1 140 176 + chr1 100 130 + chr1 120 147 + + +Output (BedGraph format)- +Sorted, non-overlapping intervals, with coverage value on the 4th column:: + + chr1 100 120 1 + chr1 120 130 2 + chr1 130 140 1 + chr1 140 147 2 + chr1 147 176 1 + +----- + +**Example 2 - with ZERO-Regions selected (assuming hg19)** + +Input (BED format)- +Overlapping, un-sorted intervals:: + + chr1 140 176 + chr1 100 130 + chr1 120 147 + + +BedGraph output will contain five columns: + + * 1. Chromosome name (or 'genome' for whole-genome coverage) + * 2. Coverage depth + * 3. The number of bases on chromosome (or genome) with depth equal to column 2. + * 4. The size of chromosome (or entire genome) in base pairs + * 5. The fraction of bases on chromosome (or entire genome) with depth equal to column 2. + +**Example Output**: + + chr2L 0 1379895 23011544 0.0599653 + chr2L 1 837250 23011544 0.0363839 + chr2L 2 904442 23011544 0.0393038 + chr2L 3 913723 23011544 0.0397072 + chr2L 4 952166 23011544 0.0413778 + chr2L 5 967763 23011544 0.0420555 + chr2L 6 986331 23011544 0.0428624 + chr2L 7 998244 23011544 0.0433801 + chr2L 8 995791 23011544 0.0432735 + chr2L 9 996398 23011544 0.0432999 + + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- a/genomeCoverageBed_bedgraph.xml Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,106 +0,0 @@ -<tool id="bedtools_genomecoveragebed_bedgraph" name="Create a BedGraph of genome coverage" version="@WRAPPER_VERSION@.0"> - <description> - </description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements" /> - <expand macro="stdio" /> - <command> - genomeCoverageBed - #if $input.ext == "bam" - -ibam '$input' - #else - -i '$input' - -g ${chromInfo} - #end if - - #if str($scale): - -scale $scale - #end if - - -bg - $zero_regions - $split - $strand - > '$output' - </command> - <inputs> - <param format="bed,bam" name="input" type="data" label="The BAM or BED file from which coverage should be computed"> - <validator type="unspecified_build" /> - </param> - - <param name="zero_regions" type="boolean" checked="true" truevalue="-bga" falsevalue="" label="Report regions with zero coverage" help="If set, regions without any coverage will also be reported." /> - - <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." /> - - <param name="strand" type="select" label="Calculate coverage based on"> - <option value="">both strands combined</option> - <option value="-strand +">positive strand only</option> - <option value="-strand -">negative strand only</option> - </param> - - <param name="scale" type="float" optional="true" label="Scale the coverage by a constant factor" help="Each BEDGRAPH coverage value is multiplied by this factor before being reported. Useful for normalizing coverage by, e.g., reads per million (RPM)"/> - </inputs> - <outputs> - <data format="bedgraph" name="output" metadata_source="input" label="${input.name} (Genome Coverage BedGraph)" /> - </outputs> - <help> - - -**What it does** - -This tool calculates the genome-wide coverage of intervals defined in a BAM or BED file and reports them in BedGraph format. - -.. class:: warningmark - -The input BED or BAM file must be sorted by chromosome name (but doesn't necessarily have to be sorted by start position). - ------ - -**Example 1** - -Input (BED format)- -Overlapping, un-sorted intervals:: - - chr1 140 176 - chr1 100 130 - chr1 120 147 - - -Output (BedGraph format)- -Sorted, non-overlapping intervals, with coverage value on the 4th column:: - - chr1 100 120 1 - chr1 120 130 2 - chr1 130 140 1 - chr1 140 147 2 - chr1 147 176 1 - ------ - -**Example 2 - with ZERO-Regions selected (assuming hg19)** - -Input (BED format)- -Overlapping, un-sorted intervals:: - - chr1 140 176 - chr1 100 130 - chr1 120 147 - - -Output (BedGraph format)- -Sorted, non-overlapping intervals, with coverage value on the 4th column:: - - chr1 0 100 0 - chr1 100 120 1 - chr1 120 130 2 - chr1 130 140 1 - chr1 140 147 2 - chr1 147 176 1 - chr1 176 249250621 0 - -@REFERENCES@ - </help> - <expand macro="citations" /> -</tool>
--- a/genomeCoverageBed_histogram.xml Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,68 +0,0 @@ -<tool id="bedtools_genomecoveragebed_histogram" name="Create a histogram of genome coverage" version="@WRAPPER_VERSION@.0"> - <description> - </description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements" /> - <expand macro="stdio" /> - <command> - genomeCoverageBed - #if $input.ext == "bam" - -ibam '$input' - #else - -i '$input' - -g ${chromInfo} - #end if - #if str($max): - -max $max - #end if - > '$output' - </command> - - <inputs> - <param format="bed,bam" name="input" type="data" label="The BAM or BED file from which coverage should be computed"></param> - <param name="max" type="text" optional="true" label="Max depth" help="Combine all positions with a depth >= max into a single bin in the histogram."/> - </inputs> - - <outputs> - <data format="tabular" name="output" metadata_source="input" label="${input.name} (Genome Coverage Histogram)" /> - </outputs> - -<help> -**What it does** - -This tool calculates a histogram of genome coverage depth based on mapped reads in BAM format or intervals in BED format. - - ------- - - -.. class:: infomark - -The output file will contain five columns: - - * 1. Chromosome name (or 'genome' for whole-genome coverage) - * 2. Coverage depth - * 3. The number of bases on chromosome (or genome) with depth equal to column 2. - * 4. The size of chromosome (or entire genome) in base pairs - * 5. The fraction of bases on chromosome (or entire genome) with depth equal to column 2. - -**Example Output**:: - - chr2L 0 1379895 23011544 0.0599653 - chr2L 1 837250 23011544 0.0363839 - chr2L 2 904442 23011544 0.0393038 - chr2L 3 913723 23011544 0.0397072 - chr2L 4 952166 23011544 0.0413778 - chr2L 5 967763 23011544 0.0420555 - chr2L 6 986331 23011544 0.0428624 - chr2L 7 998244 23011544 0.0433801 - chr2L 8 995791 23011544 0.0432735 - chr2L 9 996398 23011544 0.0432999 - - -@REFERENCES@ - </help> - <expand macro="citations" /> -</tool>
--- a/getfastaBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/getfastaBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,30 +6,59 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools getfasta $name $tab $strand $split -fi $fasta - -bed $inputA + -bed $input -fo $output +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file" /> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file" /> <param format="fasta" name="fasta" type="data" label="Fasta file" /> - <param name="name" type="boolean" checked="false" truevalue="-name" falsevalue="" label="Use the “name” column in the BED file for the FASTA headers in the output FASTA file" /> - <param name="tab" type="boolean" checked="false" truevalue="-tab" falsevalue="" label="Report extract sequences in a tab-delimited format instead of in FASTA format" /> - <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Force strandedness" help="If the feature occupies the antisense strand, the sequence will be reverse complemented." /> - <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" label="Given BED12 input, extract and concatenate the sequences from the BED 'blocks' (e.g., exons)" /> + <param name="name" type="boolean" checked="false" truevalue="-name" falsevalue="" + label="Use the 'name' column in the BED file for the FASTA headers in the output FASTA file" + help="(-name)" /> + <param name="tab" type="boolean" checked="false" truevalue="-tab" falsevalue="" + label="Report extract sequences in a tab-delimited format instead of in FASTA format" + help="(-tab)" /> + <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" + label="Force strandedness" + help="If the feature occupies the antisense strand, the sequence will be reverse complemented. (-s)" /> + <expand macro="split" /> </inputs> <outputs> - <data format="fasta" name="output" /> + <data format="fasta" name="output"> + <change_format> + <when input="tab" value="-tab" format="tabular" /> + </change_format> + </data> </outputs> + <tests> + <test> + <param name="input" value="nucBed1.bed" ftype="bed" /> + <param name="fasta" value="nucBed1.fasta" ftype="fasta" /> + <param name="tab" value="False" /> + <param name="split" value="False" /> + <output name="output" file="getfastaBed_result1.bed" ftype="fasta" /> + </test> + <test> + <param name="input" value="nucBed1.bed" ftype="bed" /> + <param name="fasta" value="nucBed1.fasta" ftype="fasta" /> + <param name="tab" value="True" /> + <param name="split" value="False" /> + <output name="output" file="getfastaBed_result2.tabular" ftype="tabular" /> + </test> + </tests> <help> +<![CDATA[ **What it does** -bedtools getfasta will extract the sequence defined by the coordinates in a BED interval and create a new FASTA entry in the output file for each extracted sequence. By default, the FASTA header for each extracted sequence will be formatted as follows: “<chrom>:<start>-<end>”. +bedtools getfasta will extract the sequence defined by the coordinates in a BED interval and create a new FASTA entry in the output file for each extracted sequence. By default, the FASTA header for each extracted sequence will be formatted as follows: “>chrom>:<start>-<end>”. .. image:: $PATH_TO_IMAGES/getfasta-glyph.png @@ -40,6 +69,7 @@ 2. You can use the UNIX fold command to set the line width of the FASTA output. For example, fold -w 60 will make each line of the FASTA file have at most 60 nucleotides for easy viewing. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/groupbyBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/groupbyBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,23 +6,31 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools groupby - -c $cols + -c "${cols}" -g $group -o $operation - -i $inputA - > $output + -i "${inputA}" + > "${output}" +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - <param name="cols" type="text" value="" label="Specify the column(s) (comma separated) that should be summarized" /> - <param name="group" type="text" value="1,2,3" label="Specifies which column(s) (1-based) should be used to group the input. Columns may be comma-separated with each column must be explicitly listed. Or, ranges (e.g. 1-4) are also allowed." /> - <param name="operation" type="select" label="Specify the operation"> + <param format="bed" name="inputA" type="data" label="BED file"/> + <expand macro="choose_columns" /> + <param name="group" type="text" value="1,2,3" + label="Specifies which column(s) (1-based) should be used to group the input" + help="Columns may be comma-separated with each column must be explicitly listed. Or, ranges (e.g. 1-4) are also allowed. (-g)"> + <sanitizer invalid_char=""> + <valid initial="string.digits"><add value=","/><add value="-"/></valid> + </sanitizer> + </param> + <param name="operation" type="select" label="Specify the operation" help="(-o)"> <option value="sum" selected="True">Sum - numeric only</option> <option value="stdev">Stdev - numeric only</option> <option value="sstdev">Sstdev - numeric only</option> - <option value="freqasc">Freqasc - print a comma separated list of values observed and the number of times they were observed. Reported in ascending order of frequency*</option> - <option value="freqdesc">Freqdesc - - print a comma separated list of values observed and the number of times they were observed. Reported in descending order of frequency*</option> + <option value="freqasc">Freqasc - comma separated list of values observed and the number of times they were observed (ascending)</option> + <option value="freqdesc">Freqdesc - comma separated list of values observed and the number of times they were observed (descending)</option> <option value="first">First - numeric or text</option> <option value="last">Last - numeric or text</option> <expand macro="math_options" /> @@ -30,15 +38,39 @@ </param> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label=""/> + <data format_source="inputA" name="output" metadata_source="inputA"/> </outputs> + <tests> + <test> + <param name="inputA" value="groupbyBed1.bed" ftype="bed" /> + <param name="cols" value="9" /> + <param name="group" value="1,2,3" /> + <param name="operation" value="sum" /> + <output name="output" file="groupbyBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="groupbyBed1.bed" ftype="bed" /> + <param name="cols" value="9" /> + <param name="group" value="1,2,3" /> + <param name="operation" value="min" /> + <output name="output" file="groupbyBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="groupbyBed1.bed" ftype="bed" /> + <param name="cols" value="9" /> + <param name="group" value="1-4" /> + <param name="operation" value="median" /> + <output name="output" file="groupbyBed_result3.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Replicate lines in a file based on columns of comma-separated values. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/intersectBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/intersectBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,65 +6,92 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - intersectBed - #if $inputA.ext == "bam": - -abam $inputA - #else: - -a $inputA - #end if +<![CDATA[ + #set inputBs = '" "'.join( [ str( $file ) for $file in $inputB ] ) + #set modes = ' '.join( str($overlap_mode).split(',') ) + + bedtools intersect + #if $inputA.ext == "bam": + -abam "${inputA}" + #else: + -a "${inputA}" + #end if - -b $inputB - $split - $strand - #if str($fraction): - -f $fraction - #end if - $reciprocal - $invert - $once - $header - $overlap_mode - > $output + -b "${inputBs}" + $split + $strand + #if str($fraction) != "None" and str($fraction): + -f "${fraction}" + #end if + $reciprocal + $invert + $once + $header + $modes + > "${output}" +]]> </command> <inputs> <param format="bed,bam,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF/BAM file"/> - <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="overlap intervals in this BED file?"/> - - <param name="strand" type="select" label="Calculate the intersection based on strandedness?"> - <option value="" selected="True">Overlaps on either strand</option> - <option value="-s">Only overlaps occurring on the **same** strand.</option> - <option value="-S">Only overlaps occurring on the **opposite** strand.</option> - </param> - - <param name="overlap_mode" type="select" label="What should be written to the output file?"> - <option value="-wa" selected="True">Write the original entry in A for each overlap.</option> - <option value="-wb">Write the original entry in B for each overlap. Useful for knowing what A overlaps. Restricted by the fraction- and reciprocal option.</option> - <option value="-wo">Write the original A and B entries plus the number of base pairs of overlap between the two features. Only A features with overlap are reported. Restricted by the fraction- and reciprocal option.</option> - <option value="-wao">Write the original A and B entries plus the number of base pairs of overlap between the two features. However, A features w/o overlap are also reported with a NULL B feature and overlap = 0. Restricted by the fraction- and reciprocal option.</option> - <option value="-loj">Perform a "left outer join". That is, for each feature in A report each overlap with B. If no overlaps are found, report a NULL feature for B.</option> + <param format="bed,bam,gff,vcf,gff3" name="inputB" type="data" multiple="True" label="One or more BAM/BED/GFF/VCF file(s)"/> + <expand macro="strand2" /> + <param name="overlap_mode" type="select" multiple="True" label="What should be written to the output file?"> + <option value="-wa" selected="True">Write the original entry in A for each overlap (-wa)</option> + <option value="-wb">Write the original entry in B for each overlap. Useful for knowing what A overlaps. Restricted by the fraction- and reciprocal option (-wb)</option> + <option value="-wo">Write the original A and B entries plus the number of base pairs of overlap between the two features. Only A features with overlap are reported. Restricted by the fraction- and reciprocal option (-wo)</option> + <option value="-wao">Write the original A and B entries plus the number of base pairs of overlap between the two features. However, A features w/o overlap are also reported with a NULL B feature and overlap = 0. Restricted by the fraction- and reciprocal option (-wao)</option> + <option value="-loj">Perform a "left outer join". That is, for each feature in A report each overlap with B. If no overlaps are found, report a NULL feature for B (-loj)</option> </param> - <param name="split" type="boolean" checked="true" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." /> + <expand macro="split" /> <!-- -f --> - <param name="fraction" type="text" optional="true" label="Minimum overlap required as a fraction of the BAM alignment" help="Alignments are only retained if the overlap with the an interval in the BED file comprises at least this fraction of the BAM alignment's length. For example, to require that the overlap affects 50% of the BAM alignment, use 0.50. (-f)"/> + <param name="fraction" type="text" + label="Minimum overlap required as a fraction of the BAM alignment" + help="Alignments are only retained if the overlap with the an interval in the BED file comprises at least this fraction of the BAM alignment's length. For example, to require that the overlap affects 50% of the BAM alignment, use 0.50. (-f)"/> <!-- -r --> - <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" label="Require reciprocal overlap." help="If set, the overlap between the BAM alignment and the BED interval must affect the above fraction of both the alignment and the BED interval. (-r)" /> + <expand macro="reciprocal" /> <!-- -v --> - <param name="invert" type="boolean" checked="false" truevalue="-v" falsevalue="" label="Report only those alignments that **do not** overlap the BED file. (-v)"/> + <param name="invert" type="boolean" checked="false" truevalue="-v" falsevalue="" + label="Report only those alignments that **do not** overlap the BED file" + help="(-v)"/> <!-- -u --> - <param name="once" type="boolean" checked="false" truevalue="-u" falsevalue="" label="Write the original A entry _once_ if _any_ overlaps found in B." help="Just report the fact >=1 hit was found. (-u)" /> + <param name="once" type="boolean" checked="false" truevalue="-u" falsevalue="" + label="Write the original A entry _once_ if _any_ overlaps found in B." + help="Just report the fact >=1 hit was found. (-u)" /> <!-- -c --> - <param name="count" type="boolean" checked="false" truevalue="-c" falsevalue="" label="For each entry in A, report the number of overlaps with B." help="Reports 0 for A entries that have no overlap with B. (-c)" /> - <!-- header --> - <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results." /> - <!-- header --> - <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results." /> + <param name="count" type="boolean" checked="false" truevalue="-c" falsevalue="" + label="For each entry in A, report the number of overlaps with B." + help="Reports 0 for A entries that have no overlap with B. (-c)" /> + <expand macro="print_header" /> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}"/> + <data format_source="inputA" name="output" metadata_source="inputA"/> </outputs> + <tests> + <test> + <param name="inputA" value="intersectBed1.bed" ftype="bed" /> + <param name="inputB" value="intersectBed2.bed" ftype="bed" /> + <param name="overlap_mode" value="-wa" /> + <param name="split" value="False" /> + <output name="output" file="intersectBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersectBed1.bed" ftype="bed" /> + <param name="inputB" value="intersectBed2.bed" ftype="bed" /> + <param name="overlap_mode" value="-wa,-wb" /> + <param name="split" value="False" /> + <output name="output" file="intersectBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersectBed1.bed" ftype="bed" /> + <param name="inputB" value="intersectBed2.bed" ftype="bed" /> + <param name="invert" value="True" /> + <param name="split" value="False" /> + <output name="output" file="intersectBed_result3.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** By far, the most common question asked of two sets of genomic features is whether or not any of the features in the two sets “overlap” with one another. This is known as feature intersection. bedtools intersect allows one to screen for overlaps between two sets of genomic features. Moreover, it allows one to have fine control as to how the intersections are reported. bedtools intersect works with both BED/GFF/VCF and BAM files as input. @@ -80,7 +107,7 @@ Note that a BAM alignment will be sent to the output file **once** even if it overlaps more than one interval in the BED file. @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/jaccardBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/jaccardBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,29 +6,44 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools jaccard - - $reciprocal - $strand - $split - -f $overlap - -a $inputA - -b $inputB - > $output + $strand + $split + $reciprocal + -f $overlap + -a $inputA + -b $inputB + > $output +]]> </command> <inputs> <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> <param format="bed,vcf,gff,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/> - <param name="overlap" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" /> - - <param name="reciprocal" type="boolean" checked="false" truevalue="-f" falsevalue="" label="Require that the fraction of overlap be reciprocal for A and B. In other words, if -f is 0.90 and -r is used, this requires that B overlap at least 90% of A and that A also overlaps at least 90% of B" /> - <param name="tab" type="boolean" checked="false" truevalue="-tab" falsevalue="" label="Report extract sequences in a tab-delimited format instead of in FASTA format." /> - <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Force strandedness" help="That is, only report hits in B that overlap A on the same strand. By default, overlaps are reported without respect to strand" /> + <expand macro="overlap" /> + <expand macro="reciprocal" /> + <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" + label="Force strandedness" + help="That is, only report hits in B that overlap A on the same strand. By default, overlaps are reported without respect to strand. (-s)" /> <expand macro="strand2" /> + <expand macro="split" /> </inputs> <outputs> <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}" /> </outputs> + <tests> + <test> + <param name="inputA" value="jaccardBed1.bed" ftype="bed" /> + <param name="inputB" value="jaccardBed2.bed" ftype="bed" /> + <output name="output" file="jaccardBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="jaccardBed1.bed" ftype="bed" /> + <param name="inputB" value="jaccardBed2.bed" ftype="bed" /> + <param name="overlap" value="0.1" /> + <output name="output" file="jaccardBed_result2.bed" ftype="bed" /> + </test> + </tests> <help> **What it does**
--- a/linksBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/linksBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,29 +6,49 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - linksBed - -base $basename - -org $org - -db $db - -i $inputA - > $output +<![CDATA[ + bedtools links + -base "${basename}" + -org "${org}" + -db "${db}" + -i "${input}" + > "${output}" +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - <param name="basename" type="text" value="http://genome.ucsc.edu" label="The “basename” for the UCSC browser" /> - <param name="org" type="text" value="human" label="The organism (e.g. mouse, human)" /> - <param name="db" type="text" value="hg18" label="The genome build" /> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> + <param name="basename" type="text" value="http://genome.ucsc.edu" + label="The 'basename' for the UCSC genome browser" /> + <param name="org" type="text" value="human" label="Organism name" help="e.g. mouse, human (-org)" /> + <param name="db" type="text" value="hg19" label="The genome build" help="(-db)"/> </inputs> <outputs> <data name="output" format="html" /> </outputs> + <tests> + <test> + <param name="input" value="linksBed1.bed" ftype="bed" /> + <param name="basename" value="http://genome.ucsc.edu" /> + <param name="org" value="" /> + <param name="db" value="" /> + <output name="output" file="linksBed_result1.html" lines_diff="2" ftype="html" /> + </test> + <test> + <param name="input" value="linksBed1.bed" ftype="bed" /> + <param name="basename" value="http://genome.ucsc.edu" /> + <param name="org" value="mouse" /> + <param name="db" value="mm9" /> + <output name="output" file="linksBed_result2.html" lines_diff="2" ftype="html" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Creates an HTML file with links to an instance of the UCSC Genome Browser for all features / intervals in a file. This is useful for cases when one wants to manually inspect through a large set of annotations or features. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/macros.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/macros.xml Thu Jan 08 14:25:51 2015 -0500 @@ -1,11 +1,12 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="2.19.1">bedtools</requirement> + <requirement type="package" version="2.22">bedtools</requirement> + <yield/> </requirements> <version_command>bedtools --version</version_command> </xml> - <token name="@WRAPPER_VERSION@">2.19</token> + <token name="@WRAPPER_VERSION@">2.22</token> <xml name="stdio"> <stdio> <!-- Anything other than zero is an error --> @@ -16,9 +17,13 @@ <regex match="Exception:" /> </stdio> </xml> - + <xml name="reciprocal"> + <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" + label="Require that the fraction of overlap be reciprocal for A and B" + help="In other words, if -f is 0.90 and -r is used, this requires that B overlap at least 90% of A and that A also overlaps at least 90% of B. (-r)" /> + </xml> <xml name="overlap"> - <param name="overlap" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" /> + <param name="overlap" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" help="Default is 1E-9, i.e. 1bp. (-f)"/> </xml> <xml name="strand2"> <param name="strand" type="select" label="Calculation based on strandedness?"> @@ -29,19 +34,24 @@ </xml> <xml name="seed"> <conditional name="seed"> - <param name="choose" type="boolean" label="Choose Seed?" selected="False" truevalue="True" falsevalue="False" /> + <param name="seed_choose" type="select" label="Choose Seed?" help="(-seed)"> + <option value="False" selected="True">Random Shuffling</option> + <option value="True">Choose fixed seed</option> + </param> <when value="True"> <param name="seed" type="integer" value="12345" label="Enter Seed" /> </when> + <when value="False" /> </conditional> </xml> <xml name="split"> - <param name="split" type="boolean" checked="true" truevalue="-split" falsevalue="" + <param name="split" type="boolean" checked="false" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." - help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." /> + help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data. (-split)" /> </xml> <xml name="genome"> - <param format="bed,vcf,gff,gff3" name="genome" type="data" label="Genome file" /> + <param format="tabular" name="genome" type="data" label="Genome file" /> + <!--TODO: make use of: ${chromInfo} --> </xml> <xml name="addition"> <conditional name="addition"> @@ -50,30 +60,61 @@ <option value="lr">Increase by Start Coordinate and End Coordinate</option> </param> <when value="b"> - <param name="b" label="Give Value" type="integer" value="0" /> + <param name="b" value="1" label="Number of base pairs" type="integer" /> </when> <when value="lr"> - <param name="l" label="The number of base pairs to subtract from the start coordinate" type="integer" value="0" /> - <param name="r" label="The number of base pairs to add to the end coordinate" type="integer" value="0" /> + <param name="l" type="integer" value="0" label="The number of base pairs to subtract from the start coordinate" /> + <param name="r" type="integer" value="0" label="The number of base pairs to add to the end coordinate" /> </when> </conditional> </xml> + <xml name="print_header"> + <param name="header" type="boolean" checked="False" truevalue="-header" falsevalue="" + label="Print the header from the A file prior to results" help="(-header)" /> + </xml> + <!-- TODO this is currently not used, but we should make use of it --> + <xml name="genome_validator"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="fasta_indexes" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." /> + </xml> + + <!-- ToDo column_picker --> + <xml name="choose_columns"> + <param name="cols" type="text" value="" + label="Specify the column(s) (comma separated) that should be summarized" + help="(-c)"> + <sanitizer invalid_char=""> + <valid initial="string.digits"><add value=","/></valid> + </sanitizer> + </param> + </xml> + + <xml name="choose_operations"> + <param name="operation" type="select" label="Specify the operation"> + <yield /> + </param> + </xml> + <xml name="math_options"> - <option value="min">Min - numeric only</option> - <option value="max">Max - numeric only</option> - <option value="mean">Mean - numeric only</option> - <option value="median">Median - numeric only</option> - <option value="mode">Mode - numeric only</option> - <option value="antimode">Antimode - numeric only</option> - <option value="collapse">collapse (i.e., print a comma separated list) - numeric or text</option> - </xml> + <option value="sum" selected="True">Sum - numeric only</option> + <option value="min">Min - numeric only</option> + <option value="max">Max - numeric only</option> + <option value="absmin">AbsMin - numeric only</option> + <option value="absmax">AbsMax - numeric only</option> + <option value="mean">Mean - numeric only</option> + <option value="median">Median - numeric only</option> + <option value="mode">Mode - numeric only</option> + <option value="antimode">Antimode - numeric only</option> + <option value="collapse">collapse (i.e., print a comma separated list) - numeric or text</option> + </xml> <xml name="additional_math_options"> - <option value="count">Count - numeric or text</option> - <option value="count_disctinct">Count Distinct - numeric or text</option> - <option value="distinct">distinct (i.e., print a comma separated list) - numeric or text</option> - <option value="concat">concat (i.e., print a comma separated list) - numeric or text</option> + <option value="count">Count - numeric or text</option> + <option value="count_disctinct">Count Distinct - numeric or text</option> + <option value="distinct">distinct (i.e., print a comma separated list) - numeric or text</option> + <option value="concat">concat (i.e., print a comma separated list) - numeric or text</option> </xml> <token name="@REFERENCES@"> +<![CDATA[ ------ This tool is part of the `bedtools package`_ from the `Quinlan laboratory`_. @@ -81,10 +122,18 @@ .. _bedtools package: https://github.com/arq5x/bedtools2 .. _Quinlan laboratory: http://cphg.virginia.edu/quinlan/ + +**Citation** + +If you use this tool in Galaxy, please cite: + +Bjoern A. Gruening (2014), `Galaxy wrapper <https://github.com/bgruening/galaxytools>`_ +]]> </token> <xml name="citations"> <citations> <citation type="doi">10.1093/bioinformatics/btq033</citation> + <yield /> </citations> </xml> </macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/makeWindowsBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,125 @@ +<tool id="bedtools_makewindowsbed" name="MakeWindowsBed" version="@WRAPPER_VERSION@.0"> + <description></description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + bedtools makewindows + #if $type.type_select == 'genome': + -g $type.genome + #else: + -b $type.input + #end if + #if $action.action_select == 'windowsize': + -w $action.windowsize + #if $action.step_size.step_size_select == 'yes': + -s $action.step_size.step_size + #end if + #else: + -n $action.number + -s $action.step_size + #end if + $sourcename + > $output +]]> + </command> + <inputs> + <conditional name="type"> + <param name="type_select" type="select" label="Work with"> + <option value="bed" selected="True">Bed File</option> + <option value="genome">Genome File</option> + </param> + <when value="bed"> + <param name="input" format="bed,vcf,gff,gff3" type="data" label="BED/VCF/GFF file"/> + </when> + <when value="genome"> + <expand macro="genome" /> + </when> + </conditional> + <conditional name="action"> + <param name="action_select" type="select" label="Work with"> + <option value="windowsize" selected="True">Set WindowSize</option> + <option value="number">Give Number of Windows</option> + </param> + <when value="windowsize"> + <param name="windowsize" type="integer" value="1" + label="Divide each input interval (either a chromosome or a BED interval) to fixed-sized windows" + help="i.e. same number of nucleotide in each window" /> + <conditional name="step_size"> + <param name="step_size_select" type="select" + label="Specify Step size? i.e. how many base pairs to step before creating a new window" + help="Used to create 'sliding' windows. Defaults to window size (non-sliding windows)."> + <option value="yes">Yes</option> + <option value="no" selected="True">No</option> + </param> + <when value="yes"> + <param name="step_size" type="integer" value="100" label="Specify it" /> + </when> + <when value="no" /> + </conditional> + </when> + <when value="number"> + <param name="number" type="integer" value="1" + label="Divide each input interval (either a chromosome or a BED interval) to fixed number of windows" + help="i.e. same number of windows, with varying window sizes" /> + <param name="step_size" type="integer" value="100" label="Specify it" /> + </when> + </conditional> + <param name="sourcename" type="select" label="ID Naming Options"> + <option value="" selected="True">Default</option> + <option value="-i src">use the source interval's name</option> + <option value="-i winnum">use the window number as the ID (e.g. 1,2,3,4...)</option> + <option value="-i srcwinnum">use the source interval's name with the window number.</option> + </param> + </inputs> + <outputs> + <data name="output" format="bed" /> + </outputs> + <tests> + <test> + <param name="type_select" value="genome" /> + <param name="genome" value="mm9_chr1.len" ftype="tabular" /> + <param name="action_select" value="windowsize" /> + <param name="windowsize" value="1000000" /> + <output name="output" file="makeWindowBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="type_select" value="genome" /> + <param name="genome" value="mm9_chr1.len" ftype="tabular" /> + <param name="action_select" value="windowsize" /> + <param name="windowsize" value="1000000" /> + <param name="step_size_select" value="yes" /> + <param name="step_size" value="50000" /> + <output name="output" file="makeWindowBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="type_select" value="genome" /> + <param name="genome" value="mm9_chr1.len" ftype="tabular" /> + <param name="action_select" value="number" /> + <param name="number" value="100" /> + <param name="step_size" value="10000" /> + <output name="output" file="makeWindowBed_result3.bed" ftype="bed" /> + </test> + <test> + <param name="type_select" value="bed" /> + <param name="input" value="makeWindowBed1.bed" ftype="bed" /> + <param name="action_select" value="number" /> + <param name="number" value="15" /> + <param name="step_size" value="100" /> + <output name="output" file="makeWindowBed_result4.bed" ftype="bed" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +Makes adjacent or sliding windows across a genome or BED file. + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- a/makewindowsBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,79 +0,0 @@ -<tool id="bedtools_makewindowsbed" name="MakeWindowsBed" version="@WRAPPER_VERSION@.0"> - <description></description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements" /> - <expand macro="stdio" /> - <command> - bedtools makewindows - #if $type.type_select == 'genome': - -g $type.genome - #else: - -i $type.inputA - #end if - #if $action.action_select == 'windowsize': - -w $action.windowsize - #if $action.step_size.step_size_select == 'yes': - -s $action.step_size.step_size - #end if - #else: - -n $action.number - #end if - $sourcename - > $output - </command> - <inputs> - <conditional name="type"> - <param name="type_select" type="select" label="Work with"> - <option value="bed" selected="True">Bed File</option> - <option value="genome">Genome File</option> - </param> - <when value="bed"> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - </when> - <when value="genome"> - <expand macro="genome" /> - </when> - </conditional> - <conditional name="action"> - <param name="action_select" type="select" label="Work with"> - <option value="windowsize" selected="True">Set WindowSize</option> - <option value="number">Give Number of Windows</option> - </param> - <when value="windowsize"> - <param name="windowsize" type="integer" value="1" label="Divide each input interval (either a chromosome or a BED interval) to fixed-sized windows (i.e. same number of nucleotide in each window)." /> - <conditional name="step_size"> - <param name="step_size_select" type="select" label="Specify Step size? i.e. how many base pairs to step before creating a new window. Used to create 'sliding' windows. Defaults to window size (non-sliding windows)."> - <option value="yes">Yes</option> - <option value="no" selected="True">No</option> - </param> - <when value="yes"> - <param name="step_size" type="integer" value="100" label="Specify it" /> - </when> - </conditional> - </when> - <when value="number"> - <param name="number" type="integer" value="1" label="Divide each input interval (either a chromosome or a BED interval) to fixed number of windows (i.e. same number of windows, with varying window sizes)." /> - </when> - </conditional> - <param name="sourcename" type="select" label="ID Naming Options"> - <option value="" selected="True">Default</option> - <option value="-i src">use the source interval's name</option> - <option value="-i winnum">use the window number as the ID (e.g. 1,2,3,4...)</option> - <option value="-i srcwinnum">use the source interval's name with the window number.</option> - </param> - </inputs> - <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label=""/> - </outputs> - <help> - -**What it does** - -Makes adjacent or sliding windows across a genome or BED file. - -@REFERENCES@ - </help> - <expand macro="citations" /> -</tool>
--- a/mapBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/mapBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,39 +6,41 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools map - -a $inputA - -b $inputB + -a "${inputA}" + -b "${inputB}" $strand -o $operation - -c $col + -c "${cols}" -f $overlap $reciprocal $split $header #if $genome.genome_choose == "-g" : -g $genome.genome - #end if - > $output + #end if + > "${output}" +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file A"/> - <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file B"/> - <param name="col" type="integer" value="5" label="Specify the column from the B file to map onto intervals in A" /> + <param format="bam,bed,vcf,gff,gff3" name="inputA" type="data" label="File A (BAM/BED/VCF/GFF)" /> + <param format="bam,bed,gff,vcf,gff3" name="inputB" type="data" label="File B (BAM/BED/VCF/GFF)" /> + <expand macro="choose_columns" /> <expand macro="overlap" /> - <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" label="Require reciprocal overlap." help="If set, the overlap between the BAM alignment and the BED interval must affect the above fraction of both the alignment and the BED interval." /> + <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" + label="Require reciprocal overlap" + help="If set, the overlap between the BAM alignment and the BED interval must affect the above fraction of both the alignment and the BED interval. (-r)" /> <expand macro="strand2" /> - <param name="operation" type="select" label="Specify the operation"> - <option value="sum">Sum - numeric only</option> - <option value="absmin">AbsMin - numeric only</option> - <option value="absmax">AbsMax - numeric only</option> + <expand macro="choose_operations"> <expand macro="math_options" /> <expand macro="additional_math_options" /> - </param> - <param name="split" type="boolean" checked="true" truevalue="-split" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="If set, the coverage will be calculated based the spliced intervals only. For BAM files, this inspects the CIGAR N operation to infer the blocks for computing coverage. For BED12 files, this inspects the BlockCount, BlockStarts, and BlockEnds fields (i.e., columns 10,11,12). If this option is not set, coverage will be calculated based on the interval's START/END coordinates, and would include introns in the case of RNAseq data." /> - <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results." /> + </expand> + <expand macro="split" /> + <expand macro="print_header" /> <conditional name="genome"> - <param name="genome_choose" type="boolean" checked="false" truevalue="-g" falsevalue="" label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="" /> + <param name="genome_choose" type="boolean" checked="false" truevalue="-g" falsevalue="" + label="Treat split/spliced BAM or BED12 entries as distinct BED intervals when computing coverage." help="(-g)" /> <when value="-g"> <expand macro="genome" /> </when> @@ -47,8 +49,40 @@ <outputs> <data format_source="inputA" name="output" metadata_source="inputA" label="Mapping of ${inputB.name} into ${inputA.name}"/> </outputs> + <tests> + <test> + <param name="inputA" value="mapBed1.bed" ftype="bed" /> + <param name="inputB" value="mapBed2.bed" ftype="bed" /> + <param name="cols" value="5" /> + <param name="operation" value="mean" /> + <output name="output" file="mapBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="mapBed1.bed" ftype="bed" /> + <param name="inputB" value="mapBed2.bed" ftype="bed" /> + <param name="cols" value="5" /> + <param name="operation" value="collapse" /> + <output name="output" file="mapBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="mapBed1.bed" ftype="bed" /> + <param name="inputB" value="mapBed2.bed" ftype="bed" /> + <param name="cols" value="5" /> + <param name="operation" value="collapse" /> + <param name="strand" value="-S" /> + <output name="output" file="mapBed_result3.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="mapBed1.bed" ftype="bed" /> + <param name="inputB" value="mapBed2.bed" ftype="bed" /> + <param name="cols" value="5" /> + <param name="operation" value="collapse" /> + <param name="strand" value="-s" /> + <output name="output" file="mapBed_result4.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools map allows one to map overlapping features in a B file onto features in an A file and apply statistics and/or summary operations on those features. @@ -64,7 +98,7 @@ The map tool is substantially faster in versions 2.19.0 and later. The plot below demonstrates the increased speed when, for example, counting the number of exome alignments that align to each exon. The bedtools times are compared to the bedops bedmap utility as a point of reference. @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/maskFastaBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/maskFastaBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,25 +6,44 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools maskfasta - $soft - -mc $mc - -fi $fasta - -bed $inputA - -fo $output + $soft + -mc "${mc}" + -fi "${fasta}" + -bed "${input}" + -fo "${output}" +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> <param format="fasta" name="fasta" type="data" label="Fasta file"/> - - <param name="soft" type="boolean" checked="false" truevalue="-name" falsevalue="" label="Soft-mask (that is, convert to lower-case bases) the FASTA sequence. By default, hard-masking (that is, conversion to Ns) is performed" /> - <param name="mc" type="text" value="N" length="1" falsevalue="" label="Replace masking character. That is, instead of masking with Ns, use another character." /> + <param name="soft" type="boolean" checked="false" truevalue="-soft" falsevalue="" + label="Soft-mask (that is, convert to lower-case bases) the FASTA sequence" + help="By default, hard-masking (that is, conversion to Ns) is performed. (-soft)" /> + <param name="mc" type="text" value="N" length="1" + label="Replace masking character" + help="That is, instead of masking with Ns, use another character. (-mc)" /> </inputs> <outputs> <data format="fasta" name="output" /> </outputs> + <tests> + <test> + <param name="input" value="nucBed1.bed" ftype="bed" /> + <param name="fasta" value="nucBed1.fasta" ftype="fasta" /> + <param name="soft" value="False" /> + <output name="output" file="maskFastaBed_result1.bed" ftype="fasta" /> + </test> + <test> + <param name="input" value="nucBed1.bed" ftype="bed" /> + <param name="fasta" value="nucBed1.fasta" ftype="fasta" /> + <param name="soft" value="True" /> + <output name="output" file="maskFastaBed_result2.bed" ftype="fasta" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools maskfasta masks sequences in a FASTA file based on intervals defined in a feature file. The headers in the input FASTA file must exactly match the chromosome column in the feature file. This may be useful fro creating your own masked genome file based on custom annotations or for masking all but your target regions when aligning sequence data from a targeted capture experiment. @@ -32,6 +51,7 @@ .. image:: $PATH_TO_IMAGES/maskfasta-glyph.png @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/mergeBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/mergeBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,60 +6,59 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - mergeBed - -i $input - $strandedness - $report_number +<![CDATA[ + mergeBed + -i "${input}" + $strand -d $distance - $nms - #if str($scores) != 'none' - -scores $scores - #end if - > $output + $header + > "${output}" +]]> </command> <inputs> - <param name="input" format="bed,gff,vcf" type="data" label="Sort the following BED/VCF/GFF file"/> - <param name="strandedness" type="boolean" label="Force strandedness." truevalue="-s" falsevalue="" checked="false" - help="That is, only merge features that are the same strand."/> - <param name="report_number" type="boolean" label="Report the number of BED entries that were merged." truevalue="-n" falsevalue="" checked="false" - help="1 is reported if no merging occurred."/> - <param name="nms" type="boolean" label="Report the names of the merged features separated by commas." truevalue="-nms" falsevalue="" checked="false" - help="1 is reported if no merging occurred."/> - - <param name="distance" type="integer" value="0" label="Maximum distance between features allowed for features to be merged." - help="That is, overlapping and/or book-ended features are merged."/> - <param name="scores" type="select" label="Report the scores of the merged features as"> - <option value="none" selected="True">Do not report at all</option> - <option value="sum">Sum</option> + <param name="input" format="bam,bed,gff,vcf" type="data" label="Sort the following BAM/BED/VCF/GFF file"/> + <param name="strand" type="select" label="Calculation based on strandedness?"> + <option value="" selected="True">Overlaps on either strand</option> + <option value="-s">Force strandedness. That is, only merge features that are the same strand.</option> + <option value="-S +">Force merge for forward strand only.</option> + <option value="-S -">Force merge for reverse strand only.</option> + </param> + <param name="distance" type="integer" value="0" + label="Maximum distance between features allowed for features to be merged" + help="That is, overlapping and/or book-ended features are merged. (-d)"/> + <expand macro="print_header" /> + <expand macro="choose_columns" /> + <expand macro="choose_operations"> <expand macro="math_options" /> - </param> + <expand macro="additional_math_options" /> + </expand> </inputs> <outputs> <data format="bed" name="output" metadata_source="input" label="Merged ${input.name}"/> </outputs> <tests> <test> - <param name="input" value="0.bed" ftype="bed" /> - <output name="output" file="0_result.bed" ftype="bed" /> + <param name="input" value="mergedBed1.bed" ftype="bed" /> + <output name="output" file="mergedBed_result1.bed" ftype="bed" /> </test> <test> - <param name="input" value="1.bed" ftype="bed" /> + <param name="input" value="mergedBed2.bed" ftype="bed" /> <param name="strandedness" value="-s" /> - <output name="output" file="1_result.bed" ftype="bed" /> + <output name="output" file="mergedBed_result2.bed" ftype="bed" /> </test> <test> - <param name="input" value="2.bed" ftype="bed" /> + <param name="input" value="mergedBed3.bed" ftype="bed" /> <param name="report_number" value="-n" /> - <output name="output" file="2_result.bed" ftype="bed" /> + <output name="output" file="mergedBed_result3.bed" ftype="bed" /> </test> <test> - <param name="input" value="3.bed" ftype="bed" /> + <param name="input" value="mergedBed4.bed" ftype="bed" /> <param name="distance" value="1000" /> - <output name="output" file="3_result.bed" ftype="bed" /> + <output name="output" file="mergedBed_result4.bed" ftype="bed" /> </test> </tests> <help> - +<![CDATA[ **What it does** bedtools merge combines overlapping or "book-ended" features in an interval file into a single feature which spans all of the combined features. @@ -197,8 +196,8 @@ $ bedtools merge -i A.bed -scores collapse chr1 100 500 1,2,3 - @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/multiCov.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/multiCov.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,53 +6,70 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - bedtools multicov - -bed $input1 - -bam - #for $bam in $bams: - $bam.input +<![CDATA[ + #for $i, $bam in enumerate( $bams ): + ln -s -f $bam ${i}.bam && + ln -s -f $bam.metadata.bam_index ${i}.bam.bai && #end for - $strand - -f $overlap - $reciprocal - $split - -q $mapq - $duplicate - $failed - $proper - > $output + + bedtools multicov + -bed $input + -bams + #for $i, $bam in enumerate( $bams ): + ${i}.bam + #end for + $strand + -f $overlap + $reciprocal + $split + -q $q + $duplicate + $failed + $proper + > $output +]]> </command> <inputs> - <param name="input1" format="bed" type="data" label="First sorted BED file" /> + <param name="input" format="bed" type="data" label="Sorted BED file" /> <!-- Additional files, if the user needs more --> - <repeat name="bams" title="Add BAM files" > - <param name="input" format="bam" type="data" label="BAM file" /> - </repeat> + <param name="bams" format="bam" type="data" multiple="True" label="BAM file" /> + <expand macro="strand2" /> <expand macro="overlap" /> - <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" label="Require that the fraction overlap be reciprocal for A and B. In other words, if -f is 0.90 and -r is used, this requires that B overlap 90% of A and A _also_ overlaps 90% of B." /> + <expand macro="reciprocal" /> <expand macro="split" /> - - <param name="duplicate" type="boolean" checked="false" truevalue="-D" falsevalue="" label="Include duplicate reads. Default counts non-duplicates only" /> - <param name="failed" type="boolean" checked="false" truevalue="-F" falsevalue="" label=" Include failed-QC reads. Default counts pass-QC reads only" /> - <param name="proper" type="boolean" checked="false" truevalue="-p" falsevalue="" label="Only count proper pairs. Default counts all alignments with MAPQ > -q argument, regardless of the BAM FLAG field." /> + <param name="q" type="integer" value="0" label="Minimum mapping quality (MAPQ) allowed" help="(-q)" /> + <param name="duplicate" type="boolean" checked="False" truevalue="-D" falsevalue="" + label="Include duplicate reads" + help="Default counts non-duplicates only. (-D)" /> + <param name="failed" type="boolean" checked="false" truevalue="-F" falsevalue="" + label="Include failed-QC reads" + help="Default counts pass-QC reads only (-F)"/> + <param name="proper" type="boolean" checked="false" truevalue="-p" falsevalue="" + label="Only count proper pairs" + help="Default counts all alignments with MAPQ > -q argument, regardless of the BAM FLAG field. (-p)" /> </inputs> - <outputs> - <data format="bed" name="output" label="" /> + <data name="output" metadata_source="input" format_source="input" /> </outputs> + <tests> + <test> + <param name="input" value="multiCov1.bed" ftype="bed" /> + <param name="bams" value="srma_in3.bam,srma_in3.bam" ftpye="bam"/> + <param name="q" value="1"/> + <param name="split" value="False"/> + <output name="output" file="multiCovBed_result1.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools multicov, reports the count of alignments from multiple position-sorted and indexed BAM files that overlap intervals in a BED file. Specifically, for each BED interval provided, it reports a separate count of overlapping alignments from each BAM file. -.. class:: infomark - -bedtools multicov depends upon index BAM files in order to count the number of overlaps in each BAM file. As such, each BAM file should be position sorted (samtool sort aln.bam aln.sort) and indexed (samtools index aln.sort.bam) with either samtools or bamtools. @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/multiIntersectBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/multiIntersectBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,108 +6,92 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - multiIntersectBed +<![CDATA[ + bedtools multiinter $header + $cluster + -filler "${filler}" #if $zero.value == True: -empty - -g ${chromInfo} - #end if - - -i '$input1' - '$input2' - #for $q in $beds - '${q.input}' - #end for - - -names - #if $name1.choice == "tag": - '${input1.name}' - #else - '${name1.custom_name}' + -g $genome #end if - #if $name2.choice == "tag": - '${input2.name}' - #else - '${name2.custom_name}' + #if str($tag.tag_select) == "tag": + #set files = '" "'.join( [ str( $file ) for $file in $tag.inputs ] ) + -i "${files}" + #else: + -i + #for $file in $tag.beds: + "${file.input}" + #end for + -names + #for $file in $tag.beds: + "{$file.custom_name}" + #end for #end if - #for $q in $beds - #if $q.name.choice == "tag": - '${q.input.name}' - #else - '${q.input.custom_name}' - #end if - #end for - > '$output' + > '$output' +]]> </command> - <inputs> - <!-- Make it easy for the user, first two input files are always shown --> - <!-- INPUT 1 --> - <param name="input1" format="bed" type="data" label="First sorted BED file" /> - - <conditional name="name1"> - <param name="choice" type="select" label="Sample name"> + <conditional name="tag"> + <param name="tag_select" type="select" label="Sample name"> <option value="tag" selected="true">Use input's tag</option> - <option value="custom">Enter custom table name</option> + <option value="custom">Enter custom name per file</option> </param> <when value="tag"> + <param name="inputs" format="bed" type="data" multiple="True" label="BED files" /> </when> <when value="custom"> - <param name="custom_name" type="text" area="false" label="Custom sample name"/> - </when> - </conditional> - - <!-- INPUT 2 --> - <param name="input2" format="bed" type="data" label="Second sorted BED file" /> - - <conditional name="name2"> - <param name="choice" type="select" label="Sample name"> - <option value="tag" selected="true">Use input's tag</option> - <option value="custom">Enter custom table name</option> - </param> - <when value="tag"> - </when> - <when value="custom"> - <param name="custom_name" type="text" area="false" label="Custom sample name"/> + <repeat name="beds" title="Add BED files" min="2" > + <param name="input" format="bed" type="data" multiple="True" label="BED file" /> + <param name="custom_name" type="text" area="false" label="Custom sample name"/> + </repeat> </when> </conditional> - - <!-- Additional files, if the user needs more --> - <repeat name="beds" title="Add'l sorted BED files" > - <param name="input" format="bed" type="data" label="BED file" /> - - <conditional name="name"> - <param name="choice" type="select" label="Sample name"> - <option value="tag" selected="true">Use input's tag</option> - <option value="custom">Enter custom table name</option> - </param> - <when value="tag"> - </when> - <when value="custom"> - <param name="custom_name" type="text" area="false" label="Custom sample name"/> - </when> - </conditional> - </repeat> - - <param name="header" type="boolean" checked="true" truevalue="-header" falsevalue="" label="Print header line" help="The first line will include the name of each sample." /> - - <param name="zero" type="boolean" checked="true" label="Report regions that are not covered by any of the files" help="If set, regions that are not overlapped by any file will also be reported. Requires a valid organism key for all input datasets" /> + <expand macro="genome" /> + <param name="cluster" type="boolean" checked="false" truevalue="-cluster" falsevalue="" + label="Invoke Ryan Layers's clustering algorithm" + help="(-cluster)" /> + <param name="zero" type="boolean" checked="true" + label="Report regions that are not covered by any of the files" + help="If set, regions that are not overlapped by any file will also be reported. Requires a valid organism key for all input datasets" /> + <param name="filler" type="text" value="N/A" + label="Text to use for no-coverage value" + help="Can be 0.0, N/A, - or any other value. (-filler)" /> + <expand macro="print_header" /> </inputs> - <outputs> - <data format="tabular" name="output" metadata_source="input1" label="Common intervals identified from among ${input1.name}, ${input2.name} and so on." /> + <data format="bed" name="output" /> </outputs> + <tests> + <test> + <param name="tag_select" value="tag"/> + <param name="inputs" value="multiIntersectBed1.bed,multiIntersectBed2.bed,multiIntersectBed3.bed" ftype="bed" /> + <param name="zero" value="False"/> + <output name="output" file="multiIntersectBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="tag_select" value="tag"/> + <param name="inputs" value="multiIntersectBed1.bed,multiIntersectBed2.bed,multiIntersectBed3.bed" ftype="bed" /> + <param name="header" value="True"/> + <param name="zero" value="False"/> + <output name="output" file="multiIntersectBed_result2.bed" lines_diff="2" ftype="bed" /> + </test> + <test> + <param name="tag_select" value="tag"/> + <param name="inputs" value="multiIntersectBed1.bed,multiIntersectBed2.bed,multiIntersectBed3.bed" ftype="bed" /> + <param name="zero" value="True"/> + <param name="genome" value="multiIntersectBed1.len"/> + <output name="output" file="multiIntersectBed_result3.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** -This tool identifies common intervals among multiple, sorted BED files. Intervals can be common among 0 to N of the N input BED files. The pictorial and raw data examples below illustrate the behavior of this tool more clearly. - - -.. image:: http://people.virginia.edu/~arq5x/files/bedtools-galaxy/mbi.png +This tool identifies common intervals among multiple, sorted BED files. Intervals can be common among 0 to N of the N input BED files. .. class:: warningmark @@ -131,7 +115,7 @@ **Example input**:: # a.bed - chr1 6 12 + chr1 6 12bed chr1 10 20 chr1 22 27 chr1 24 30 @@ -190,7 +174,7 @@ @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/nucBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/nucBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,34 +6,54 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools nuc $strand $seq $pattern $case - -fi $fasta - -bed $inputA - > $output + -fi $fasta + -bed $input + > $output +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - <param format="fasta" name="fasta" type="data" label="Fasta file"/> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> + <param format="fasta" name="fasta" type="data" label="FASTA file"/> - <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Profile the sequence according to strand." /> - <param name="seq" type="boolean" checked="false" truevalue="-seq" falsevalue="" label="Print the extracted sequence." /> - <param name="pattern" type="boolean" checked="false" truevalue="-pattern" falsevalue="" label="Report the number of times a user-defined sequence is observed (case-sensitive)." /> - <param name="case" type="boolean" checked="false" truevalue="-C" falsevalue="" label="Igore case when matching -pattern." /> + <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" + label="Profile the sequence according to strand" help="(-s)"/> + <param name="seq" type="boolean" checked="false" truevalue="-seq" falsevalue="" + label="Print the extracted sequence" help="(-seq)"/> + <param name="pattern" type="boolean" checked="false" truevalue="-pattern" falsevalue="" + label="Report the number of times a user-defined sequence is observed" help="case-sensitive (-pattern)" /> + <param name="case" type="boolean" checked="false" truevalue="-C" falsevalue="" + label="Igore case when matching -pattern" help="(-C)"/> </inputs> <outputs> - <data format="fasta" name="output" /> + <data format="tabular" name="output" /> </outputs> + <tests> + <test> + <param name="input" value="nucBed1.bed" ftype="bed" /> + <param name="fasta" value="nucBed1.fasta" ftype="fasta" /> + <output name="output" file="nucBed_result1.bed" ftype="tabular" /> + </test> + <test> + <param name="input" value="nucBed1.bed" ftype="bed" /> + <param name="fasta" value="nucBed1.fasta" ftype="fasta" /> + <param name="seq" value="True" /> + <output name="output" file="nucBed_result2.bed" ftype="tabular" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Profiles the nucleotide content of intervals in a fasta file. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/overlapBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/overlapBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,25 +6,37 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - overlap - -i $inputA +<![CDATA[ + bedtools overlap + -i $input -cols $cols - > $output + > $output +]]> </command> <inputs> - <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> - <param name="cols" type="text" value="" area="True" size="20x10" label="Specify the columns (1-based) for the starts and ends of the features for which you’d like to compute the overlap/distance. The columns must be listed in the following order: start1,end1,start2,end2" /> + <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> + <param name="cols" type="data_column" multiple="True" data_ref="input" + label="Specify the columns for the starts and ends of the features for which you’d like to compute the overlap/distance" + help="The columns must be listed in the following order: start1,end1,start2,end2" /> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label="Overlap of ${inputA.name}"/> + <data format_source="input" name="output" metadata_source="input" label="Overlap of ${input.name}"/> </outputs> + <tests> + <test> + <param name="input" value="windowBed_result1.bed" ftype="bed" /> + <param name="cols" value="2,3,5,6" /> + <output name="output" file="overlapBed_result1.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** overlap computes the amount of overlap (in the case of positive values) or distance (in the case of negative values) between feature coordinates occurring on the same input line and reports the result at the end of the same line. In this way, it is a useful method for computing custom overlap scores from the output of other BEDTools. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/randomBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/randomBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,30 +6,44 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools random -g $genome -l $length -n $intervals - #if $seed.choose: - -seed $seed.seed + #if $seed.seed_choose: + -seed $seed.seed #end if + > "$output" +]]> </command> <inputs> <expand macro="genome" /> - <param name="length" type="integer" value="100" label="The length of the intervals to generate." /> - <param name="intervals" type="integer" value="1000000" label="The number of intervals to generate." /> + <param name="length" type="integer" value="100" label="The length of the intervals to generate" help="(-l)" /> + <param name="intervals" type="integer" value="1000000" label="The number of intervals to generate" help="(-n)" /> <expand macro="seed" /> </inputs> <outputs> <data format="bed" name="output" /> </outputs> + <tests> + <test> + <param name="genome" value="mm9_chr1.len" /> + <param name="seed_choose" value="True" /> + <param name="seed" value="1" /> + <param name="length" value="5" /> + <param name="intervals" value="3" /> + <output name="output" file="randomBed_result1.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools random will generate a random set of intervals in BED6 format. One can specify both the number (-n) and the size (-l) of the intervals that should be generated. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/reldist.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/reldist.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,31 +6,44 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools reldist -a $inputA -b $inputB $detail + > "$output" +]]> </command> <inputs> <param format="bed,bam,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF/BAM file"/> <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/> - <param name="detail" type="boolean" checked="false" truevalue="-detail" falsevalue="" label="Instead of a summary, report the relative distance for each interval in A" help="" /> + <param name="detail" type="boolean" checked="false" truevalue="-detail" falsevalue="" + label="Instead of a summary, report the relative distance for each interval in A" help="(-detail)" /> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label="Intersection of ${inputA.name} and ${inputB.name}"/> + <data format_source="inputA" name="output" metadata_source="inputA" label="Relalative distance of ${inputA.name} and ${inputB.name}"/> </outputs> + <tests> + <test> + <param name="inputA" value="windowBed_result1.bed" ftype="bed" /> + <param name="inputB" value="windowBed_result1.bed" ftype="bed" /> + <output name="output" file="reldistBed_result1.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** -Traditional approaches to summarizing the similarity between two sets of genomic intervals are based upon the number or proportion of intersecting intervals. However, such measures are largely blind to spatial correlations between the two sets where, dpesite consistent spacing or proximity, intersections are rare (for example, enhancers and transcription start sites rarely overlap, yet they are much closer to one another than two sets of random intervals). Favorov et al [1] proposed a relative distance metric that describes distribution of relative distances between each interval in one set nd the two closest intervals in another set (see figure above). If there is no spatial correlation between the two sets, one would expect the relative distances to be uniformaly distributed among the relative distances ranging from 0 to 0.5. If, however, the intervals tend to be much closer than expected by chance, the distribution of observed relative distances would be shifted towards low relative distance values (e.g., the figure below). +Traditional approaches to summarizing the similarity between two sets of genomic intervals are based upon the number or proportion of intersecting intervals. However, such measures are largely blind to spatial correlations between the two sets where, dpesite consistent spacing or proximity, intersections are rare (for example, enhancers and transcription start sites rarely overlap, yet they are much closer to one another than two sets of random intervals). Favorov et al proposed a relative distance metric that describes distribution of relative distances between each interval in one set nd the two closest intervals in another set (see figure above). If there is no spatial correlation between the two sets, one would expect the relative distances to be uniformaly distributed among the relative distances ranging from 0 to 0.5. If, however, the intervals tend to be much closer than expected by chance, the distribution of observed relative distances would be shifted towards low relative distance values (e.g., the figure below). .. image:: $PATH_TO_IMAGES/reldist-glyph.png .. class:: infomark @REFERENCES@ - +]]> </help> - <expand macro="citations" /> + <expand macro="citations"> + <citation type="doi">10.1371/journal.pcbi.1002529</citation> + </expand> </tool>
--- a/shuffleBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/shuffleBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,63 +6,107 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools shuffle -g $genome -i $inputA $bedpe - #if $seed.choose: - -seed $seed.seed + #if str($seed.seed_choose) == "True": + -seed $seed.seed #end if - #if $excl.choose: - -excl $excl.excl - -f $overlap - #end if - #if $incl.choose: - -incl $incl.incl + #if str($add_bed.add_bed_select) == "not_be": + -excl $add_bed_select.excl + -f $add_bed_select.overlap + #elif str($add_bed.add_bed_select) == "be": + -incl $add_bed_select.incl #end if $chrom $chromfirst - $nooverlap - $allowBeyond + $no_overlap + $allow_beyond -maxTries $maxtries - > $output + > $output +]]> </command> <inputs> <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> <param name="bedpe" type="boolean" label="The file is in BEDPE format" selected="False" truevalue="-bedpe" falsevalue="" /> <expand macro="genome" /> - <param name="chrom" type="boolean" label="Keep features in the input file on the same chromosome. Solely permute their location on the chromosome. By default, both the chromosome and position are randomly chosen" selected="False" truevalue="-chrom" falsevalue="" /> + <param name="chrom" type="boolean" selected="False" truevalue="-chrom" falsevalue="" + label="Keep features in the input file on the same chromosome" + help="Solely permute their location on the chromosome. By default, both the chromosome and position are randomly chosen. (-chrom)" /> <expand macro="seed" /> - <conditional name="excl"> - <param name="choose" type="boolean" label="Choose a BED file of coordinates in which features from -i should not be placed?" selected="False" truevalue="True" falsevalue="False" /> - <when value="True"> + <conditional name="add_bed"> + <param name="add_bed_select" type="select" label="Choose an additional BED file"> + <option value="no" selected="True">No additional BED file</option> + <option value="not_be">Coordinates in which features from -i should not be placed?</option> + <option value="be">coordinates in which features from -i should be placed?</option> + </param> + <when value="not_be"> <param name="excl" type="data" format="bed" label="Choose File" /> <expand macro="overlap" /> </when> - </conditional> - <conditional name="incl"> - <param name="choose" type="boolean" label="Choose a BED file of coordinates in which features from -i should be placed?" selected="False" truevalue="True" falsevalue="False" /> - <when value="True"> + <when value="be"> <param name="incl" type="data" format="bed" label="Choose File" /> </when> </conditional> - <param name="chromfirst" type="boolean" selected="False" truevalue="-chromFirst" falsevalue="" - label="Instead of choosing a position randomly among the entire genome (the default), first choose a chrom randomly, and then choose a random start coordinate on that chrom. This leads to features being ~uniformly distributed among the chroms, as opposed to features being distribute as a function of chrom size" /> - <param name="maxtries" type="integer" value="1000" label="Max. number of attempts to find a home for a shuffled interval in the presence of -incl or -excl" /> - <param name="nooverlap" type="boolean" selected="False" truevalue="-noOverlapping" falsevalue="" label="Don’t allow shuffled intervals to overlap" /> - <param name="allowBeyond" type="boolean" selected="False" truevalue="-allowBeyondChromEnd" falsevalue="" label="Allow the original the length of the original records to extebd beyond the length of the chromosome." /> + label="Choose chromosome first" + help="Instead of choosing a position randomly among the entire genome (the default), first choose a chrom randomly, and then choose a random start coordinate on that chrom. This leads to features being ~uniformly distributed among the chroms, as opposed to features being distribute as a function of chrom size. (-chromFirst)" /> + <param name="maxtries" type="integer" value="1000" + label="Max. number of attempts to find a home for a shuffled interval in the presence of -incl or -excl" help="(-maxTries)" /> + <param name="no_overlap" type="boolean" selected="False" truevalue="-noOverlapping" falsevalue="" + label="Don’t allow shuffled intervals to overlap" help="(-noOverlapping)" /> + <param name="allow_beyond" type="boolean" selected="False" truevalue="-allowBeyondChromEnd" falsevalue="" + label="Allow the original the length of the original records to extebd beyond the length of the chromosome" help="(-allowBeyondChromEnd)" /> </inputs> <outputs> <data format="bed" name="output" /> </outputs> + <tests> + <test> + <param name="inputA" value="shuffleBed1.bed" ftype="bed" /> + <param name="genome" value="shuffleBed.len" ftype="tabular" /> + <param name="chrom" value="" /> + <param name="seed_choose" value="True" /> + <param name="seed" value="1" /> + <output name="output" file="shuffleBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="shuffleBed1.bed" ftype="bed" /> + <param name="genome" value="shuffleBed.len" ftype="tabular" /> + <param name="chrom" value="True" /> + <param name="seed_choose" value="True" /> + <param name="seed" value="1" /> + <output name="output" file="shuffleBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="shuffleBed1.bed" ftype="bed" /> + <param name="genome" value="shuffleBed.len" ftype="tabular" /> + <param name="excl" value="shuffleBed2.bed" ftype="bed" /> + <param name="seed_choose" value="True" /> + <param name="seed" value="1" /> + <output name="output" file="shuffleBed_result3.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="shuffleBed1.bed" ftype="bed" /> + <param name="genome" value="shuffleBed.len" ftype="bed" /> + <param name="allow_beyond" value="True" /> + <param name="seed_choose" value="True" /> + <param name="seed" value="1" /> + <output name="output" file="shuffleBed_result4.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools shuffle will randomly permute the genomic locations of a feature file among a genome defined in a genome file. One can also provide an “exclusions” BED/GFF/VCF file that lists regions where you do not want the permuted features to be placed. For example, one might want to prevent features from being placed in known genome gaps. shuffle is useful as a null basis against which to test the significance of associations of one feature with another. + .. image:: $PATH_TO_IMAGES/shuffle-glyph.png + @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/slopBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/slopBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,34 +6,56 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools slop $pct $strand -g $genome -i $inputA #if $addition.addition_select == 'b': - -b $addition.b + -b $addition.b #else: - -l $addition.l - -r $addition.r + -l $addition.l + -r $addition.r #end if $header - - > $output + > $output +]]> </command> <inputs> <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> <expand macro="genome" /> - <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue="" label="Define -l and -r as a fraction of the feature’s length" help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" /> - <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" label="Define -l and -r based on strand" help="For example. if used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" /> + <param name="pct" type="boolean" checked="false" truevalue="-pct" falsevalue="" + label="Define -l and -r as a fraction of the feature’s length" + help="E.g. if used on a 1000bp feature, -l 0.50, will add 500 bp “upstream”" /> + <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" + label="Define -l and -r based on strand" + help="If used, -l 500 for a negative-stranded feature, it will add 500 bp to the end coordinate" /> <expand macro="addition" /> - <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the input file prior to results." /> + <expand macro="print_header" /> </inputs> <outputs> - <data format="bed" name="output" label=""/> + <data format="bed" name="output"/> </outputs> + <tests> + <test> + <param name="inputA" value="a.bed" ftype="bed" /> + <param name="genome" value="mm9_chr1.len" ftype="bed" /> + <param name="addition_select" value="b" /> + <param name="b" value="5" /> + <output name="output" file="slopBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="a.bed" ftype="bed" /> + <param name="genome" value="mm9_chr1.len" ftype="bed" /> + <param name="addition_select" value="lr" /> + <param name="l" value="2" /> + <param name="r" value="3" /> + <output name="output" file="slopBed_result2.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools slop will increase the size of each feature in a feature file by a user-defined number of bases. While something like this could be done with an awk '{OFS="\t" print $1,$2-<slop>,$3+<slop>}', bedtools slop will restrict the resizing to the size of the chromosome (i.e. no start < 0 and no end > chromosome size). @@ -44,6 +66,7 @@ In order to prevent the extension of intervals beyond chromosome boundaries, bedtools slop requires a genome file defining the length of each chromosome or contig. @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/sortBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/sortBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,7 +6,12 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> - sortBed -i $input $option > $output +<![CDATA[ + sortBed + -i $input + $option + > $output +]]> </command> <inputs> <param format="bed" name="input" type="data" label="Sort the following BED file"/> @@ -21,13 +26,18 @@ <option value="-chrThenScoreD">chromosome, then by score (desc).</option> </param> </inputs> - <outputs> <data format="bed" name="output" metadata_source="input" label="${input.name} (as BED)"/> </outputs> - + <tests> + <test> + <param name="input" value="sortBed1.bed" ftype="bed" /> + <param name="option" value="" /> + <output name="output" file="sortBed_result1.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Sorts a feature file by chromosome and other criteria. @@ -40,7 +50,7 @@ by chromosome then by start position in the following manner: sort -k 1,1 -k2,2 -n a.bed @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/subtractBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/subtractBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,37 +6,51 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools subtract $strand -a $inputA -b $inputB -f $overlap $removeIfOverlap - > $output + > $output +]]> </command> <inputs> <param format="bed,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF file"/> <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/> <expand macro="strand2" /> <expand macro="overlap" /> - - <param name="strand" type="select" label="Calculation based on strandedness?"> - <option value="" selected="True">Overlaps on either strand</option> - <option value="-s">Only overlaps occurring on the **same** strand.</option> - <option value="-S">Only overlaps occurring on the **opposite** strand.</option> - </param> - <param name="removeIfOverlap" type="select" label="Calculation based on strandedness?"> <option value="" selected="True">Dont Remove entire feature on overlap</option> - <option value="-A">Remove entire feature if any overlap. That is, by default, only subtract the portion of A that overlaps B. Here, if any overlap is found (or -f amount), the entire feature is removed.</option> - <option value="-N">Same as -A except when used with -f, the amount is the sum of all features (not any single feature).</option> + <option value="-A">Remove entire feature if any overlap. That is, by default, only subtract the portion of A that overlaps B. Here, if any overlap is found (or -f amount), the entire feature is removed</option> + <option value="-N">Same as -A except when used with -f, the amount is the sum of all features (not any single feature)</option> </param> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA" label=""/> + <data format_source="inputA" name="output" metadata_source="inputA"/> </outputs> + <tests> + <test> + <param name="inputA" value="subtractBed1.bed" ftype="bed" /> + <param name="inputB" value="subtractBed2.bed" ftype="bed" /> + <output name="output" file="subtractBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="subtractBed1.bed" ftype="bed" /> + <param name="inputB" value="subtractBed2.bed" ftype="bed" /> + <param name="overlap" value="0.80" /> + <output name="output" file="subtractBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="subtractBed1.bed" ftype="bed" /> + <param name="inputB" value="subtractBed2.bed" ftype="bed" /> + <param name="removeIfOverlap" value="-A" /> + <output name="output" file="subtractBed_result3.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** bedtools subtract searches for features in B that overlap A. If an overlapping feature is found in B, the overlapping portion is removed from A and the remaining portion of A is reported. If a feature in B overlaps all of a feature in A, the A feature will not be reported. @@ -44,6 +58,7 @@ .. image:: $PATH_TO_IMAGES/subtract-glyph.png @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>
--- a/tagBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/tagBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,46 +6,50 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ + #set files = '" "'.join( [ str( $file ) for $file in $inputB ] ) bedtools tag - -i $inputA - -files - #for $bed in beds: - $bed.input - #end for + -i "${inputA}" + -files "${files}" -f $overlap $strand - -tag $tag + -tag "${tag}" $field - > $output + > "${output}" +]]> </command> <inputs> - <param format="bam" name="inputA" type="data" label="BAM file"/> - - <repeat name="beds" title="Add files" > - <param name="input" format="bed,gff,vcf" type="data" label="BED/VCF/GFF file" /> - </repeat> + <param name="inputA" format="bam" type="data" label="BAM file"/> + <param name="inputB" format="bed,gff,vcf" multiple="True" type="data" label="BED/VCF/GFF file" /> <expand macro="strand2" /> <expand macro="overlap" /> - - <param name="tag" type="text" value="YB" label="Dictate what the tag should be." /> - <param name="field" type="select" label="Use which field from the annotation files to populate tags?"> - <option value="-labels" selected="True">labels</option> + <param name="tag" type="text" value="YB" label="Specify the tag to use" /> + <param name="field" type="select" label="Field from the annotation files to populate tags?"> + <option value="-labels" selected="True">Labels</option> <option value="-scores">Scores</option> <option value="-names">Names</option> <option value="-labels -intervals">Intervals</option> </param> </inputs> <outputs> - <data format="bed" name="output" label="" /> + <data format="bam" name="output"/> </outputs> + <tests> + <test> + <param name="inputA" value="srma_in3.bam" ftype="bam" /> + <param name="inputB" value="tagBed1.bed" ftype="bed" /> + <param name="field" value="-names" /> + <output name="output" file="tagBed_result1.bam" ftype="bam" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Annotates a BAM file based on overlaps with multiple BED/GFF/VCF files on the intervals in an input bam file @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/test-data/0.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -chr1 100 200 -chr1 180 250 -chr1 250 500 -chr1 501 1000
--- a/test-data/0_result.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -chr1 100 500 -chr1 501 1000
--- a/test-data/1.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -chr1 100 200 a1 1 + -chr1 180 250 a2 2 + -chr1 250 500 a3 3 - -chr1 501 1000 a4 4 +
--- a/test-data/1_result.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,3 +0,0 @@ -chr1 100 250 + -chr1 501 1000 + -chr1 250 500 -
--- a/test-data/2.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -chr1 100 200 -chr1 180 250 -chr1 250 500 -chr1 501 1000
--- a/test-data/2_result.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -chr1 100 500 3 -chr1 501 1000 1
--- a/test-data/3.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -chr1 100 200 -chr1 501 1000
--- a/test-data/3_result_1000.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -chr1 100 200 1000
--- a/test-data/A.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,5 +0,0 @@ -chr1 100 200 -chr1 180 250 -chr1 250 500 -chr1 501 1000 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/a.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 100 200 +chr1 180 250 +chr1 250 500 +chr1 501 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annotateBed_result.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 100 200 nasty 1 - 0.500000 1.000000 0.300000 +chr2 500 1000 ugly 2 + 0.000000 0.600000 1.000000 +chr3 1000 5000 big 3 - 1.000000 0.250000 0.000000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamToBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,8 @@ +dummy_chr 1278 1354 GA5:3:2:1710:1301#0 18 + +dummy_chr 128881 128957 GA5:3:24:462:583#0 37 + +dummy_chr 5591012 5591088 GA5:3:29:1241:1653#0 37 + +dummy_chr 11880047 11880123 GA5:3:33:1591:303#0 37 + +dummy_chr 11880930 11881006 GA5:3:31:677:1537#0 37 - +dummy_chr 11913867 11913943 GA5:3:49:1480:1116#0 37 - +dummy_chr 13030395 13030471 GA5:3:61:213:1812#0 37 - +dummy_chr 15055983 15056059 GA5:3:116:1581:552#0 37 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamToBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,8 @@ +dummy_chr 1278 1354 GA5:3:2:1710:1301#0 0 + +dummy_chr 128881 128957 GA5:3:24:462:583#0 3 + +dummy_chr 5591012 5591088 GA5:3:29:1241:1653#0 1 + +dummy_chr 11880047 11880123 GA5:3:33:1591:303#0 0 + +dummy_chr 11880930 11881006 GA5:3:31:677:1537#0 0 - +dummy_chr 11913867 11913943 GA5:3:49:1480:1116#0 1 - +dummy_chr 13030395 13030471 GA5:3:61:213:1812#0 1 - +dummy_chr 15055983 15056059 GA5:3:116:1581:552#0 0 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bed12.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 14756 15038 JUNC00000001 294 - 14756 15038 255,0,0 2 73,69 0,213 +chr1 14969 15836 JUNC00000002 144 - 14969 15836 255,0,0 2 69,41 0,826 +chr1 15905 16677 JUNC00000003 12 - 15905 16677 255,0,0 2 42,71 0,701
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bed12ToBed6_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,6 @@ +chr1 14756 14829 JUNC00000001 294 - +chr1 14969 15038 JUNC00000001 294 - +chr1 14969 15038 JUNC00000002 144 - +chr1 15795 15836 JUNC00000002 144 - +chr1 15905 15947 JUNC00000003 12 - +chr1 16606 16677 JUNC00000003 12 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bedToBam1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,5 @@ +chr1 100 200 foo +chr1 180 250 bar +chr1 250 500 world +chr1 501 1000 peace +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bedpeToBamBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 200 chr5 5000 5100 bedpe_example1 30 + - +chr9 1000 5000 chr9 3000 3800 bedpe_example2 100 + -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_a.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 10 20 a1 1 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_b1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 5 6 b1.1 1 - +chr1 30 40 b1.2 2 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_b2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 0 1 b2.1 1 - +chr1 21 22 b2.2 2 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_c.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 10 20 a1 1 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_d.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 7 8 b1 1 + +chr1 22 23 b2 2 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 100 200 chr1 500 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 a1 1 - 1 chr1 5 6 b1.1 1 - 5 +chr1 10 20 a1 1 - 2 chr1 21 22 b2.2 2 + 2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 10 20 a1 1 - 2 chr1 21 22 b2.2 2 + 2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_result4.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 a1 1 + chr1 7 8 b1 1 + -3 +chr1 10 20 a1 1 + chr1 22 23 b2 2 - 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/closestBed_result5.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 a1 1 + chr1 7 8 b1 1 + -3 +chr1 10 20 a1 1 + chr1 22 23 b2 2 - 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/clusterBed_result.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 100 200 1 +chr1 180 250 1 +chr1 250 500 1 +chr1 501 1000 2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/complementBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 0 100 +chr1 500 501 +chr1 1000 197195432
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/coverageBedA.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 10 20 +chr1 20 30 +chr1 30 40 +chr1 100 200
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/coverageBedB.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 0 100 +chr1 100 200 +chr2 0 100
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/coverageBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 10 20 1 10 10 1.0000000 +chr1 20 30 1 10 10 1.0000000 +chr1 30 40 1 10 10 1.0000000 +chr1 100 200 1 100 100 1.0000000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expandBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 1,2,3 10,20,30 +chr1 40 50 4,5,6 40,50,60
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expandBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,6 @@ +chr1 10 20 1,2,3 10 +chr1 10 20 1,2,3 20 +chr1 10 20 1,2,3 30 +chr1 40 50 4,5,6 40 +chr1 40 50 4,5,6 50 +chr1 40 50 4,5,6 60
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/expandBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,6 @@ +chr1 10 20 1 10 +chr1 10 20 2 20 +chr1 10 20 3 30 +chr1 40 50 4 40 +chr1 40 50 5 50 +chr1 40 50 6 60
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fisherBed.len Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 500
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fisherBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 +chr1 30 40 +chr1 51 52
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fisherBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 15 25 +chr1 51 52
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fisherBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,14 @@ +# Number of query intervals: 3 +# Number of db intervals: 2 +# Number of overlaps: 2 +# Number of possible intervals (estimated): 34 +# phyper(2 - 1, 3, 34 - 3, 2, lower.tail=F) +# Contingency Table Of Counts +#_________________________________________ +# | in -b | not in -b | +# in -a | 2 | 1 | +# not in -a | 0 | 31 | +#_________________________________________ +# p-values for fisher's exact test +left right two-tail ratio +1 0.0053476 0.0053476 inf
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/flankBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,8 @@ +chr1 95 100 +chr1 200 205 +chr1 175 180 +chr1 250 255 +chr1 245 250 +chr1 500 505 +chr1 496 501 +chr1 1000 1005
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/flankBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,8 @@ +chr1 98 100 +chr1 200 203 +chr1 178 180 +chr1 250 253 +chr1 248 250 +chr1 500 503 +chr1 499 501 +chr1 1000 1003
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genomeCoverageBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 +chr1 20 30 +chr2 0 500
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genomeCoverageBed1.len Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 1000 +chr2 500
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genomeCoverageBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 0 1000 1000 1 +chr2 0 500 500 1 +genome 0 1500 1500 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/getfastaBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +>chr1:10-100 +TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/getfastaBed_result2.tabular Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1:10-100 TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
--- a/test-data/groupbyBed.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,14 +0,0 @@ -chr21 9719758 9729320 variant1 chr21 9719768 9721892 ALR/Alpha 1004 + -chr21 9719758 9729320 variant1 chr21 9721905 9725582 ALR/Alpha 1010 + -chr21 9719758 9729320 variant1 chr21 9725582 9725977 L1PA3 3288 + -chr21 9719758 9729320 variant1 chr21 9726021 9729309 ALR/Alpha 1051 + -chr21 9729310 9757478 variant2 chr21 9729320 9729809 L1PA3 3897 - -chr21 9729310 9757478 variant2 chr21 9729809 9730866 L1P1 8367 + -chr21 9729310 9757478 variant2 chr21 9730866 9734026 ALR/Alpha 1036 - -chr21 9729310 9757478 variant2 chr21 9734037 9757471 ALR/Alpha 1182 - -chr21 9795588 9796685 variant3 chr21 9795589 9795713 (GAATG)n 308 + -chr21 9795588 9796685 variant3 chr21 9795736 9795894 (GAATG)n 683 + -chr21 9795588 9796685 variant3 chr21 9795911 9796007 (GAATG)n 345 + -chr21 9795588 9796685 variant3 chr21 9796028 9796187 (GAATG)n 756 + -chr21 9795588 9796685 variant3 chr21 9796202 9796615 (GAATG)n 891 + -chr21 9795588 9796685 variant3 chr21 9796637 9796824 (GAATG)n 621 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/groupbyBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,14 @@ +chr21 9719758 9729320 variant1 chr21 9719768 9721892 ALR/Alpha 1004 + +chr21 9719758 9729320 variant1 chr21 9721905 9725582 ALR/Alpha 1010 + +chr21 9719758 9729320 variant1 chr21 9725582 9725977 L1PA3 3288 + +chr21 9719758 9729320 variant1 chr21 9726021 9729309 ALR/Alpha 1051 + +chr21 9729310 9757478 variant2 chr21 9729320 9729809 L1PA3 3897 - +chr21 9729310 9757478 variant2 chr21 9729809 9730866 L1P1 8367 + +chr21 9729310 9757478 variant2 chr21 9730866 9734026 ALR/Alpha 1036 - +chr21 9729310 9757478 variant2 chr21 9734037 9757471 ALR/Alpha 1182 - +chr21 9795588 9796685 variant3 chr21 9795589 9795713 (GAATG)n 308 + +chr21 9795588 9796685 variant3 chr21 9795736 9795894 (GAATG)n 683 + +chr21 9795588 9796685 variant3 chr21 9795911 9796007 (GAATG)n 345 + +chr21 9795588 9796685 variant3 chr21 9796028 9796187 (GAATG)n 756 + +chr21 9795588 9796685 variant3 chr21 9796202 9796615 (GAATG)n 891 + +chr21 9795588 9796685 variant3 chr21 9796637 9796824 (GAATG)n 621 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/groupbyBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr21 9719758 9729320 6353 +chr21 9729310 9757478 14482 +chr21 9795588 9796685 3604
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/groupbyBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr21 9719758 9729320 1004 +chr21 9729310 9757478 1036 +chr21 9795588 9796685 308
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/groupbyBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr21 9719758 9729320 variant1 1030.5 +chr21 9729310 9757478 variant2 2539.5 +chr21 9795588 9796685 variant3 652
--- a/test-data/groupbyinput.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,14 +0,0 @@ -chr21 9719758 9729320 variant1 chr21 9719768 9721892 ALR/Alpha 1004 + -chr21 9719758 9729320 variant1 chr21 9721905 9725582 ALR/Alpha 1010 + -chr21 9719758 9729320 variant1 chr21 9725582 9725977 L1PA3 3288 + -chr21 9719758 9729320 variant1 chr21 9726021 9729309 ALR/Alpha 1051 + -chr21 9729310 9757478 variant2 chr21 9729320 9729809 L1PA3 3897 - -chr21 9729310 9757478 variant2 chr21 9729809 9730866 L1P1 8367 + -chr21 9729310 9757478 variant2 chr21 9730866 9734026 ALR/Alpha 1036 - -chr21 9729310 9757478 variant2 chr21 9734037 9757471 ALR/Alpha 1182 - -chr21 9795588 9796685 variant3 chr21 9795589 9795713 (GAATG)n 308 + -chr21 9795588 9796685 variant3 chr21 9795736 9795894 (GAATG)n 683 + -chr21 9795588 9796685 variant3 chr21 9795911 9796007 (GAATG)n 345 + -chr21 9795588 9796685 variant3 chr21 9796028 9796187 (GAATG)n 756 + -chr21 9795588 9796685 variant3 chr21 9796202 9796615 (GAATG)n 891 + -chr21 9795588 9796685 variant3 chr21 9796637 9796824 (GAATG)n 621 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersectBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 +chr1 30 40
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersectBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 15 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersectBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 10 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersectBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 10 20 chr1 15 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersectBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 30 40
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/jaccardBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 +chr1 30 40
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/jaccardBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 15 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/jaccardBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +intersection union-intersection jaccard n_intersections +5 20 0.25 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/jaccardBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +intersection union-intersection jaccard n_intersections +5 20 0.25 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/linksBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr21 9928613 10012791 uc002yip.1 0 - +chr21 9928613 10012791 uc002yiq.1 0 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/linksBed_result1.html Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,33 @@ +<html> + <body> +<title>/tmp/tmp5hihJcfiles/000/dataset_1.dat</title> +<br>Firefox users: Press and hold the "apple" or "alt" key and click link to open in new tab. +<p style="font-family:courier"> +<table border="0" align="justify" +<h3>BED Entries from: stdin </h3> +<tr> + <td> + <a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=&db=&position=chr21:9928613-10012791>chr21:9928614-10012791</a> + </td> + <td> +uc002yip.1 0 + </td> + <td> +- + </td> +</tr> +<tr> + <td> + <a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=&db=&position=chr21:9928613-10012791>chr21:9928614-10012791</a> + </td> + <td> +uc002yiq.1 0 + </td> + <td> +- + </td> +</tr> +</table> +</p> + </body> +</html>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/linksBed_result2.html Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,33 @@ +<html> + <body> +<title>/tmp/tmp5hihJcfiles/000/dataset_3.dat</title> +<br>Firefox users: Press and hold the "apple" or "alt" key and click link to open in new tab. +<p style="font-family:courier"> +<table border="0" align="justify" +<h3>BED Entries from: stdin </h3> +<tr> + <td> + <a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=mouse&db=mm9&position=chr21:9928613-10012791>chr21:9928614-10012791</a> + </td> + <td> +uc002yip.1 0 + </td> + <td> +- + </td> +</tr> +<tr> + <td> + <a href=http://genome.ucsc.edu/cgi-bin/hgTracks?org=mouse&db=mm9&position=chr21:9928613-10012791>chr21:9928614-10012791</a> + </td> + <td> +uc002yiq.1 0 + </td> + <td> +- + </td> +</tr> +</table> +</p> + </body> +</html>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/makeWindowBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr5 60000 70000 +chr5 73000 90000 +chr5 100000 101000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/makeWindowBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,198 @@ +chr1 0 1000000 +chr1 1000000 2000000 +chr1 2000000 3000000 +chr1 3000000 4000000 +chr1 4000000 5000000 +chr1 5000000 6000000 +chr1 6000000 7000000 +chr1 7000000 8000000 +chr1 8000000 9000000 +chr1 9000000 10000000 +chr1 10000000 11000000 +chr1 11000000 12000000 +chr1 12000000 13000000 +chr1 13000000 14000000 +chr1 14000000 15000000 +chr1 15000000 16000000 +chr1 16000000 17000000 +chr1 17000000 18000000 +chr1 18000000 19000000 +chr1 19000000 20000000 +chr1 20000000 21000000 +chr1 21000000 22000000 +chr1 22000000 23000000 +chr1 23000000 24000000 +chr1 24000000 25000000 +chr1 25000000 26000000 +chr1 26000000 27000000 +chr1 27000000 28000000 +chr1 28000000 29000000 +chr1 29000000 30000000 +chr1 30000000 31000000 +chr1 31000000 32000000 +chr1 32000000 33000000 +chr1 33000000 34000000 +chr1 34000000 35000000 +chr1 35000000 36000000 +chr1 36000000 37000000 +chr1 37000000 38000000 +chr1 38000000 39000000 +chr1 39000000 40000000 +chr1 40000000 41000000 +chr1 41000000 42000000 +chr1 42000000 43000000 +chr1 43000000 44000000 +chr1 44000000 45000000 +chr1 45000000 46000000 +chr1 46000000 47000000 +chr1 47000000 48000000 +chr1 48000000 49000000 +chr1 49000000 50000000 +chr1 50000000 51000000 +chr1 51000000 52000000 +chr1 52000000 53000000 +chr1 53000000 54000000 +chr1 54000000 55000000 +chr1 55000000 56000000 +chr1 56000000 57000000 +chr1 57000000 58000000 +chr1 58000000 59000000 +chr1 59000000 60000000 +chr1 60000000 61000000 +chr1 61000000 62000000 +chr1 62000000 63000000 +chr1 63000000 64000000 +chr1 64000000 65000000 +chr1 65000000 66000000 +chr1 66000000 67000000 +chr1 67000000 68000000 +chr1 68000000 69000000 +chr1 69000000 70000000 +chr1 70000000 71000000 +chr1 71000000 72000000 +chr1 72000000 73000000 +chr1 73000000 74000000 +chr1 74000000 75000000 +chr1 75000000 76000000 +chr1 76000000 77000000 +chr1 77000000 78000000 +chr1 78000000 79000000 +chr1 79000000 80000000 +chr1 80000000 81000000 +chr1 81000000 82000000 +chr1 82000000 83000000 +chr1 83000000 84000000 +chr1 84000000 85000000 +chr1 85000000 86000000 +chr1 86000000 87000000 +chr1 87000000 88000000 +chr1 88000000 89000000 +chr1 89000000 90000000 +chr1 90000000 91000000 +chr1 91000000 92000000 +chr1 92000000 93000000 +chr1 93000000 94000000 +chr1 94000000 95000000 +chr1 95000000 96000000 +chr1 96000000 97000000 +chr1 97000000 98000000 +chr1 98000000 99000000 +chr1 99000000 100000000 +chr1 100000000 101000000 +chr1 101000000 102000000 +chr1 102000000 103000000 +chr1 103000000 104000000 +chr1 104000000 105000000 +chr1 105000000 106000000 +chr1 106000000 107000000 +chr1 107000000 108000000 +chr1 108000000 109000000 +chr1 109000000 110000000 +chr1 110000000 111000000 +chr1 111000000 112000000 +chr1 112000000 113000000 +chr1 113000000 114000000 +chr1 114000000 115000000 +chr1 115000000 116000000 +chr1 116000000 117000000 +chr1 117000000 118000000 +chr1 118000000 119000000 +chr1 119000000 120000000 +chr1 120000000 121000000 +chr1 121000000 122000000 +chr1 122000000 123000000 +chr1 123000000 124000000 +chr1 124000000 125000000 +chr1 125000000 126000000 +chr1 126000000 127000000 +chr1 127000000 128000000 +chr1 128000000 129000000 +chr1 129000000 130000000 +chr1 130000000 131000000 +chr1 131000000 132000000 +chr1 132000000 133000000 +chr1 133000000 134000000 +chr1 134000000 135000000 +chr1 135000000 136000000 +chr1 136000000 137000000 +chr1 137000000 138000000 +chr1 138000000 139000000 +chr1 139000000 140000000 +chr1 140000000 141000000 +chr1 141000000 142000000 +chr1 142000000 143000000 +chr1 143000000 144000000 +chr1 144000000 145000000 +chr1 145000000 146000000 +chr1 146000000 147000000 +chr1 147000000 148000000 +chr1 148000000 149000000 +chr1 149000000 150000000 +chr1 150000000 151000000 +chr1 151000000 152000000 +chr1 152000000 153000000 +chr1 153000000 154000000 +chr1 154000000 155000000 +chr1 155000000 156000000 +chr1 156000000 157000000 +chr1 157000000 158000000 +chr1 158000000 159000000 +chr1 159000000 160000000 +chr1 160000000 161000000 +chr1 161000000 162000000 +chr1 162000000 163000000 +chr1 163000000 164000000 +chr1 164000000 165000000 +chr1 165000000 166000000 +chr1 166000000 167000000 +chr1 167000000 168000000 +chr1 168000000 169000000 +chr1 169000000 170000000 +chr1 170000000 171000000 +chr1 171000000 172000000 +chr1 172000000 173000000 +chr1 173000000 174000000 +chr1 174000000 175000000 +chr1 175000000 176000000 +chr1 176000000 177000000 +chr1 177000000 178000000 +chr1 178000000 179000000 +chr1 179000000 180000000 +chr1 180000000 181000000 +chr1 181000000 182000000 +chr1 182000000 183000000 +chr1 183000000 184000000 +chr1 184000000 185000000 +chr1 185000000 186000000 +chr1 186000000 187000000 +chr1 187000000 188000000 +chr1 188000000 189000000 +chr1 189000000 190000000 +chr1 190000000 191000000 +chr1 191000000 192000000 +chr1 192000000 193000000 +chr1 193000000 194000000 +chr1 194000000 195000000 +chr1 195000000 196000000 +chr1 196000000 197000000 +chr1 197000000 197195432
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/makeWindowBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3944 @@ +chr1 0 1000000 +chr1 50000 1050000 +chr1 100000 1100000 +chr1 150000 1150000 +chr1 200000 1200000 +chr1 250000 1250000 +chr1 300000 1300000 +chr1 350000 1350000 +chr1 400000 1400000 +chr1 450000 1450000 +chr1 500000 1500000 +chr1 550000 1550000 +chr1 600000 1600000 +chr1 650000 1650000 +chr1 700000 1700000 +chr1 750000 1750000 +chr1 800000 1800000 +chr1 850000 1850000 +chr1 900000 1900000 +chr1 950000 1950000 +chr1 1000000 2000000 +chr1 1050000 2050000 +chr1 1100000 2100000 +chr1 1150000 2150000 +chr1 1200000 2200000 +chr1 1250000 2250000 +chr1 1300000 2300000 +chr1 1350000 2350000 +chr1 1400000 2400000 +chr1 1450000 2450000 +chr1 1500000 2500000 +chr1 1550000 2550000 +chr1 1600000 2600000 +chr1 1650000 2650000 +chr1 1700000 2700000 +chr1 1750000 2750000 +chr1 1800000 2800000 +chr1 1850000 2850000 +chr1 1900000 2900000 +chr1 1950000 2950000 +chr1 2000000 3000000 +chr1 2050000 3050000 +chr1 2100000 3100000 +chr1 2150000 3150000 +chr1 2200000 3200000 +chr1 2250000 3250000 +chr1 2300000 3300000 +chr1 2350000 3350000 +chr1 2400000 3400000 +chr1 2450000 3450000 +chr1 2500000 3500000 +chr1 2550000 3550000 +chr1 2600000 3600000 +chr1 2650000 3650000 +chr1 2700000 3700000 +chr1 2750000 3750000 +chr1 2800000 3800000 +chr1 2850000 3850000 +chr1 2900000 3900000 +chr1 2950000 3950000 +chr1 3000000 4000000 +chr1 3050000 4050000 +chr1 3100000 4100000 +chr1 3150000 4150000 +chr1 3200000 4200000 +chr1 3250000 4250000 +chr1 3300000 4300000 +chr1 3350000 4350000 +chr1 3400000 4400000 +chr1 3450000 4450000 +chr1 3500000 4500000 +chr1 3550000 4550000 +chr1 3600000 4600000 +chr1 3650000 4650000 +chr1 3700000 4700000 +chr1 3750000 4750000 +chr1 3800000 4800000 +chr1 3850000 4850000 +chr1 3900000 4900000 +chr1 3950000 4950000 +chr1 4000000 5000000 +chr1 4050000 5050000 +chr1 4100000 5100000 +chr1 4150000 5150000 +chr1 4200000 5200000 +chr1 4250000 5250000 +chr1 4300000 5300000 +chr1 4350000 5350000 +chr1 4400000 5400000 +chr1 4450000 5450000 +chr1 4500000 5500000 +chr1 4550000 5550000 +chr1 4600000 5600000 +chr1 4650000 5650000 +chr1 4700000 5700000 +chr1 4750000 5750000 +chr1 4800000 5800000 +chr1 4850000 5850000 +chr1 4900000 5900000 +chr1 4950000 5950000 +chr1 5000000 6000000 +chr1 5050000 6050000 +chr1 5100000 6100000 +chr1 5150000 6150000 +chr1 5200000 6200000 +chr1 5250000 6250000 +chr1 5300000 6300000 +chr1 5350000 6350000 +chr1 5400000 6400000 +chr1 5450000 6450000 +chr1 5500000 6500000 +chr1 5550000 6550000 +chr1 5600000 6600000 +chr1 5650000 6650000 +chr1 5700000 6700000 +chr1 5750000 6750000 +chr1 5800000 6800000 +chr1 5850000 6850000 +chr1 5900000 6900000 +chr1 5950000 6950000 +chr1 6000000 7000000 +chr1 6050000 7050000 +chr1 6100000 7100000 +chr1 6150000 7150000 +chr1 6200000 7200000 +chr1 6250000 7250000 +chr1 6300000 7300000 +chr1 6350000 7350000 +chr1 6400000 7400000 +chr1 6450000 7450000 +chr1 6500000 7500000 +chr1 6550000 7550000 +chr1 6600000 7600000 +chr1 6650000 7650000 +chr1 6700000 7700000 +chr1 6750000 7750000 +chr1 6800000 7800000 +chr1 6850000 7850000 +chr1 6900000 7900000 +chr1 6950000 7950000 +chr1 7000000 8000000 +chr1 7050000 8050000 +chr1 7100000 8100000 +chr1 7150000 8150000 +chr1 7200000 8200000 +chr1 7250000 8250000 +chr1 7300000 8300000 +chr1 7350000 8350000 +chr1 7400000 8400000 +chr1 7450000 8450000 +chr1 7500000 8500000 +chr1 7550000 8550000 +chr1 7600000 8600000 +chr1 7650000 8650000 +chr1 7700000 8700000 +chr1 7750000 8750000 +chr1 7800000 8800000 +chr1 7850000 8850000 +chr1 7900000 8900000 +chr1 7950000 8950000 +chr1 8000000 9000000 +chr1 8050000 9050000 +chr1 8100000 9100000 +chr1 8150000 9150000 +chr1 8200000 9200000 +chr1 8250000 9250000 +chr1 8300000 9300000 +chr1 8350000 9350000 +chr1 8400000 9400000 +chr1 8450000 9450000 +chr1 8500000 9500000 +chr1 8550000 9550000 +chr1 8600000 9600000 +chr1 8650000 9650000 +chr1 8700000 9700000 +chr1 8750000 9750000 +chr1 8800000 9800000 +chr1 8850000 9850000 +chr1 8900000 9900000 +chr1 8950000 9950000 +chr1 9000000 10000000 +chr1 9050000 10050000 +chr1 9100000 10100000 +chr1 9150000 10150000 +chr1 9200000 10200000 +chr1 9250000 10250000 +chr1 9300000 10300000 +chr1 9350000 10350000 +chr1 9400000 10400000 +chr1 9450000 10450000 +chr1 9500000 10500000 +chr1 9550000 10550000 +chr1 9600000 10600000 +chr1 9650000 10650000 +chr1 9700000 10700000 +chr1 9750000 10750000 +chr1 9800000 10800000 +chr1 9850000 10850000 +chr1 9900000 10900000 +chr1 9950000 10950000 +chr1 10000000 11000000 +chr1 10050000 11050000 +chr1 10100000 11100000 +chr1 10150000 11150000 +chr1 10200000 11200000 +chr1 10250000 11250000 +chr1 10300000 11300000 +chr1 10350000 11350000 +chr1 10400000 11400000 +chr1 10450000 11450000 +chr1 10500000 11500000 +chr1 10550000 11550000 +chr1 10600000 11600000 +chr1 10650000 11650000 +chr1 10700000 11700000 +chr1 10750000 11750000 +chr1 10800000 11800000 +chr1 10850000 11850000 +chr1 10900000 11900000 +chr1 10950000 11950000 +chr1 11000000 12000000 +chr1 11050000 12050000 +chr1 11100000 12100000 +chr1 11150000 12150000 +chr1 11200000 12200000 +chr1 11250000 12250000 +chr1 11300000 12300000 +chr1 11350000 12350000 +chr1 11400000 12400000 +chr1 11450000 12450000 +chr1 11500000 12500000 +chr1 11550000 12550000 +chr1 11600000 12600000 +chr1 11650000 12650000 +chr1 11700000 12700000 +chr1 11750000 12750000 +chr1 11800000 12800000 +chr1 11850000 12850000 +chr1 11900000 12900000 +chr1 11950000 12950000 +chr1 12000000 13000000 +chr1 12050000 13050000 +chr1 12100000 13100000 +chr1 12150000 13150000 +chr1 12200000 13200000 +chr1 12250000 13250000 +chr1 12300000 13300000 +chr1 12350000 13350000 +chr1 12400000 13400000 +chr1 12450000 13450000 +chr1 12500000 13500000 +chr1 12550000 13550000 +chr1 12600000 13600000 +chr1 12650000 13650000 +chr1 12700000 13700000 +chr1 12750000 13750000 +chr1 12800000 13800000 +chr1 12850000 13850000 +chr1 12900000 13900000 +chr1 12950000 13950000 +chr1 13000000 14000000 +chr1 13050000 14050000 +chr1 13100000 14100000 +chr1 13150000 14150000 +chr1 13200000 14200000 +chr1 13250000 14250000 +chr1 13300000 14300000 +chr1 13350000 14350000 +chr1 13400000 14400000 +chr1 13450000 14450000 +chr1 13500000 14500000 +chr1 13550000 14550000 +chr1 13600000 14600000 +chr1 13650000 14650000 +chr1 13700000 14700000 +chr1 13750000 14750000 +chr1 13800000 14800000 +chr1 13850000 14850000 +chr1 13900000 14900000 +chr1 13950000 14950000 +chr1 14000000 15000000 +chr1 14050000 15050000 +chr1 14100000 15100000 +chr1 14150000 15150000 +chr1 14200000 15200000 +chr1 14250000 15250000 +chr1 14300000 15300000 +chr1 14350000 15350000 +chr1 14400000 15400000 +chr1 14450000 15450000 +chr1 14500000 15500000 +chr1 14550000 15550000 +chr1 14600000 15600000 +chr1 14650000 15650000 +chr1 14700000 15700000 +chr1 14750000 15750000 +chr1 14800000 15800000 +chr1 14850000 15850000 +chr1 14900000 15900000 +chr1 14950000 15950000 +chr1 15000000 16000000 +chr1 15050000 16050000 +chr1 15100000 16100000 +chr1 15150000 16150000 +chr1 15200000 16200000 +chr1 15250000 16250000 +chr1 15300000 16300000 +chr1 15350000 16350000 +chr1 15400000 16400000 +chr1 15450000 16450000 +chr1 15500000 16500000 +chr1 15550000 16550000 +chr1 15600000 16600000 +chr1 15650000 16650000 +chr1 15700000 16700000 +chr1 15750000 16750000 +chr1 15800000 16800000 +chr1 15850000 16850000 +chr1 15900000 16900000 +chr1 15950000 16950000 +chr1 16000000 17000000 +chr1 16050000 17050000 +chr1 16100000 17100000 +chr1 16150000 17150000 +chr1 16200000 17200000 +chr1 16250000 17250000 +chr1 16300000 17300000 +chr1 16350000 17350000 +chr1 16400000 17400000 +chr1 16450000 17450000 +chr1 16500000 17500000 +chr1 16550000 17550000 +chr1 16600000 17600000 +chr1 16650000 17650000 +chr1 16700000 17700000 +chr1 16750000 17750000 +chr1 16800000 17800000 +chr1 16850000 17850000 +chr1 16900000 17900000 +chr1 16950000 17950000 +chr1 17000000 18000000 +chr1 17050000 18050000 +chr1 17100000 18100000 +chr1 17150000 18150000 +chr1 17200000 18200000 +chr1 17250000 18250000 +chr1 17300000 18300000 +chr1 17350000 18350000 +chr1 17400000 18400000 +chr1 17450000 18450000 +chr1 17500000 18500000 +chr1 17550000 18550000 +chr1 17600000 18600000 +chr1 17650000 18650000 +chr1 17700000 18700000 +chr1 17750000 18750000 +chr1 17800000 18800000 +chr1 17850000 18850000 +chr1 17900000 18900000 +chr1 17950000 18950000 +chr1 18000000 19000000 +chr1 18050000 19050000 +chr1 18100000 19100000 +chr1 18150000 19150000 +chr1 18200000 19200000 +chr1 18250000 19250000 +chr1 18300000 19300000 +chr1 18350000 19350000 +chr1 18400000 19400000 +chr1 18450000 19450000 +chr1 18500000 19500000 +chr1 18550000 19550000 +chr1 18600000 19600000 +chr1 18650000 19650000 +chr1 18700000 19700000 +chr1 18750000 19750000 +chr1 18800000 19800000 +chr1 18850000 19850000 +chr1 18900000 19900000 +chr1 18950000 19950000 +chr1 19000000 20000000 +chr1 19050000 20050000 +chr1 19100000 20100000 +chr1 19150000 20150000 +chr1 19200000 20200000 +chr1 19250000 20250000 +chr1 19300000 20300000 +chr1 19350000 20350000 +chr1 19400000 20400000 +chr1 19450000 20450000 +chr1 19500000 20500000 +chr1 19550000 20550000 +chr1 19600000 20600000 +chr1 19650000 20650000 +chr1 19700000 20700000 +chr1 19750000 20750000 +chr1 19800000 20800000 +chr1 19850000 20850000 +chr1 19900000 20900000 +chr1 19950000 20950000 +chr1 20000000 21000000 +chr1 20050000 21050000 +chr1 20100000 21100000 +chr1 20150000 21150000 +chr1 20200000 21200000 +chr1 20250000 21250000 +chr1 20300000 21300000 +chr1 20350000 21350000 +chr1 20400000 21400000 +chr1 20450000 21450000 +chr1 20500000 21500000 +chr1 20550000 21550000 +chr1 20600000 21600000 +chr1 20650000 21650000 +chr1 20700000 21700000 +chr1 20750000 21750000 +chr1 20800000 21800000 +chr1 20850000 21850000 +chr1 20900000 21900000 +chr1 20950000 21950000 +chr1 21000000 22000000 +chr1 21050000 22050000 +chr1 21100000 22100000 +chr1 21150000 22150000 +chr1 21200000 22200000 +chr1 21250000 22250000 +chr1 21300000 22300000 +chr1 21350000 22350000 +chr1 21400000 22400000 +chr1 21450000 22450000 +chr1 21500000 22500000 +chr1 21550000 22550000 +chr1 21600000 22600000 +chr1 21650000 22650000 +chr1 21700000 22700000 +chr1 21750000 22750000 +chr1 21800000 22800000 +chr1 21850000 22850000 +chr1 21900000 22900000 +chr1 21950000 22950000 +chr1 22000000 23000000 +chr1 22050000 23050000 +chr1 22100000 23100000 +chr1 22150000 23150000 +chr1 22200000 23200000 +chr1 22250000 23250000 +chr1 22300000 23300000 +chr1 22350000 23350000 +chr1 22400000 23400000 +chr1 22450000 23450000 +chr1 22500000 23500000 +chr1 22550000 23550000 +chr1 22600000 23600000 +chr1 22650000 23650000 +chr1 22700000 23700000 +chr1 22750000 23750000 +chr1 22800000 23800000 +chr1 22850000 23850000 +chr1 22900000 23900000 +chr1 22950000 23950000 +chr1 23000000 24000000 +chr1 23050000 24050000 +chr1 23100000 24100000 +chr1 23150000 24150000 +chr1 23200000 24200000 +chr1 23250000 24250000 +chr1 23300000 24300000 +chr1 23350000 24350000 +chr1 23400000 24400000 +chr1 23450000 24450000 +chr1 23500000 24500000 +chr1 23550000 24550000 +chr1 23600000 24600000 +chr1 23650000 24650000 +chr1 23700000 24700000 +chr1 23750000 24750000 +chr1 23800000 24800000 +chr1 23850000 24850000 +chr1 23900000 24900000 +chr1 23950000 24950000 +chr1 24000000 25000000 +chr1 24050000 25050000 +chr1 24100000 25100000 +chr1 24150000 25150000 +chr1 24200000 25200000 +chr1 24250000 25250000 +chr1 24300000 25300000 +chr1 24350000 25350000 +chr1 24400000 25400000 +chr1 24450000 25450000 +chr1 24500000 25500000 +chr1 24550000 25550000 +chr1 24600000 25600000 +chr1 24650000 25650000 +chr1 24700000 25700000 +chr1 24750000 25750000 +chr1 24800000 25800000 +chr1 24850000 25850000 +chr1 24900000 25900000 +chr1 24950000 25950000 +chr1 25000000 26000000 +chr1 25050000 26050000 +chr1 25100000 26100000 +chr1 25150000 26150000 +chr1 25200000 26200000 +chr1 25250000 26250000 +chr1 25300000 26300000 +chr1 25350000 26350000 +chr1 25400000 26400000 +chr1 25450000 26450000 +chr1 25500000 26500000 +chr1 25550000 26550000 +chr1 25600000 26600000 +chr1 25650000 26650000 +chr1 25700000 26700000 +chr1 25750000 26750000 +chr1 25800000 26800000 +chr1 25850000 26850000 +chr1 25900000 26900000 +chr1 25950000 26950000 +chr1 26000000 27000000 +chr1 26050000 27050000 +chr1 26100000 27100000 +chr1 26150000 27150000 +chr1 26200000 27200000 +chr1 26250000 27250000 +chr1 26300000 27300000 +chr1 26350000 27350000 +chr1 26400000 27400000 +chr1 26450000 27450000 +chr1 26500000 27500000 +chr1 26550000 27550000 +chr1 26600000 27600000 +chr1 26650000 27650000 +chr1 26700000 27700000 +chr1 26750000 27750000 +chr1 26800000 27800000 +chr1 26850000 27850000 +chr1 26900000 27900000 +chr1 26950000 27950000 +chr1 27000000 28000000 +chr1 27050000 28050000 +chr1 27100000 28100000 +chr1 27150000 28150000 +chr1 27200000 28200000 +chr1 27250000 28250000 +chr1 27300000 28300000 +chr1 27350000 28350000 +chr1 27400000 28400000 +chr1 27450000 28450000 +chr1 27500000 28500000 +chr1 27550000 28550000 +chr1 27600000 28600000 +chr1 27650000 28650000 +chr1 27700000 28700000 +chr1 27750000 28750000 +chr1 27800000 28800000 +chr1 27850000 28850000 +chr1 27900000 28900000 +chr1 27950000 28950000 +chr1 28000000 29000000 +chr1 28050000 29050000 +chr1 28100000 29100000 +chr1 28150000 29150000 +chr1 28200000 29200000 +chr1 28250000 29250000 +chr1 28300000 29300000 +chr1 28350000 29350000 +chr1 28400000 29400000 +chr1 28450000 29450000 +chr1 28500000 29500000 +chr1 28550000 29550000 +chr1 28600000 29600000 +chr1 28650000 29650000 +chr1 28700000 29700000 +chr1 28750000 29750000 +chr1 28800000 29800000 +chr1 28850000 29850000 +chr1 28900000 29900000 +chr1 28950000 29950000 +chr1 29000000 30000000 +chr1 29050000 30050000 +chr1 29100000 30100000 +chr1 29150000 30150000 +chr1 29200000 30200000 +chr1 29250000 30250000 +chr1 29300000 30300000 +chr1 29350000 30350000 +chr1 29400000 30400000 +chr1 29450000 30450000 +chr1 29500000 30500000 +chr1 29550000 30550000 +chr1 29600000 30600000 +chr1 29650000 30650000 +chr1 29700000 30700000 +chr1 29750000 30750000 +chr1 29800000 30800000 +chr1 29850000 30850000 +chr1 29900000 30900000 +chr1 29950000 30950000 +chr1 30000000 31000000 +chr1 30050000 31050000 +chr1 30100000 31100000 +chr1 30150000 31150000 +chr1 30200000 31200000 +chr1 30250000 31250000 +chr1 30300000 31300000 +chr1 30350000 31350000 +chr1 30400000 31400000 +chr1 30450000 31450000 +chr1 30500000 31500000 +chr1 30550000 31550000 +chr1 30600000 31600000 +chr1 30650000 31650000 +chr1 30700000 31700000 +chr1 30750000 31750000 +chr1 30800000 31800000 +chr1 30850000 31850000 +chr1 30900000 31900000 +chr1 30950000 31950000 +chr1 31000000 32000000 +chr1 31050000 32050000 +chr1 31100000 32100000 +chr1 31150000 32150000 +chr1 31200000 32200000 +chr1 31250000 32250000 +chr1 31300000 32300000 +chr1 31350000 32350000 +chr1 31400000 32400000 +chr1 31450000 32450000 +chr1 31500000 32500000 +chr1 31550000 32550000 +chr1 31600000 32600000 +chr1 31650000 32650000 +chr1 31700000 32700000 +chr1 31750000 32750000 +chr1 31800000 32800000 +chr1 31850000 32850000 +chr1 31900000 32900000 +chr1 31950000 32950000 +chr1 32000000 33000000 +chr1 32050000 33050000 +chr1 32100000 33100000 +chr1 32150000 33150000 +chr1 32200000 33200000 +chr1 32250000 33250000 +chr1 32300000 33300000 +chr1 32350000 33350000 +chr1 32400000 33400000 +chr1 32450000 33450000 +chr1 32500000 33500000 +chr1 32550000 33550000 +chr1 32600000 33600000 +chr1 32650000 33650000 +chr1 32700000 33700000 +chr1 32750000 33750000 +chr1 32800000 33800000 +chr1 32850000 33850000 +chr1 32900000 33900000 +chr1 32950000 33950000 +chr1 33000000 34000000 +chr1 33050000 34050000 +chr1 33100000 34100000 +chr1 33150000 34150000 +chr1 33200000 34200000 +chr1 33250000 34250000 +chr1 33300000 34300000 +chr1 33350000 34350000 +chr1 33400000 34400000 +chr1 33450000 34450000 +chr1 33500000 34500000 +chr1 33550000 34550000 +chr1 33600000 34600000 +chr1 33650000 34650000 +chr1 33700000 34700000 +chr1 33750000 34750000 +chr1 33800000 34800000 +chr1 33850000 34850000 +chr1 33900000 34900000 +chr1 33950000 34950000 +chr1 34000000 35000000 +chr1 34050000 35050000 +chr1 34100000 35100000 +chr1 34150000 35150000 +chr1 34200000 35200000 +chr1 34250000 35250000 +chr1 34300000 35300000 +chr1 34350000 35350000 +chr1 34400000 35400000 +chr1 34450000 35450000 +chr1 34500000 35500000 +chr1 34550000 35550000 +chr1 34600000 35600000 +chr1 34650000 35650000 +chr1 34700000 35700000 +chr1 34750000 35750000 +chr1 34800000 35800000 +chr1 34850000 35850000 +chr1 34900000 35900000 +chr1 34950000 35950000 +chr1 35000000 36000000 +chr1 35050000 36050000 +chr1 35100000 36100000 +chr1 35150000 36150000 +chr1 35200000 36200000 +chr1 35250000 36250000 +chr1 35300000 36300000 +chr1 35350000 36350000 +chr1 35400000 36400000 +chr1 35450000 36450000 +chr1 35500000 36500000 +chr1 35550000 36550000 +chr1 35600000 36600000 +chr1 35650000 36650000 +chr1 35700000 36700000 +chr1 35750000 36750000 +chr1 35800000 36800000 +chr1 35850000 36850000 +chr1 35900000 36900000 +chr1 35950000 36950000 +chr1 36000000 37000000 +chr1 36050000 37050000 +chr1 36100000 37100000 +chr1 36150000 37150000 +chr1 36200000 37200000 +chr1 36250000 37250000 +chr1 36300000 37300000 +chr1 36350000 37350000 +chr1 36400000 37400000 +chr1 36450000 37450000 +chr1 36500000 37500000 +chr1 36550000 37550000 +chr1 36600000 37600000 +chr1 36650000 37650000 +chr1 36700000 37700000 +chr1 36750000 37750000 +chr1 36800000 37800000 +chr1 36850000 37850000 +chr1 36900000 37900000 +chr1 36950000 37950000 +chr1 37000000 38000000 +chr1 37050000 38050000 +chr1 37100000 38100000 +chr1 37150000 38150000 +chr1 37200000 38200000 +chr1 37250000 38250000 +chr1 37300000 38300000 +chr1 37350000 38350000 +chr1 37400000 38400000 +chr1 37450000 38450000 +chr1 37500000 38500000 +chr1 37550000 38550000 +chr1 37600000 38600000 +chr1 37650000 38650000 +chr1 37700000 38700000 +chr1 37750000 38750000 +chr1 37800000 38800000 +chr1 37850000 38850000 +chr1 37900000 38900000 +chr1 37950000 38950000 +chr1 38000000 39000000 +chr1 38050000 39050000 +chr1 38100000 39100000 +chr1 38150000 39150000 +chr1 38200000 39200000 +chr1 38250000 39250000 +chr1 38300000 39300000 +chr1 38350000 39350000 +chr1 38400000 39400000 +chr1 38450000 39450000 +chr1 38500000 39500000 +chr1 38550000 39550000 +chr1 38600000 39600000 +chr1 38650000 39650000 +chr1 38700000 39700000 +chr1 38750000 39750000 +chr1 38800000 39800000 +chr1 38850000 39850000 +chr1 38900000 39900000 +chr1 38950000 39950000 +chr1 39000000 40000000 +chr1 39050000 40050000 +chr1 39100000 40100000 +chr1 39150000 40150000 +chr1 39200000 40200000 +chr1 39250000 40250000 +chr1 39300000 40300000 +chr1 39350000 40350000 +chr1 39400000 40400000 +chr1 39450000 40450000 +chr1 39500000 40500000 +chr1 39550000 40550000 +chr1 39600000 40600000 +chr1 39650000 40650000 +chr1 39700000 40700000 +chr1 39750000 40750000 +chr1 39800000 40800000 +chr1 39850000 40850000 +chr1 39900000 40900000 +chr1 39950000 40950000 +chr1 40000000 41000000 +chr1 40050000 41050000 +chr1 40100000 41100000 +chr1 40150000 41150000 +chr1 40200000 41200000 +chr1 40250000 41250000 +chr1 40300000 41300000 +chr1 40350000 41350000 +chr1 40400000 41400000 +chr1 40450000 41450000 +chr1 40500000 41500000 +chr1 40550000 41550000 +chr1 40600000 41600000 +chr1 40650000 41650000 +chr1 40700000 41700000 +chr1 40750000 41750000 +chr1 40800000 41800000 +chr1 40850000 41850000 +chr1 40900000 41900000 +chr1 40950000 41950000 +chr1 41000000 42000000 +chr1 41050000 42050000 +chr1 41100000 42100000 +chr1 41150000 42150000 +chr1 41200000 42200000 +chr1 41250000 42250000 +chr1 41300000 42300000 +chr1 41350000 42350000 +chr1 41400000 42400000 +chr1 41450000 42450000 +chr1 41500000 42500000 +chr1 41550000 42550000 +chr1 41600000 42600000 +chr1 41650000 42650000 +chr1 41700000 42700000 +chr1 41750000 42750000 +chr1 41800000 42800000 +chr1 41850000 42850000 +chr1 41900000 42900000 +chr1 41950000 42950000 +chr1 42000000 43000000 +chr1 42050000 43050000 +chr1 42100000 43100000 +chr1 42150000 43150000 +chr1 42200000 43200000 +chr1 42250000 43250000 +chr1 42300000 43300000 +chr1 42350000 43350000 +chr1 42400000 43400000 +chr1 42450000 43450000 +chr1 42500000 43500000 +chr1 42550000 43550000 +chr1 42600000 43600000 +chr1 42650000 43650000 +chr1 42700000 43700000 +chr1 42750000 43750000 +chr1 42800000 43800000 +chr1 42850000 43850000 +chr1 42900000 43900000 +chr1 42950000 43950000 +chr1 43000000 44000000 +chr1 43050000 44050000 +chr1 43100000 44100000 +chr1 43150000 44150000 +chr1 43200000 44200000 +chr1 43250000 44250000 +chr1 43300000 44300000 +chr1 43350000 44350000 +chr1 43400000 44400000 +chr1 43450000 44450000 +chr1 43500000 44500000 +chr1 43550000 44550000 +chr1 43600000 44600000 +chr1 43650000 44650000 +chr1 43700000 44700000 +chr1 43750000 44750000 +chr1 43800000 44800000 +chr1 43850000 44850000 +chr1 43900000 44900000 +chr1 43950000 44950000 +chr1 44000000 45000000 +chr1 44050000 45050000 +chr1 44100000 45100000 +chr1 44150000 45150000 +chr1 44200000 45200000 +chr1 44250000 45250000 +chr1 44300000 45300000 +chr1 44350000 45350000 +chr1 44400000 45400000 +chr1 44450000 45450000 +chr1 44500000 45500000 +chr1 44550000 45550000 +chr1 44600000 45600000 +chr1 44650000 45650000 +chr1 44700000 45700000 +chr1 44750000 45750000 +chr1 44800000 45800000 +chr1 44850000 45850000 +chr1 44900000 45900000 +chr1 44950000 45950000 +chr1 45000000 46000000 +chr1 45050000 46050000 +chr1 45100000 46100000 +chr1 45150000 46150000 +chr1 45200000 46200000 +chr1 45250000 46250000 +chr1 45300000 46300000 +chr1 45350000 46350000 +chr1 45400000 46400000 +chr1 45450000 46450000 +chr1 45500000 46500000 +chr1 45550000 46550000 +chr1 45600000 46600000 +chr1 45650000 46650000 +chr1 45700000 46700000 +chr1 45750000 46750000 +chr1 45800000 46800000 +chr1 45850000 46850000 +chr1 45900000 46900000 +chr1 45950000 46950000 +chr1 46000000 47000000 +chr1 46050000 47050000 +chr1 46100000 47100000 +chr1 46150000 47150000 +chr1 46200000 47200000 +chr1 46250000 47250000 +chr1 46300000 47300000 +chr1 46350000 47350000 +chr1 46400000 47400000 +chr1 46450000 47450000 +chr1 46500000 47500000 +chr1 46550000 47550000 +chr1 46600000 47600000 +chr1 46650000 47650000 +chr1 46700000 47700000 +chr1 46750000 47750000 +chr1 46800000 47800000 +chr1 46850000 47850000 +chr1 46900000 47900000 +chr1 46950000 47950000 +chr1 47000000 48000000 +chr1 47050000 48050000 +chr1 47100000 48100000 +chr1 47150000 48150000 +chr1 47200000 48200000 +chr1 47250000 48250000 +chr1 47300000 48300000 +chr1 47350000 48350000 +chr1 47400000 48400000 +chr1 47450000 48450000 +chr1 47500000 48500000 +chr1 47550000 48550000 +chr1 47600000 48600000 +chr1 47650000 48650000 +chr1 47700000 48700000 +chr1 47750000 48750000 +chr1 47800000 48800000 +chr1 47850000 48850000 +chr1 47900000 48900000 +chr1 47950000 48950000 +chr1 48000000 49000000 +chr1 48050000 49050000 +chr1 48100000 49100000 +chr1 48150000 49150000 +chr1 48200000 49200000 +chr1 48250000 49250000 +chr1 48300000 49300000 +chr1 48350000 49350000 +chr1 48400000 49400000 +chr1 48450000 49450000 +chr1 48500000 49500000 +chr1 48550000 49550000 +chr1 48600000 49600000 +chr1 48650000 49650000 +chr1 48700000 49700000 +chr1 48750000 49750000 +chr1 48800000 49800000 +chr1 48850000 49850000 +chr1 48900000 49900000 +chr1 48950000 49950000 +chr1 49000000 50000000 +chr1 49050000 50050000 +chr1 49100000 50100000 +chr1 49150000 50150000 +chr1 49200000 50200000 +chr1 49250000 50250000 +chr1 49300000 50300000 +chr1 49350000 50350000 +chr1 49400000 50400000 +chr1 49450000 50450000 +chr1 49500000 50500000 +chr1 49550000 50550000 +chr1 49600000 50600000 +chr1 49650000 50650000 +chr1 49700000 50700000 +chr1 49750000 50750000 +chr1 49800000 50800000 +chr1 49850000 50850000 +chr1 49900000 50900000 +chr1 49950000 50950000 +chr1 50000000 51000000 +chr1 50050000 51050000 +chr1 50100000 51100000 +chr1 50150000 51150000 +chr1 50200000 51200000 +chr1 50250000 51250000 +chr1 50300000 51300000 +chr1 50350000 51350000 +chr1 50400000 51400000 +chr1 50450000 51450000 +chr1 50500000 51500000 +chr1 50550000 51550000 +chr1 50600000 51600000 +chr1 50650000 51650000 +chr1 50700000 51700000 +chr1 50750000 51750000 +chr1 50800000 51800000 +chr1 50850000 51850000 +chr1 50900000 51900000 +chr1 50950000 51950000 +chr1 51000000 52000000 +chr1 51050000 52050000 +chr1 51100000 52100000 +chr1 51150000 52150000 +chr1 51200000 52200000 +chr1 51250000 52250000 +chr1 51300000 52300000 +chr1 51350000 52350000 +chr1 51400000 52400000 +chr1 51450000 52450000 +chr1 51500000 52500000 +chr1 51550000 52550000 +chr1 51600000 52600000 +chr1 51650000 52650000 +chr1 51700000 52700000 +chr1 51750000 52750000 +chr1 51800000 52800000 +chr1 51850000 52850000 +chr1 51900000 52900000 +chr1 51950000 52950000 +chr1 52000000 53000000 +chr1 52050000 53050000 +chr1 52100000 53100000 +chr1 52150000 53150000 +chr1 52200000 53200000 +chr1 52250000 53250000 +chr1 52300000 53300000 +chr1 52350000 53350000 +chr1 52400000 53400000 +chr1 52450000 53450000 +chr1 52500000 53500000 +chr1 52550000 53550000 +chr1 52600000 53600000 +chr1 52650000 53650000 +chr1 52700000 53700000 +chr1 52750000 53750000 +chr1 52800000 53800000 +chr1 52850000 53850000 +chr1 52900000 53900000 +chr1 52950000 53950000 +chr1 53000000 54000000 +chr1 53050000 54050000 +chr1 53100000 54100000 +chr1 53150000 54150000 +chr1 53200000 54200000 +chr1 53250000 54250000 +chr1 53300000 54300000 +chr1 53350000 54350000 +chr1 53400000 54400000 +chr1 53450000 54450000 +chr1 53500000 54500000 +chr1 53550000 54550000 +chr1 53600000 54600000 +chr1 53650000 54650000 +chr1 53700000 54700000 +chr1 53750000 54750000 +chr1 53800000 54800000 +chr1 53850000 54850000 +chr1 53900000 54900000 +chr1 53950000 54950000 +chr1 54000000 55000000 +chr1 54050000 55050000 +chr1 54100000 55100000 +chr1 54150000 55150000 +chr1 54200000 55200000 +chr1 54250000 55250000 +chr1 54300000 55300000 +chr1 54350000 55350000 +chr1 54400000 55400000 +chr1 54450000 55450000 +chr1 54500000 55500000 +chr1 54550000 55550000 +chr1 54600000 55600000 +chr1 54650000 55650000 +chr1 54700000 55700000 +chr1 54750000 55750000 +chr1 54800000 55800000 +chr1 54850000 55850000 +chr1 54900000 55900000 +chr1 54950000 55950000 +chr1 55000000 56000000 +chr1 55050000 56050000 +chr1 55100000 56100000 +chr1 55150000 56150000 +chr1 55200000 56200000 +chr1 55250000 56250000 +chr1 55300000 56300000 +chr1 55350000 56350000 +chr1 55400000 56400000 +chr1 55450000 56450000 +chr1 55500000 56500000 +chr1 55550000 56550000 +chr1 55600000 56600000 +chr1 55650000 56650000 +chr1 55700000 56700000 +chr1 55750000 56750000 +chr1 55800000 56800000 +chr1 55850000 56850000 +chr1 55900000 56900000 +chr1 55950000 56950000 +chr1 56000000 57000000 +chr1 56050000 57050000 +chr1 56100000 57100000 +chr1 56150000 57150000 +chr1 56200000 57200000 +chr1 56250000 57250000 +chr1 56300000 57300000 +chr1 56350000 57350000 +chr1 56400000 57400000 +chr1 56450000 57450000 +chr1 56500000 57500000 +chr1 56550000 57550000 +chr1 56600000 57600000 +chr1 56650000 57650000 +chr1 56700000 57700000 +chr1 56750000 57750000 +chr1 56800000 57800000 +chr1 56850000 57850000 +chr1 56900000 57900000 +chr1 56950000 57950000 +chr1 57000000 58000000 +chr1 57050000 58050000 +chr1 57100000 58100000 +chr1 57150000 58150000 +chr1 57200000 58200000 +chr1 57250000 58250000 +chr1 57300000 58300000 +chr1 57350000 58350000 +chr1 57400000 58400000 +chr1 57450000 58450000 +chr1 57500000 58500000 +chr1 57550000 58550000 +chr1 57600000 58600000 +chr1 57650000 58650000 +chr1 57700000 58700000 +chr1 57750000 58750000 +chr1 57800000 58800000 +chr1 57850000 58850000 +chr1 57900000 58900000 +chr1 57950000 58950000 +chr1 58000000 59000000 +chr1 58050000 59050000 +chr1 58100000 59100000 +chr1 58150000 59150000 +chr1 58200000 59200000 +chr1 58250000 59250000 +chr1 58300000 59300000 +chr1 58350000 59350000 +chr1 58400000 59400000 +chr1 58450000 59450000 +chr1 58500000 59500000 +chr1 58550000 59550000 +chr1 58600000 59600000 +chr1 58650000 59650000 +chr1 58700000 59700000 +chr1 58750000 59750000 +chr1 58800000 59800000 +chr1 58850000 59850000 +chr1 58900000 59900000 +chr1 58950000 59950000 +chr1 59000000 60000000 +chr1 59050000 60050000 +chr1 59100000 60100000 +chr1 59150000 60150000 +chr1 59200000 60200000 +chr1 59250000 60250000 +chr1 59300000 60300000 +chr1 59350000 60350000 +chr1 59400000 60400000 +chr1 59450000 60450000 +chr1 59500000 60500000 +chr1 59550000 60550000 +chr1 59600000 60600000 +chr1 59650000 60650000 +chr1 59700000 60700000 +chr1 59750000 60750000 +chr1 59800000 60800000 +chr1 59850000 60850000 +chr1 59900000 60900000 +chr1 59950000 60950000 +chr1 60000000 61000000 +chr1 60050000 61050000 +chr1 60100000 61100000 +chr1 60150000 61150000 +chr1 60200000 61200000 +chr1 60250000 61250000 +chr1 60300000 61300000 +chr1 60350000 61350000 +chr1 60400000 61400000 +chr1 60450000 61450000 +chr1 60500000 61500000 +chr1 60550000 61550000 +chr1 60600000 61600000 +chr1 60650000 61650000 +chr1 60700000 61700000 +chr1 60750000 61750000 +chr1 60800000 61800000 +chr1 60850000 61850000 +chr1 60900000 61900000 +chr1 60950000 61950000 +chr1 61000000 62000000 +chr1 61050000 62050000 +chr1 61100000 62100000 +chr1 61150000 62150000 +chr1 61200000 62200000 +chr1 61250000 62250000 +chr1 61300000 62300000 +chr1 61350000 62350000 +chr1 61400000 62400000 +chr1 61450000 62450000 +chr1 61500000 62500000 +chr1 61550000 62550000 +chr1 61600000 62600000 +chr1 61650000 62650000 +chr1 61700000 62700000 +chr1 61750000 62750000 +chr1 61800000 62800000 +chr1 61850000 62850000 +chr1 61900000 62900000 +chr1 61950000 62950000 +chr1 62000000 63000000 +chr1 62050000 63050000 +chr1 62100000 63100000 +chr1 62150000 63150000 +chr1 62200000 63200000 +chr1 62250000 63250000 +chr1 62300000 63300000 +chr1 62350000 63350000 +chr1 62400000 63400000 +chr1 62450000 63450000 +chr1 62500000 63500000 +chr1 62550000 63550000 +chr1 62600000 63600000 +chr1 62650000 63650000 +chr1 62700000 63700000 +chr1 62750000 63750000 +chr1 62800000 63800000 +chr1 62850000 63850000 +chr1 62900000 63900000 +chr1 62950000 63950000 +chr1 63000000 64000000 +chr1 63050000 64050000 +chr1 63100000 64100000 +chr1 63150000 64150000 +chr1 63200000 64200000 +chr1 63250000 64250000 +chr1 63300000 64300000 +chr1 63350000 64350000 +chr1 63400000 64400000 +chr1 63450000 64450000 +chr1 63500000 64500000 +chr1 63550000 64550000 +chr1 63600000 64600000 +chr1 63650000 64650000 +chr1 63700000 64700000 +chr1 63750000 64750000 +chr1 63800000 64800000 +chr1 63850000 64850000 +chr1 63900000 64900000 +chr1 63950000 64950000 +chr1 64000000 65000000 +chr1 64050000 65050000 +chr1 64100000 65100000 +chr1 64150000 65150000 +chr1 64200000 65200000 +chr1 64250000 65250000 +chr1 64300000 65300000 +chr1 64350000 65350000 +chr1 64400000 65400000 +chr1 64450000 65450000 +chr1 64500000 65500000 +chr1 64550000 65550000 +chr1 64600000 65600000 +chr1 64650000 65650000 +chr1 64700000 65700000 +chr1 64750000 65750000 +chr1 64800000 65800000 +chr1 64850000 65850000 +chr1 64900000 65900000 +chr1 64950000 65950000 +chr1 65000000 66000000 +chr1 65050000 66050000 +chr1 65100000 66100000 +chr1 65150000 66150000 +chr1 65200000 66200000 +chr1 65250000 66250000 +chr1 65300000 66300000 +chr1 65350000 66350000 +chr1 65400000 66400000 +chr1 65450000 66450000 +chr1 65500000 66500000 +chr1 65550000 66550000 +chr1 65600000 66600000 +chr1 65650000 66650000 +chr1 65700000 66700000 +chr1 65750000 66750000 +chr1 65800000 66800000 +chr1 65850000 66850000 +chr1 65900000 66900000 +chr1 65950000 66950000 +chr1 66000000 67000000 +chr1 66050000 67050000 +chr1 66100000 67100000 +chr1 66150000 67150000 +chr1 66200000 67200000 +chr1 66250000 67250000 +chr1 66300000 67300000 +chr1 66350000 67350000 +chr1 66400000 67400000 +chr1 66450000 67450000 +chr1 66500000 67500000 +chr1 66550000 67550000 +chr1 66600000 67600000 +chr1 66650000 67650000 +chr1 66700000 67700000 +chr1 66750000 67750000 +chr1 66800000 67800000 +chr1 66850000 67850000 +chr1 66900000 67900000 +chr1 66950000 67950000 +chr1 67000000 68000000 +chr1 67050000 68050000 +chr1 67100000 68100000 +chr1 67150000 68150000 +chr1 67200000 68200000 +chr1 67250000 68250000 +chr1 67300000 68300000 +chr1 67350000 68350000 +chr1 67400000 68400000 +chr1 67450000 68450000 +chr1 67500000 68500000 +chr1 67550000 68550000 +chr1 67600000 68600000 +chr1 67650000 68650000 +chr1 67700000 68700000 +chr1 67750000 68750000 +chr1 67800000 68800000 +chr1 67850000 68850000 +chr1 67900000 68900000 +chr1 67950000 68950000 +chr1 68000000 69000000 +chr1 68050000 69050000 +chr1 68100000 69100000 +chr1 68150000 69150000 +chr1 68200000 69200000 +chr1 68250000 69250000 +chr1 68300000 69300000 +chr1 68350000 69350000 +chr1 68400000 69400000 +chr1 68450000 69450000 +chr1 68500000 69500000 +chr1 68550000 69550000 +chr1 68600000 69600000 +chr1 68650000 69650000 +chr1 68700000 69700000 +chr1 68750000 69750000 +chr1 68800000 69800000 +chr1 68850000 69850000 +chr1 68900000 69900000 +chr1 68950000 69950000 +chr1 69000000 70000000 +chr1 69050000 70050000 +chr1 69100000 70100000 +chr1 69150000 70150000 +chr1 69200000 70200000 +chr1 69250000 70250000 +chr1 69300000 70300000 +chr1 69350000 70350000 +chr1 69400000 70400000 +chr1 69450000 70450000 +chr1 69500000 70500000 +chr1 69550000 70550000 +chr1 69600000 70600000 +chr1 69650000 70650000 +chr1 69700000 70700000 +chr1 69750000 70750000 +chr1 69800000 70800000 +chr1 69850000 70850000 +chr1 69900000 70900000 +chr1 69950000 70950000 +chr1 70000000 71000000 +chr1 70050000 71050000 +chr1 70100000 71100000 +chr1 70150000 71150000 +chr1 70200000 71200000 +chr1 70250000 71250000 +chr1 70300000 71300000 +chr1 70350000 71350000 +chr1 70400000 71400000 +chr1 70450000 71450000 +chr1 70500000 71500000 +chr1 70550000 71550000 +chr1 70600000 71600000 +chr1 70650000 71650000 +chr1 70700000 71700000 +chr1 70750000 71750000 +chr1 70800000 71800000 +chr1 70850000 71850000 +chr1 70900000 71900000 +chr1 70950000 71950000 +chr1 71000000 72000000 +chr1 71050000 72050000 +chr1 71100000 72100000 +chr1 71150000 72150000 +chr1 71200000 72200000 +chr1 71250000 72250000 +chr1 71300000 72300000 +chr1 71350000 72350000 +chr1 71400000 72400000 +chr1 71450000 72450000 +chr1 71500000 72500000 +chr1 71550000 72550000 +chr1 71600000 72600000 +chr1 71650000 72650000 +chr1 71700000 72700000 +chr1 71750000 72750000 +chr1 71800000 72800000 +chr1 71850000 72850000 +chr1 71900000 72900000 +chr1 71950000 72950000 +chr1 72000000 73000000 +chr1 72050000 73050000 +chr1 72100000 73100000 +chr1 72150000 73150000 +chr1 72200000 73200000 +chr1 72250000 73250000 +chr1 72300000 73300000 +chr1 72350000 73350000 +chr1 72400000 73400000 +chr1 72450000 73450000 +chr1 72500000 73500000 +chr1 72550000 73550000 +chr1 72600000 73600000 +chr1 72650000 73650000 +chr1 72700000 73700000 +chr1 72750000 73750000 +chr1 72800000 73800000 +chr1 72850000 73850000 +chr1 72900000 73900000 +chr1 72950000 73950000 +chr1 73000000 74000000 +chr1 73050000 74050000 +chr1 73100000 74100000 +chr1 73150000 74150000 +chr1 73200000 74200000 +chr1 73250000 74250000 +chr1 73300000 74300000 +chr1 73350000 74350000 +chr1 73400000 74400000 +chr1 73450000 74450000 +chr1 73500000 74500000 +chr1 73550000 74550000 +chr1 73600000 74600000 +chr1 73650000 74650000 +chr1 73700000 74700000 +chr1 73750000 74750000 +chr1 73800000 74800000 +chr1 73850000 74850000 +chr1 73900000 74900000 +chr1 73950000 74950000 +chr1 74000000 75000000 +chr1 74050000 75050000 +chr1 74100000 75100000 +chr1 74150000 75150000 +chr1 74200000 75200000 +chr1 74250000 75250000 +chr1 74300000 75300000 +chr1 74350000 75350000 +chr1 74400000 75400000 +chr1 74450000 75450000 +chr1 74500000 75500000 +chr1 74550000 75550000 +chr1 74600000 75600000 +chr1 74650000 75650000 +chr1 74700000 75700000 +chr1 74750000 75750000 +chr1 74800000 75800000 +chr1 74850000 75850000 +chr1 74900000 75900000 +chr1 74950000 75950000 +chr1 75000000 76000000 +chr1 75050000 76050000 +chr1 75100000 76100000 +chr1 75150000 76150000 +chr1 75200000 76200000 +chr1 75250000 76250000 +chr1 75300000 76300000 +chr1 75350000 76350000 +chr1 75400000 76400000 +chr1 75450000 76450000 +chr1 75500000 76500000 +chr1 75550000 76550000 +chr1 75600000 76600000 +chr1 75650000 76650000 +chr1 75700000 76700000 +chr1 75750000 76750000 +chr1 75800000 76800000 +chr1 75850000 76850000 +chr1 75900000 76900000 +chr1 75950000 76950000 +chr1 76000000 77000000 +chr1 76050000 77050000 +chr1 76100000 77100000 +chr1 76150000 77150000 +chr1 76200000 77200000 +chr1 76250000 77250000 +chr1 76300000 77300000 +chr1 76350000 77350000 +chr1 76400000 77400000 +chr1 76450000 77450000 +chr1 76500000 77500000 +chr1 76550000 77550000 +chr1 76600000 77600000 +chr1 76650000 77650000 +chr1 76700000 77700000 +chr1 76750000 77750000 +chr1 76800000 77800000 +chr1 76850000 77850000 +chr1 76900000 77900000 +chr1 76950000 77950000 +chr1 77000000 78000000 +chr1 77050000 78050000 +chr1 77100000 78100000 +chr1 77150000 78150000 +chr1 77200000 78200000 +chr1 77250000 78250000 +chr1 77300000 78300000 +chr1 77350000 78350000 +chr1 77400000 78400000 +chr1 77450000 78450000 +chr1 77500000 78500000 +chr1 77550000 78550000 +chr1 77600000 78600000 +chr1 77650000 78650000 +chr1 77700000 78700000 +chr1 77750000 78750000 +chr1 77800000 78800000 +chr1 77850000 78850000 +chr1 77900000 78900000 +chr1 77950000 78950000 +chr1 78000000 79000000 +chr1 78050000 79050000 +chr1 78100000 79100000 +chr1 78150000 79150000 +chr1 78200000 79200000 +chr1 78250000 79250000 +chr1 78300000 79300000 +chr1 78350000 79350000 +chr1 78400000 79400000 +chr1 78450000 79450000 +chr1 78500000 79500000 +chr1 78550000 79550000 +chr1 78600000 79600000 +chr1 78650000 79650000 +chr1 78700000 79700000 +chr1 78750000 79750000 +chr1 78800000 79800000 +chr1 78850000 79850000 +chr1 78900000 79900000 +chr1 78950000 79950000 +chr1 79000000 80000000 +chr1 79050000 80050000 +chr1 79100000 80100000 +chr1 79150000 80150000 +chr1 79200000 80200000 +chr1 79250000 80250000 +chr1 79300000 80300000 +chr1 79350000 80350000 +chr1 79400000 80400000 +chr1 79450000 80450000 +chr1 79500000 80500000 +chr1 79550000 80550000 +chr1 79600000 80600000 +chr1 79650000 80650000 +chr1 79700000 80700000 +chr1 79750000 80750000 +chr1 79800000 80800000 +chr1 79850000 80850000 +chr1 79900000 80900000 +chr1 79950000 80950000 +chr1 80000000 81000000 +chr1 80050000 81050000 +chr1 80100000 81100000 +chr1 80150000 81150000 +chr1 80200000 81200000 +chr1 80250000 81250000 +chr1 80300000 81300000 +chr1 80350000 81350000 +chr1 80400000 81400000 +chr1 80450000 81450000 +chr1 80500000 81500000 +chr1 80550000 81550000 +chr1 80600000 81600000 +chr1 80650000 81650000 +chr1 80700000 81700000 +chr1 80750000 81750000 +chr1 80800000 81800000 +chr1 80850000 81850000 +chr1 80900000 81900000 +chr1 80950000 81950000 +chr1 81000000 82000000 +chr1 81050000 82050000 +chr1 81100000 82100000 +chr1 81150000 82150000 +chr1 81200000 82200000 +chr1 81250000 82250000 +chr1 81300000 82300000 +chr1 81350000 82350000 +chr1 81400000 82400000 +chr1 81450000 82450000 +chr1 81500000 82500000 +chr1 81550000 82550000 +chr1 81600000 82600000 +chr1 81650000 82650000 +chr1 81700000 82700000 +chr1 81750000 82750000 +chr1 81800000 82800000 +chr1 81850000 82850000 +chr1 81900000 82900000 +chr1 81950000 82950000 +chr1 82000000 83000000 +chr1 82050000 83050000 +chr1 82100000 83100000 +chr1 82150000 83150000 +chr1 82200000 83200000 +chr1 82250000 83250000 +chr1 82300000 83300000 +chr1 82350000 83350000 +chr1 82400000 83400000 +chr1 82450000 83450000 +chr1 82500000 83500000 +chr1 82550000 83550000 +chr1 82600000 83600000 +chr1 82650000 83650000 +chr1 82700000 83700000 +chr1 82750000 83750000 +chr1 82800000 83800000 +chr1 82850000 83850000 +chr1 82900000 83900000 +chr1 82950000 83950000 +chr1 83000000 84000000 +chr1 83050000 84050000 +chr1 83100000 84100000 +chr1 83150000 84150000 +chr1 83200000 84200000 +chr1 83250000 84250000 +chr1 83300000 84300000 +chr1 83350000 84350000 +chr1 83400000 84400000 +chr1 83450000 84450000 +chr1 83500000 84500000 +chr1 83550000 84550000 +chr1 83600000 84600000 +chr1 83650000 84650000 +chr1 83700000 84700000 +chr1 83750000 84750000 +chr1 83800000 84800000 +chr1 83850000 84850000 +chr1 83900000 84900000 +chr1 83950000 84950000 +chr1 84000000 85000000 +chr1 84050000 85050000 +chr1 84100000 85100000 +chr1 84150000 85150000 +chr1 84200000 85200000 +chr1 84250000 85250000 +chr1 84300000 85300000 +chr1 84350000 85350000 +chr1 84400000 85400000 +chr1 84450000 85450000 +chr1 84500000 85500000 +chr1 84550000 85550000 +chr1 84600000 85600000 +chr1 84650000 85650000 +chr1 84700000 85700000 +chr1 84750000 85750000 +chr1 84800000 85800000 +chr1 84850000 85850000 +chr1 84900000 85900000 +chr1 84950000 85950000 +chr1 85000000 86000000 +chr1 85050000 86050000 +chr1 85100000 86100000 +chr1 85150000 86150000 +chr1 85200000 86200000 +chr1 85250000 86250000 +chr1 85300000 86300000 +chr1 85350000 86350000 +chr1 85400000 86400000 +chr1 85450000 86450000 +chr1 85500000 86500000 +chr1 85550000 86550000 +chr1 85600000 86600000 +chr1 85650000 86650000 +chr1 85700000 86700000 +chr1 85750000 86750000 +chr1 85800000 86800000 +chr1 85850000 86850000 +chr1 85900000 86900000 +chr1 85950000 86950000 +chr1 86000000 87000000 +chr1 86050000 87050000 +chr1 86100000 87100000 +chr1 86150000 87150000 +chr1 86200000 87200000 +chr1 86250000 87250000 +chr1 86300000 87300000 +chr1 86350000 87350000 +chr1 86400000 87400000 +chr1 86450000 87450000 +chr1 86500000 87500000 +chr1 86550000 87550000 +chr1 86600000 87600000 +chr1 86650000 87650000 +chr1 86700000 87700000 +chr1 86750000 87750000 +chr1 86800000 87800000 +chr1 86850000 87850000 +chr1 86900000 87900000 +chr1 86950000 87950000 +chr1 87000000 88000000 +chr1 87050000 88050000 +chr1 87100000 88100000 +chr1 87150000 88150000 +chr1 87200000 88200000 +chr1 87250000 88250000 +chr1 87300000 88300000 +chr1 87350000 88350000 +chr1 87400000 88400000 +chr1 87450000 88450000 +chr1 87500000 88500000 +chr1 87550000 88550000 +chr1 87600000 88600000 +chr1 87650000 88650000 +chr1 87700000 88700000 +chr1 87750000 88750000 +chr1 87800000 88800000 +chr1 87850000 88850000 +chr1 87900000 88900000 +chr1 87950000 88950000 +chr1 88000000 89000000 +chr1 88050000 89050000 +chr1 88100000 89100000 +chr1 88150000 89150000 +chr1 88200000 89200000 +chr1 88250000 89250000 +chr1 88300000 89300000 +chr1 88350000 89350000 +chr1 88400000 89400000 +chr1 88450000 89450000 +chr1 88500000 89500000 +chr1 88550000 89550000 +chr1 88600000 89600000 +chr1 88650000 89650000 +chr1 88700000 89700000 +chr1 88750000 89750000 +chr1 88800000 89800000 +chr1 88850000 89850000 +chr1 88900000 89900000 +chr1 88950000 89950000 +chr1 89000000 90000000 +chr1 89050000 90050000 +chr1 89100000 90100000 +chr1 89150000 90150000 +chr1 89200000 90200000 +chr1 89250000 90250000 +chr1 89300000 90300000 +chr1 89350000 90350000 +chr1 89400000 90400000 +chr1 89450000 90450000 +chr1 89500000 90500000 +chr1 89550000 90550000 +chr1 89600000 90600000 +chr1 89650000 90650000 +chr1 89700000 90700000 +chr1 89750000 90750000 +chr1 89800000 90800000 +chr1 89850000 90850000 +chr1 89900000 90900000 +chr1 89950000 90950000 +chr1 90000000 91000000 +chr1 90050000 91050000 +chr1 90100000 91100000 +chr1 90150000 91150000 +chr1 90200000 91200000 +chr1 90250000 91250000 +chr1 90300000 91300000 +chr1 90350000 91350000 +chr1 90400000 91400000 +chr1 90450000 91450000 +chr1 90500000 91500000 +chr1 90550000 91550000 +chr1 90600000 91600000 +chr1 90650000 91650000 +chr1 90700000 91700000 +chr1 90750000 91750000 +chr1 90800000 91800000 +chr1 90850000 91850000 +chr1 90900000 91900000 +chr1 90950000 91950000 +chr1 91000000 92000000 +chr1 91050000 92050000 +chr1 91100000 92100000 +chr1 91150000 92150000 +chr1 91200000 92200000 +chr1 91250000 92250000 +chr1 91300000 92300000 +chr1 91350000 92350000 +chr1 91400000 92400000 +chr1 91450000 92450000 +chr1 91500000 92500000 +chr1 91550000 92550000 +chr1 91600000 92600000 +chr1 91650000 92650000 +chr1 91700000 92700000 +chr1 91750000 92750000 +chr1 91800000 92800000 +chr1 91850000 92850000 +chr1 91900000 92900000 +chr1 91950000 92950000 +chr1 92000000 93000000 +chr1 92050000 93050000 +chr1 92100000 93100000 +chr1 92150000 93150000 +chr1 92200000 93200000 +chr1 92250000 93250000 +chr1 92300000 93300000 +chr1 92350000 93350000 +chr1 92400000 93400000 +chr1 92450000 93450000 +chr1 92500000 93500000 +chr1 92550000 93550000 +chr1 92600000 93600000 +chr1 92650000 93650000 +chr1 92700000 93700000 +chr1 92750000 93750000 +chr1 92800000 93800000 +chr1 92850000 93850000 +chr1 92900000 93900000 +chr1 92950000 93950000 +chr1 93000000 94000000 +chr1 93050000 94050000 +chr1 93100000 94100000 +chr1 93150000 94150000 +chr1 93200000 94200000 +chr1 93250000 94250000 +chr1 93300000 94300000 +chr1 93350000 94350000 +chr1 93400000 94400000 +chr1 93450000 94450000 +chr1 93500000 94500000 +chr1 93550000 94550000 +chr1 93600000 94600000 +chr1 93650000 94650000 +chr1 93700000 94700000 +chr1 93750000 94750000 +chr1 93800000 94800000 +chr1 93850000 94850000 +chr1 93900000 94900000 +chr1 93950000 94950000 +chr1 94000000 95000000 +chr1 94050000 95050000 +chr1 94100000 95100000 +chr1 94150000 95150000 +chr1 94200000 95200000 +chr1 94250000 95250000 +chr1 94300000 95300000 +chr1 94350000 95350000 +chr1 94400000 95400000 +chr1 94450000 95450000 +chr1 94500000 95500000 +chr1 94550000 95550000 +chr1 94600000 95600000 +chr1 94650000 95650000 +chr1 94700000 95700000 +chr1 94750000 95750000 +chr1 94800000 95800000 +chr1 94850000 95850000 +chr1 94900000 95900000 +chr1 94950000 95950000 +chr1 95000000 96000000 +chr1 95050000 96050000 +chr1 95100000 96100000 +chr1 95150000 96150000 +chr1 95200000 96200000 +chr1 95250000 96250000 +chr1 95300000 96300000 +chr1 95350000 96350000 +chr1 95400000 96400000 +chr1 95450000 96450000 +chr1 95500000 96500000 +chr1 95550000 96550000 +chr1 95600000 96600000 +chr1 95650000 96650000 +chr1 95700000 96700000 +chr1 95750000 96750000 +chr1 95800000 96800000 +chr1 95850000 96850000 +chr1 95900000 96900000 +chr1 95950000 96950000 +chr1 96000000 97000000 +chr1 96050000 97050000 +chr1 96100000 97100000 +chr1 96150000 97150000 +chr1 96200000 97200000 +chr1 96250000 97250000 +chr1 96300000 97300000 +chr1 96350000 97350000 +chr1 96400000 97400000 +chr1 96450000 97450000 +chr1 96500000 97500000 +chr1 96550000 97550000 +chr1 96600000 97600000 +chr1 96650000 97650000 +chr1 96700000 97700000 +chr1 96750000 97750000 +chr1 96800000 97800000 +chr1 96850000 97850000 +chr1 96900000 97900000 +chr1 96950000 97950000 +chr1 97000000 98000000 +chr1 97050000 98050000 +chr1 97100000 98100000 +chr1 97150000 98150000 +chr1 97200000 98200000 +chr1 97250000 98250000 +chr1 97300000 98300000 +chr1 97350000 98350000 +chr1 97400000 98400000 +chr1 97450000 98450000 +chr1 97500000 98500000 +chr1 97550000 98550000 +chr1 97600000 98600000 +chr1 97650000 98650000 +chr1 97700000 98700000 +chr1 97750000 98750000 +chr1 97800000 98800000 +chr1 97850000 98850000 +chr1 97900000 98900000 +chr1 97950000 98950000 +chr1 98000000 99000000 +chr1 98050000 99050000 +chr1 98100000 99100000 +chr1 98150000 99150000 +chr1 98200000 99200000 +chr1 98250000 99250000 +chr1 98300000 99300000 +chr1 98350000 99350000 +chr1 98400000 99400000 +chr1 98450000 99450000 +chr1 98500000 99500000 +chr1 98550000 99550000 +chr1 98600000 99600000 +chr1 98650000 99650000 +chr1 98700000 99700000 +chr1 98750000 99750000 +chr1 98800000 99800000 +chr1 98850000 99850000 +chr1 98900000 99900000 +chr1 98950000 99950000 +chr1 99000000 100000000 +chr1 99050000 100050000 +chr1 99100000 100100000 +chr1 99150000 100150000 +chr1 99200000 100200000 +chr1 99250000 100250000 +chr1 99300000 100300000 +chr1 99350000 100350000 +chr1 99400000 100400000 +chr1 99450000 100450000 +chr1 99500000 100500000 +chr1 99550000 100550000 +chr1 99600000 100600000 +chr1 99650000 100650000 +chr1 99700000 100700000 +chr1 99750000 100750000 +chr1 99800000 100800000 +chr1 99850000 100850000 +chr1 99900000 100900000 +chr1 99950000 100950000 +chr1 100000000 101000000 +chr1 100050000 101050000 +chr1 100100000 101100000 +chr1 100150000 101150000 +chr1 100200000 101200000 +chr1 100250000 101250000 +chr1 100300000 101300000 +chr1 100350000 101350000 +chr1 100400000 101400000 +chr1 100450000 101450000 +chr1 100500000 101500000 +chr1 100550000 101550000 +chr1 100600000 101600000 +chr1 100650000 101650000 +chr1 100700000 101700000 +chr1 100750000 101750000 +chr1 100800000 101800000 +chr1 100850000 101850000 +chr1 100900000 101900000 +chr1 100950000 101950000 +chr1 101000000 102000000 +chr1 101050000 102050000 +chr1 101100000 102100000 +chr1 101150000 102150000 +chr1 101200000 102200000 +chr1 101250000 102250000 +chr1 101300000 102300000 +chr1 101350000 102350000 +chr1 101400000 102400000 +chr1 101450000 102450000 +chr1 101500000 102500000 +chr1 101550000 102550000 +chr1 101600000 102600000 +chr1 101650000 102650000 +chr1 101700000 102700000 +chr1 101750000 102750000 +chr1 101800000 102800000 +chr1 101850000 102850000 +chr1 101900000 102900000 +chr1 101950000 102950000 +chr1 102000000 103000000 +chr1 102050000 103050000 +chr1 102100000 103100000 +chr1 102150000 103150000 +chr1 102200000 103200000 +chr1 102250000 103250000 +chr1 102300000 103300000 +chr1 102350000 103350000 +chr1 102400000 103400000 +chr1 102450000 103450000 +chr1 102500000 103500000 +chr1 102550000 103550000 +chr1 102600000 103600000 +chr1 102650000 103650000 +chr1 102700000 103700000 +chr1 102750000 103750000 +chr1 102800000 103800000 +chr1 102850000 103850000 +chr1 102900000 103900000 +chr1 102950000 103950000 +chr1 103000000 104000000 +chr1 103050000 104050000 +chr1 103100000 104100000 +chr1 103150000 104150000 +chr1 103200000 104200000 +chr1 103250000 104250000 +chr1 103300000 104300000 +chr1 103350000 104350000 +chr1 103400000 104400000 +chr1 103450000 104450000 +chr1 103500000 104500000 +chr1 103550000 104550000 +chr1 103600000 104600000 +chr1 103650000 104650000 +chr1 103700000 104700000 +chr1 103750000 104750000 +chr1 103800000 104800000 +chr1 103850000 104850000 +chr1 103900000 104900000 +chr1 103950000 104950000 +chr1 104000000 105000000 +chr1 104050000 105050000 +chr1 104100000 105100000 +chr1 104150000 105150000 +chr1 104200000 105200000 +chr1 104250000 105250000 +chr1 104300000 105300000 +chr1 104350000 105350000 +chr1 104400000 105400000 +chr1 104450000 105450000 +chr1 104500000 105500000 +chr1 104550000 105550000 +chr1 104600000 105600000 +chr1 104650000 105650000 +chr1 104700000 105700000 +chr1 104750000 105750000 +chr1 104800000 105800000 +chr1 104850000 105850000 +chr1 104900000 105900000 +chr1 104950000 105950000 +chr1 105000000 106000000 +chr1 105050000 106050000 +chr1 105100000 106100000 +chr1 105150000 106150000 +chr1 105200000 106200000 +chr1 105250000 106250000 +chr1 105300000 106300000 +chr1 105350000 106350000 +chr1 105400000 106400000 +chr1 105450000 106450000 +chr1 105500000 106500000 +chr1 105550000 106550000 +chr1 105600000 106600000 +chr1 105650000 106650000 +chr1 105700000 106700000 +chr1 105750000 106750000 +chr1 105800000 106800000 +chr1 105850000 106850000 +chr1 105900000 106900000 +chr1 105950000 106950000 +chr1 106000000 107000000 +chr1 106050000 107050000 +chr1 106100000 107100000 +chr1 106150000 107150000 +chr1 106200000 107200000 +chr1 106250000 107250000 +chr1 106300000 107300000 +chr1 106350000 107350000 +chr1 106400000 107400000 +chr1 106450000 107450000 +chr1 106500000 107500000 +chr1 106550000 107550000 +chr1 106600000 107600000 +chr1 106650000 107650000 +chr1 106700000 107700000 +chr1 106750000 107750000 +chr1 106800000 107800000 +chr1 106850000 107850000 +chr1 106900000 107900000 +chr1 106950000 107950000 +chr1 107000000 108000000 +chr1 107050000 108050000 +chr1 107100000 108100000 +chr1 107150000 108150000 +chr1 107200000 108200000 +chr1 107250000 108250000 +chr1 107300000 108300000 +chr1 107350000 108350000 +chr1 107400000 108400000 +chr1 107450000 108450000 +chr1 107500000 108500000 +chr1 107550000 108550000 +chr1 107600000 108600000 +chr1 107650000 108650000 +chr1 107700000 108700000 +chr1 107750000 108750000 +chr1 107800000 108800000 +chr1 107850000 108850000 +chr1 107900000 108900000 +chr1 107950000 108950000 +chr1 108000000 109000000 +chr1 108050000 109050000 +chr1 108100000 109100000 +chr1 108150000 109150000 +chr1 108200000 109200000 +chr1 108250000 109250000 +chr1 108300000 109300000 +chr1 108350000 109350000 +chr1 108400000 109400000 +chr1 108450000 109450000 +chr1 108500000 109500000 +chr1 108550000 109550000 +chr1 108600000 109600000 +chr1 108650000 109650000 +chr1 108700000 109700000 +chr1 108750000 109750000 +chr1 108800000 109800000 +chr1 108850000 109850000 +chr1 108900000 109900000 +chr1 108950000 109950000 +chr1 109000000 110000000 +chr1 109050000 110050000 +chr1 109100000 110100000 +chr1 109150000 110150000 +chr1 109200000 110200000 +chr1 109250000 110250000 +chr1 109300000 110300000 +chr1 109350000 110350000 +chr1 109400000 110400000 +chr1 109450000 110450000 +chr1 109500000 110500000 +chr1 109550000 110550000 +chr1 109600000 110600000 +chr1 109650000 110650000 +chr1 109700000 110700000 +chr1 109750000 110750000 +chr1 109800000 110800000 +chr1 109850000 110850000 +chr1 109900000 110900000 +chr1 109950000 110950000 +chr1 110000000 111000000 +chr1 110050000 111050000 +chr1 110100000 111100000 +chr1 110150000 111150000 +chr1 110200000 111200000 +chr1 110250000 111250000 +chr1 110300000 111300000 +chr1 110350000 111350000 +chr1 110400000 111400000 +chr1 110450000 111450000 +chr1 110500000 111500000 +chr1 110550000 111550000 +chr1 110600000 111600000 +chr1 110650000 111650000 +chr1 110700000 111700000 +chr1 110750000 111750000 +chr1 110800000 111800000 +chr1 110850000 111850000 +chr1 110900000 111900000 +chr1 110950000 111950000 +chr1 111000000 112000000 +chr1 111050000 112050000 +chr1 111100000 112100000 +chr1 111150000 112150000 +chr1 111200000 112200000 +chr1 111250000 112250000 +chr1 111300000 112300000 +chr1 111350000 112350000 +chr1 111400000 112400000 +chr1 111450000 112450000 +chr1 111500000 112500000 +chr1 111550000 112550000 +chr1 111600000 112600000 +chr1 111650000 112650000 +chr1 111700000 112700000 +chr1 111750000 112750000 +chr1 111800000 112800000 +chr1 111850000 112850000 +chr1 111900000 112900000 +chr1 111950000 112950000 +chr1 112000000 113000000 +chr1 112050000 113050000 +chr1 112100000 113100000 +chr1 112150000 113150000 +chr1 112200000 113200000 +chr1 112250000 113250000 +chr1 112300000 113300000 +chr1 112350000 113350000 +chr1 112400000 113400000 +chr1 112450000 113450000 +chr1 112500000 113500000 +chr1 112550000 113550000 +chr1 112600000 113600000 +chr1 112650000 113650000 +chr1 112700000 113700000 +chr1 112750000 113750000 +chr1 112800000 113800000 +chr1 112850000 113850000 +chr1 112900000 113900000 +chr1 112950000 113950000 +chr1 113000000 114000000 +chr1 113050000 114050000 +chr1 113100000 114100000 +chr1 113150000 114150000 +chr1 113200000 114200000 +chr1 113250000 114250000 +chr1 113300000 114300000 +chr1 113350000 114350000 +chr1 113400000 114400000 +chr1 113450000 114450000 +chr1 113500000 114500000 +chr1 113550000 114550000 +chr1 113600000 114600000 +chr1 113650000 114650000 +chr1 113700000 114700000 +chr1 113750000 114750000 +chr1 113800000 114800000 +chr1 113850000 114850000 +chr1 113900000 114900000 +chr1 113950000 114950000 +chr1 114000000 115000000 +chr1 114050000 115050000 +chr1 114100000 115100000 +chr1 114150000 115150000 +chr1 114200000 115200000 +chr1 114250000 115250000 +chr1 114300000 115300000 +chr1 114350000 115350000 +chr1 114400000 115400000 +chr1 114450000 115450000 +chr1 114500000 115500000 +chr1 114550000 115550000 +chr1 114600000 115600000 +chr1 114650000 115650000 +chr1 114700000 115700000 +chr1 114750000 115750000 +chr1 114800000 115800000 +chr1 114850000 115850000 +chr1 114900000 115900000 +chr1 114950000 115950000 +chr1 115000000 116000000 +chr1 115050000 116050000 +chr1 115100000 116100000 +chr1 115150000 116150000 +chr1 115200000 116200000 +chr1 115250000 116250000 +chr1 115300000 116300000 +chr1 115350000 116350000 +chr1 115400000 116400000 +chr1 115450000 116450000 +chr1 115500000 116500000 +chr1 115550000 116550000 +chr1 115600000 116600000 +chr1 115650000 116650000 +chr1 115700000 116700000 +chr1 115750000 116750000 +chr1 115800000 116800000 +chr1 115850000 116850000 +chr1 115900000 116900000 +chr1 115950000 116950000 +chr1 116000000 117000000 +chr1 116050000 117050000 +chr1 116100000 117100000 +chr1 116150000 117150000 +chr1 116200000 117200000 +chr1 116250000 117250000 +chr1 116300000 117300000 +chr1 116350000 117350000 +chr1 116400000 117400000 +chr1 116450000 117450000 +chr1 116500000 117500000 +chr1 116550000 117550000 +chr1 116600000 117600000 +chr1 116650000 117650000 +chr1 116700000 117700000 +chr1 116750000 117750000 +chr1 116800000 117800000 +chr1 116850000 117850000 +chr1 116900000 117900000 +chr1 116950000 117950000 +chr1 117000000 118000000 +chr1 117050000 118050000 +chr1 117100000 118100000 +chr1 117150000 118150000 +chr1 117200000 118200000 +chr1 117250000 118250000 +chr1 117300000 118300000 +chr1 117350000 118350000 +chr1 117400000 118400000 +chr1 117450000 118450000 +chr1 117500000 118500000 +chr1 117550000 118550000 +chr1 117600000 118600000 +chr1 117650000 118650000 +chr1 117700000 118700000 +chr1 117750000 118750000 +chr1 117800000 118800000 +chr1 117850000 118850000 +chr1 117900000 118900000 +chr1 117950000 118950000 +chr1 118000000 119000000 +chr1 118050000 119050000 +chr1 118100000 119100000 +chr1 118150000 119150000 +chr1 118200000 119200000 +chr1 118250000 119250000 +chr1 118300000 119300000 +chr1 118350000 119350000 +chr1 118400000 119400000 +chr1 118450000 119450000 +chr1 118500000 119500000 +chr1 118550000 119550000 +chr1 118600000 119600000 +chr1 118650000 119650000 +chr1 118700000 119700000 +chr1 118750000 119750000 +chr1 118800000 119800000 +chr1 118850000 119850000 +chr1 118900000 119900000 +chr1 118950000 119950000 +chr1 119000000 120000000 +chr1 119050000 120050000 +chr1 119100000 120100000 +chr1 119150000 120150000 +chr1 119200000 120200000 +chr1 119250000 120250000 +chr1 119300000 120300000 +chr1 119350000 120350000 +chr1 119400000 120400000 +chr1 119450000 120450000 +chr1 119500000 120500000 +chr1 119550000 120550000 +chr1 119600000 120600000 +chr1 119650000 120650000 +chr1 119700000 120700000 +chr1 119750000 120750000 +chr1 119800000 120800000 +chr1 119850000 120850000 +chr1 119900000 120900000 +chr1 119950000 120950000 +chr1 120000000 121000000 +chr1 120050000 121050000 +chr1 120100000 121100000 +chr1 120150000 121150000 +chr1 120200000 121200000 +chr1 120250000 121250000 +chr1 120300000 121300000 +chr1 120350000 121350000 +chr1 120400000 121400000 +chr1 120450000 121450000 +chr1 120500000 121500000 +chr1 120550000 121550000 +chr1 120600000 121600000 +chr1 120650000 121650000 +chr1 120700000 121700000 +chr1 120750000 121750000 +chr1 120800000 121800000 +chr1 120850000 121850000 +chr1 120900000 121900000 +chr1 120950000 121950000 +chr1 121000000 122000000 +chr1 121050000 122050000 +chr1 121100000 122100000 +chr1 121150000 122150000 +chr1 121200000 122200000 +chr1 121250000 122250000 +chr1 121300000 122300000 +chr1 121350000 122350000 +chr1 121400000 122400000 +chr1 121450000 122450000 +chr1 121500000 122500000 +chr1 121550000 122550000 +chr1 121600000 122600000 +chr1 121650000 122650000 +chr1 121700000 122700000 +chr1 121750000 122750000 +chr1 121800000 122800000 +chr1 121850000 122850000 +chr1 121900000 122900000 +chr1 121950000 122950000 +chr1 122000000 123000000 +chr1 122050000 123050000 +chr1 122100000 123100000 +chr1 122150000 123150000 +chr1 122200000 123200000 +chr1 122250000 123250000 +chr1 122300000 123300000 +chr1 122350000 123350000 +chr1 122400000 123400000 +chr1 122450000 123450000 +chr1 122500000 123500000 +chr1 122550000 123550000 +chr1 122600000 123600000 +chr1 122650000 123650000 +chr1 122700000 123700000 +chr1 122750000 123750000 +chr1 122800000 123800000 +chr1 122850000 123850000 +chr1 122900000 123900000 +chr1 122950000 123950000 +chr1 123000000 124000000 +chr1 123050000 124050000 +chr1 123100000 124100000 +chr1 123150000 124150000 +chr1 123200000 124200000 +chr1 123250000 124250000 +chr1 123300000 124300000 +chr1 123350000 124350000 +chr1 123400000 124400000 +chr1 123450000 124450000 +chr1 123500000 124500000 +chr1 123550000 124550000 +chr1 123600000 124600000 +chr1 123650000 124650000 +chr1 123700000 124700000 +chr1 123750000 124750000 +chr1 123800000 124800000 +chr1 123850000 124850000 +chr1 123900000 124900000 +chr1 123950000 124950000 +chr1 124000000 125000000 +chr1 124050000 125050000 +chr1 124100000 125100000 +chr1 124150000 125150000 +chr1 124200000 125200000 +chr1 124250000 125250000 +chr1 124300000 125300000 +chr1 124350000 125350000 +chr1 124400000 125400000 +chr1 124450000 125450000 +chr1 124500000 125500000 +chr1 124550000 125550000 +chr1 124600000 125600000 +chr1 124650000 125650000 +chr1 124700000 125700000 +chr1 124750000 125750000 +chr1 124800000 125800000 +chr1 124850000 125850000 +chr1 124900000 125900000 +chr1 124950000 125950000 +chr1 125000000 126000000 +chr1 125050000 126050000 +chr1 125100000 126100000 +chr1 125150000 126150000 +chr1 125200000 126200000 +chr1 125250000 126250000 +chr1 125300000 126300000 +chr1 125350000 126350000 +chr1 125400000 126400000 +chr1 125450000 126450000 +chr1 125500000 126500000 +chr1 125550000 126550000 +chr1 125600000 126600000 +chr1 125650000 126650000 +chr1 125700000 126700000 +chr1 125750000 126750000 +chr1 125800000 126800000 +chr1 125850000 126850000 +chr1 125900000 126900000 +chr1 125950000 126950000 +chr1 126000000 127000000 +chr1 126050000 127050000 +chr1 126100000 127100000 +chr1 126150000 127150000 +chr1 126200000 127200000 +chr1 126250000 127250000 +chr1 126300000 127300000 +chr1 126350000 127350000 +chr1 126400000 127400000 +chr1 126450000 127450000 +chr1 126500000 127500000 +chr1 126550000 127550000 +chr1 126600000 127600000 +chr1 126650000 127650000 +chr1 126700000 127700000 +chr1 126750000 127750000 +chr1 126800000 127800000 +chr1 126850000 127850000 +chr1 126900000 127900000 +chr1 126950000 127950000 +chr1 127000000 128000000 +chr1 127050000 128050000 +chr1 127100000 128100000 +chr1 127150000 128150000 +chr1 127200000 128200000 +chr1 127250000 128250000 +chr1 127300000 128300000 +chr1 127350000 128350000 +chr1 127400000 128400000 +chr1 127450000 128450000 +chr1 127500000 128500000 +chr1 127550000 128550000 +chr1 127600000 128600000 +chr1 127650000 128650000 +chr1 127700000 128700000 +chr1 127750000 128750000 +chr1 127800000 128800000 +chr1 127850000 128850000 +chr1 127900000 128900000 +chr1 127950000 128950000 +chr1 128000000 129000000 +chr1 128050000 129050000 +chr1 128100000 129100000 +chr1 128150000 129150000 +chr1 128200000 129200000 +chr1 128250000 129250000 +chr1 128300000 129300000 +chr1 128350000 129350000 +chr1 128400000 129400000 +chr1 128450000 129450000 +chr1 128500000 129500000 +chr1 128550000 129550000 +chr1 128600000 129600000 +chr1 128650000 129650000 +chr1 128700000 129700000 +chr1 128750000 129750000 +chr1 128800000 129800000 +chr1 128850000 129850000 +chr1 128900000 129900000 +chr1 128950000 129950000 +chr1 129000000 130000000 +chr1 129050000 130050000 +chr1 129100000 130100000 +chr1 129150000 130150000 +chr1 129200000 130200000 +chr1 129250000 130250000 +chr1 129300000 130300000 +chr1 129350000 130350000 +chr1 129400000 130400000 +chr1 129450000 130450000 +chr1 129500000 130500000 +chr1 129550000 130550000 +chr1 129600000 130600000 +chr1 129650000 130650000 +chr1 129700000 130700000 +chr1 129750000 130750000 +chr1 129800000 130800000 +chr1 129850000 130850000 +chr1 129900000 130900000 +chr1 129950000 130950000 +chr1 130000000 131000000 +chr1 130050000 131050000 +chr1 130100000 131100000 +chr1 130150000 131150000 +chr1 130200000 131200000 +chr1 130250000 131250000 +chr1 130300000 131300000 +chr1 130350000 131350000 +chr1 130400000 131400000 +chr1 130450000 131450000 +chr1 130500000 131500000 +chr1 130550000 131550000 +chr1 130600000 131600000 +chr1 130650000 131650000 +chr1 130700000 131700000 +chr1 130750000 131750000 +chr1 130800000 131800000 +chr1 130850000 131850000 +chr1 130900000 131900000 +chr1 130950000 131950000 +chr1 131000000 132000000 +chr1 131050000 132050000 +chr1 131100000 132100000 +chr1 131150000 132150000 +chr1 131200000 132200000 +chr1 131250000 132250000 +chr1 131300000 132300000 +chr1 131350000 132350000 +chr1 131400000 132400000 +chr1 131450000 132450000 +chr1 131500000 132500000 +chr1 131550000 132550000 +chr1 131600000 132600000 +chr1 131650000 132650000 +chr1 131700000 132700000 +chr1 131750000 132750000 +chr1 131800000 132800000 +chr1 131850000 132850000 +chr1 131900000 132900000 +chr1 131950000 132950000 +chr1 132000000 133000000 +chr1 132050000 133050000 +chr1 132100000 133100000 +chr1 132150000 133150000 +chr1 132200000 133200000 +chr1 132250000 133250000 +chr1 132300000 133300000 +chr1 132350000 133350000 +chr1 132400000 133400000 +chr1 132450000 133450000 +chr1 132500000 133500000 +chr1 132550000 133550000 +chr1 132600000 133600000 +chr1 132650000 133650000 +chr1 132700000 133700000 +chr1 132750000 133750000 +chr1 132800000 133800000 +chr1 132850000 133850000 +chr1 132900000 133900000 +chr1 132950000 133950000 +chr1 133000000 134000000 +chr1 133050000 134050000 +chr1 133100000 134100000 +chr1 133150000 134150000 +chr1 133200000 134200000 +chr1 133250000 134250000 +chr1 133300000 134300000 +chr1 133350000 134350000 +chr1 133400000 134400000 +chr1 133450000 134450000 +chr1 133500000 134500000 +chr1 133550000 134550000 +chr1 133600000 134600000 +chr1 133650000 134650000 +chr1 133700000 134700000 +chr1 133750000 134750000 +chr1 133800000 134800000 +chr1 133850000 134850000 +chr1 133900000 134900000 +chr1 133950000 134950000 +chr1 134000000 135000000 +chr1 134050000 135050000 +chr1 134100000 135100000 +chr1 134150000 135150000 +chr1 134200000 135200000 +chr1 134250000 135250000 +chr1 134300000 135300000 +chr1 134350000 135350000 +chr1 134400000 135400000 +chr1 134450000 135450000 +chr1 134500000 135500000 +chr1 134550000 135550000 +chr1 134600000 135600000 +chr1 134650000 135650000 +chr1 134700000 135700000 +chr1 134750000 135750000 +chr1 134800000 135800000 +chr1 134850000 135850000 +chr1 134900000 135900000 +chr1 134950000 135950000 +chr1 135000000 136000000 +chr1 135050000 136050000 +chr1 135100000 136100000 +chr1 135150000 136150000 +chr1 135200000 136200000 +chr1 135250000 136250000 +chr1 135300000 136300000 +chr1 135350000 136350000 +chr1 135400000 136400000 +chr1 135450000 136450000 +chr1 135500000 136500000 +chr1 135550000 136550000 +chr1 135600000 136600000 +chr1 135650000 136650000 +chr1 135700000 136700000 +chr1 135750000 136750000 +chr1 135800000 136800000 +chr1 135850000 136850000 +chr1 135900000 136900000 +chr1 135950000 136950000 +chr1 136000000 137000000 +chr1 136050000 137050000 +chr1 136100000 137100000 +chr1 136150000 137150000 +chr1 136200000 137200000 +chr1 136250000 137250000 +chr1 136300000 137300000 +chr1 136350000 137350000 +chr1 136400000 137400000 +chr1 136450000 137450000 +chr1 136500000 137500000 +chr1 136550000 137550000 +chr1 136600000 137600000 +chr1 136650000 137650000 +chr1 136700000 137700000 +chr1 136750000 137750000 +chr1 136800000 137800000 +chr1 136850000 137850000 +chr1 136900000 137900000 +chr1 136950000 137950000 +chr1 137000000 138000000 +chr1 137050000 138050000 +chr1 137100000 138100000 +chr1 137150000 138150000 +chr1 137200000 138200000 +chr1 137250000 138250000 +chr1 137300000 138300000 +chr1 137350000 138350000 +chr1 137400000 138400000 +chr1 137450000 138450000 +chr1 137500000 138500000 +chr1 137550000 138550000 +chr1 137600000 138600000 +chr1 137650000 138650000 +chr1 137700000 138700000 +chr1 137750000 138750000 +chr1 137800000 138800000 +chr1 137850000 138850000 +chr1 137900000 138900000 +chr1 137950000 138950000 +chr1 138000000 139000000 +chr1 138050000 139050000 +chr1 138100000 139100000 +chr1 138150000 139150000 +chr1 138200000 139200000 +chr1 138250000 139250000 +chr1 138300000 139300000 +chr1 138350000 139350000 +chr1 138400000 139400000 +chr1 138450000 139450000 +chr1 138500000 139500000 +chr1 138550000 139550000 +chr1 138600000 139600000 +chr1 138650000 139650000 +chr1 138700000 139700000 +chr1 138750000 139750000 +chr1 138800000 139800000 +chr1 138850000 139850000 +chr1 138900000 139900000 +chr1 138950000 139950000 +chr1 139000000 140000000 +chr1 139050000 140050000 +chr1 139100000 140100000 +chr1 139150000 140150000 +chr1 139200000 140200000 +chr1 139250000 140250000 +chr1 139300000 140300000 +chr1 139350000 140350000 +chr1 139400000 140400000 +chr1 139450000 140450000 +chr1 139500000 140500000 +chr1 139550000 140550000 +chr1 139600000 140600000 +chr1 139650000 140650000 +chr1 139700000 140700000 +chr1 139750000 140750000 +chr1 139800000 140800000 +chr1 139850000 140850000 +chr1 139900000 140900000 +chr1 139950000 140950000 +chr1 140000000 141000000 +chr1 140050000 141050000 +chr1 140100000 141100000 +chr1 140150000 141150000 +chr1 140200000 141200000 +chr1 140250000 141250000 +chr1 140300000 141300000 +chr1 140350000 141350000 +chr1 140400000 141400000 +chr1 140450000 141450000 +chr1 140500000 141500000 +chr1 140550000 141550000 +chr1 140600000 141600000 +chr1 140650000 141650000 +chr1 140700000 141700000 +chr1 140750000 141750000 +chr1 140800000 141800000 +chr1 140850000 141850000 +chr1 140900000 141900000 +chr1 140950000 141950000 +chr1 141000000 142000000 +chr1 141050000 142050000 +chr1 141100000 142100000 +chr1 141150000 142150000 +chr1 141200000 142200000 +chr1 141250000 142250000 +chr1 141300000 142300000 +chr1 141350000 142350000 +chr1 141400000 142400000 +chr1 141450000 142450000 +chr1 141500000 142500000 +chr1 141550000 142550000 +chr1 141600000 142600000 +chr1 141650000 142650000 +chr1 141700000 142700000 +chr1 141750000 142750000 +chr1 141800000 142800000 +chr1 141850000 142850000 +chr1 141900000 142900000 +chr1 141950000 142950000 +chr1 142000000 143000000 +chr1 142050000 143050000 +chr1 142100000 143100000 +chr1 142150000 143150000 +chr1 142200000 143200000 +chr1 142250000 143250000 +chr1 142300000 143300000 +chr1 142350000 143350000 +chr1 142400000 143400000 +chr1 142450000 143450000 +chr1 142500000 143500000 +chr1 142550000 143550000 +chr1 142600000 143600000 +chr1 142650000 143650000 +chr1 142700000 143700000 +chr1 142750000 143750000 +chr1 142800000 143800000 +chr1 142850000 143850000 +chr1 142900000 143900000 +chr1 142950000 143950000 +chr1 143000000 144000000 +chr1 143050000 144050000 +chr1 143100000 144100000 +chr1 143150000 144150000 +chr1 143200000 144200000 +chr1 143250000 144250000 +chr1 143300000 144300000 +chr1 143350000 144350000 +chr1 143400000 144400000 +chr1 143450000 144450000 +chr1 143500000 144500000 +chr1 143550000 144550000 +chr1 143600000 144600000 +chr1 143650000 144650000 +chr1 143700000 144700000 +chr1 143750000 144750000 +chr1 143800000 144800000 +chr1 143850000 144850000 +chr1 143900000 144900000 +chr1 143950000 144950000 +chr1 144000000 145000000 +chr1 144050000 145050000 +chr1 144100000 145100000 +chr1 144150000 145150000 +chr1 144200000 145200000 +chr1 144250000 145250000 +chr1 144300000 145300000 +chr1 144350000 145350000 +chr1 144400000 145400000 +chr1 144450000 145450000 +chr1 144500000 145500000 +chr1 144550000 145550000 +chr1 144600000 145600000 +chr1 144650000 145650000 +chr1 144700000 145700000 +chr1 144750000 145750000 +chr1 144800000 145800000 +chr1 144850000 145850000 +chr1 144900000 145900000 +chr1 144950000 145950000 +chr1 145000000 146000000 +chr1 145050000 146050000 +chr1 145100000 146100000 +chr1 145150000 146150000 +chr1 145200000 146200000 +chr1 145250000 146250000 +chr1 145300000 146300000 +chr1 145350000 146350000 +chr1 145400000 146400000 +chr1 145450000 146450000 +chr1 145500000 146500000 +chr1 145550000 146550000 +chr1 145600000 146600000 +chr1 145650000 146650000 +chr1 145700000 146700000 +chr1 145750000 146750000 +chr1 145800000 146800000 +chr1 145850000 146850000 +chr1 145900000 146900000 +chr1 145950000 146950000 +chr1 146000000 147000000 +chr1 146050000 147050000 +chr1 146100000 147100000 +chr1 146150000 147150000 +chr1 146200000 147200000 +chr1 146250000 147250000 +chr1 146300000 147300000 +chr1 146350000 147350000 +chr1 146400000 147400000 +chr1 146450000 147450000 +chr1 146500000 147500000 +chr1 146550000 147550000 +chr1 146600000 147600000 +chr1 146650000 147650000 +chr1 146700000 147700000 +chr1 146750000 147750000 +chr1 146800000 147800000 +chr1 146850000 147850000 +chr1 146900000 147900000 +chr1 146950000 147950000 +chr1 147000000 148000000 +chr1 147050000 148050000 +chr1 147100000 148100000 +chr1 147150000 148150000 +chr1 147200000 148200000 +chr1 147250000 148250000 +chr1 147300000 148300000 +chr1 147350000 148350000 +chr1 147400000 148400000 +chr1 147450000 148450000 +chr1 147500000 148500000 +chr1 147550000 148550000 +chr1 147600000 148600000 +chr1 147650000 148650000 +chr1 147700000 148700000 +chr1 147750000 148750000 +chr1 147800000 148800000 +chr1 147850000 148850000 +chr1 147900000 148900000 +chr1 147950000 148950000 +chr1 148000000 149000000 +chr1 148050000 149050000 +chr1 148100000 149100000 +chr1 148150000 149150000 +chr1 148200000 149200000 +chr1 148250000 149250000 +chr1 148300000 149300000 +chr1 148350000 149350000 +chr1 148400000 149400000 +chr1 148450000 149450000 +chr1 148500000 149500000 +chr1 148550000 149550000 +chr1 148600000 149600000 +chr1 148650000 149650000 +chr1 148700000 149700000 +chr1 148750000 149750000 +chr1 148800000 149800000 +chr1 148850000 149850000 +chr1 148900000 149900000 +chr1 148950000 149950000 +chr1 149000000 150000000 +chr1 149050000 150050000 +chr1 149100000 150100000 +chr1 149150000 150150000 +chr1 149200000 150200000 +chr1 149250000 150250000 +chr1 149300000 150300000 +chr1 149350000 150350000 +chr1 149400000 150400000 +chr1 149450000 150450000 +chr1 149500000 150500000 +chr1 149550000 150550000 +chr1 149600000 150600000 +chr1 149650000 150650000 +chr1 149700000 150700000 +chr1 149750000 150750000 +chr1 149800000 150800000 +chr1 149850000 150850000 +chr1 149900000 150900000 +chr1 149950000 150950000 +chr1 150000000 151000000 +chr1 150050000 151050000 +chr1 150100000 151100000 +chr1 150150000 151150000 +chr1 150200000 151200000 +chr1 150250000 151250000 +chr1 150300000 151300000 +chr1 150350000 151350000 +chr1 150400000 151400000 +chr1 150450000 151450000 +chr1 150500000 151500000 +chr1 150550000 151550000 +chr1 150600000 151600000 +chr1 150650000 151650000 +chr1 150700000 151700000 +chr1 150750000 151750000 +chr1 150800000 151800000 +chr1 150850000 151850000 +chr1 150900000 151900000 +chr1 150950000 151950000 +chr1 151000000 152000000 +chr1 151050000 152050000 +chr1 151100000 152100000 +chr1 151150000 152150000 +chr1 151200000 152200000 +chr1 151250000 152250000 +chr1 151300000 152300000 +chr1 151350000 152350000 +chr1 151400000 152400000 +chr1 151450000 152450000 +chr1 151500000 152500000 +chr1 151550000 152550000 +chr1 151600000 152600000 +chr1 151650000 152650000 +chr1 151700000 152700000 +chr1 151750000 152750000 +chr1 151800000 152800000 +chr1 151850000 152850000 +chr1 151900000 152900000 +chr1 151950000 152950000 +chr1 152000000 153000000 +chr1 152050000 153050000 +chr1 152100000 153100000 +chr1 152150000 153150000 +chr1 152200000 153200000 +chr1 152250000 153250000 +chr1 152300000 153300000 +chr1 152350000 153350000 +chr1 152400000 153400000 +chr1 152450000 153450000 +chr1 152500000 153500000 +chr1 152550000 153550000 +chr1 152600000 153600000 +chr1 152650000 153650000 +chr1 152700000 153700000 +chr1 152750000 153750000 +chr1 152800000 153800000 +chr1 152850000 153850000 +chr1 152900000 153900000 +chr1 152950000 153950000 +chr1 153000000 154000000 +chr1 153050000 154050000 +chr1 153100000 154100000 +chr1 153150000 154150000 +chr1 153200000 154200000 +chr1 153250000 154250000 +chr1 153300000 154300000 +chr1 153350000 154350000 +chr1 153400000 154400000 +chr1 153450000 154450000 +chr1 153500000 154500000 +chr1 153550000 154550000 +chr1 153600000 154600000 +chr1 153650000 154650000 +chr1 153700000 154700000 +chr1 153750000 154750000 +chr1 153800000 154800000 +chr1 153850000 154850000 +chr1 153900000 154900000 +chr1 153950000 154950000 +chr1 154000000 155000000 +chr1 154050000 155050000 +chr1 154100000 155100000 +chr1 154150000 155150000 +chr1 154200000 155200000 +chr1 154250000 155250000 +chr1 154300000 155300000 +chr1 154350000 155350000 +chr1 154400000 155400000 +chr1 154450000 155450000 +chr1 154500000 155500000 +chr1 154550000 155550000 +chr1 154600000 155600000 +chr1 154650000 155650000 +chr1 154700000 155700000 +chr1 154750000 155750000 +chr1 154800000 155800000 +chr1 154850000 155850000 +chr1 154900000 155900000 +chr1 154950000 155950000 +chr1 155000000 156000000 +chr1 155050000 156050000 +chr1 155100000 156100000 +chr1 155150000 156150000 +chr1 155200000 156200000 +chr1 155250000 156250000 +chr1 155300000 156300000 +chr1 155350000 156350000 +chr1 155400000 156400000 +chr1 155450000 156450000 +chr1 155500000 156500000 +chr1 155550000 156550000 +chr1 155600000 156600000 +chr1 155650000 156650000 +chr1 155700000 156700000 +chr1 155750000 156750000 +chr1 155800000 156800000 +chr1 155850000 156850000 +chr1 155900000 156900000 +chr1 155950000 156950000 +chr1 156000000 157000000 +chr1 156050000 157050000 +chr1 156100000 157100000 +chr1 156150000 157150000 +chr1 156200000 157200000 +chr1 156250000 157250000 +chr1 156300000 157300000 +chr1 156350000 157350000 +chr1 156400000 157400000 +chr1 156450000 157450000 +chr1 156500000 157500000 +chr1 156550000 157550000 +chr1 156600000 157600000 +chr1 156650000 157650000 +chr1 156700000 157700000 +chr1 156750000 157750000 +chr1 156800000 157800000 +chr1 156850000 157850000 +chr1 156900000 157900000 +chr1 156950000 157950000 +chr1 157000000 158000000 +chr1 157050000 158050000 +chr1 157100000 158100000 +chr1 157150000 158150000 +chr1 157200000 158200000 +chr1 157250000 158250000 +chr1 157300000 158300000 +chr1 157350000 158350000 +chr1 157400000 158400000 +chr1 157450000 158450000 +chr1 157500000 158500000 +chr1 157550000 158550000 +chr1 157600000 158600000 +chr1 157650000 158650000 +chr1 157700000 158700000 +chr1 157750000 158750000 +chr1 157800000 158800000 +chr1 157850000 158850000 +chr1 157900000 158900000 +chr1 157950000 158950000 +chr1 158000000 159000000 +chr1 158050000 159050000 +chr1 158100000 159100000 +chr1 158150000 159150000 +chr1 158200000 159200000 +chr1 158250000 159250000 +chr1 158300000 159300000 +chr1 158350000 159350000 +chr1 158400000 159400000 +chr1 158450000 159450000 +chr1 158500000 159500000 +chr1 158550000 159550000 +chr1 158600000 159600000 +chr1 158650000 159650000 +chr1 158700000 159700000 +chr1 158750000 159750000 +chr1 158800000 159800000 +chr1 158850000 159850000 +chr1 158900000 159900000 +chr1 158950000 159950000 +chr1 159000000 160000000 +chr1 159050000 160050000 +chr1 159100000 160100000 +chr1 159150000 160150000 +chr1 159200000 160200000 +chr1 159250000 160250000 +chr1 159300000 160300000 +chr1 159350000 160350000 +chr1 159400000 160400000 +chr1 159450000 160450000 +chr1 159500000 160500000 +chr1 159550000 160550000 +chr1 159600000 160600000 +chr1 159650000 160650000 +chr1 159700000 160700000 +chr1 159750000 160750000 +chr1 159800000 160800000 +chr1 159850000 160850000 +chr1 159900000 160900000 +chr1 159950000 160950000 +chr1 160000000 161000000 +chr1 160050000 161050000 +chr1 160100000 161100000 +chr1 160150000 161150000 +chr1 160200000 161200000 +chr1 160250000 161250000 +chr1 160300000 161300000 +chr1 160350000 161350000 +chr1 160400000 161400000 +chr1 160450000 161450000 +chr1 160500000 161500000 +chr1 160550000 161550000 +chr1 160600000 161600000 +chr1 160650000 161650000 +chr1 160700000 161700000 +chr1 160750000 161750000 +chr1 160800000 161800000 +chr1 160850000 161850000 +chr1 160900000 161900000 +chr1 160950000 161950000 +chr1 161000000 162000000 +chr1 161050000 162050000 +chr1 161100000 162100000 +chr1 161150000 162150000 +chr1 161200000 162200000 +chr1 161250000 162250000 +chr1 161300000 162300000 +chr1 161350000 162350000 +chr1 161400000 162400000 +chr1 161450000 162450000 +chr1 161500000 162500000 +chr1 161550000 162550000 +chr1 161600000 162600000 +chr1 161650000 162650000 +chr1 161700000 162700000 +chr1 161750000 162750000 +chr1 161800000 162800000 +chr1 161850000 162850000 +chr1 161900000 162900000 +chr1 161950000 162950000 +chr1 162000000 163000000 +chr1 162050000 163050000 +chr1 162100000 163100000 +chr1 162150000 163150000 +chr1 162200000 163200000 +chr1 162250000 163250000 +chr1 162300000 163300000 +chr1 162350000 163350000 +chr1 162400000 163400000 +chr1 162450000 163450000 +chr1 162500000 163500000 +chr1 162550000 163550000 +chr1 162600000 163600000 +chr1 162650000 163650000 +chr1 162700000 163700000 +chr1 162750000 163750000 +chr1 162800000 163800000 +chr1 162850000 163850000 +chr1 162900000 163900000 +chr1 162950000 163950000 +chr1 163000000 164000000 +chr1 163050000 164050000 +chr1 163100000 164100000 +chr1 163150000 164150000 +chr1 163200000 164200000 +chr1 163250000 164250000 +chr1 163300000 164300000 +chr1 163350000 164350000 +chr1 163400000 164400000 +chr1 163450000 164450000 +chr1 163500000 164500000 +chr1 163550000 164550000 +chr1 163600000 164600000 +chr1 163650000 164650000 +chr1 163700000 164700000 +chr1 163750000 164750000 +chr1 163800000 164800000 +chr1 163850000 164850000 +chr1 163900000 164900000 +chr1 163950000 164950000 +chr1 164000000 165000000 +chr1 164050000 165050000 +chr1 164100000 165100000 +chr1 164150000 165150000 +chr1 164200000 165200000 +chr1 164250000 165250000 +chr1 164300000 165300000 +chr1 164350000 165350000 +chr1 164400000 165400000 +chr1 164450000 165450000 +chr1 164500000 165500000 +chr1 164550000 165550000 +chr1 164600000 165600000 +chr1 164650000 165650000 +chr1 164700000 165700000 +chr1 164750000 165750000 +chr1 164800000 165800000 +chr1 164850000 165850000 +chr1 164900000 165900000 +chr1 164950000 165950000 +chr1 165000000 166000000 +chr1 165050000 166050000 +chr1 165100000 166100000 +chr1 165150000 166150000 +chr1 165200000 166200000 +chr1 165250000 166250000 +chr1 165300000 166300000 +chr1 165350000 166350000 +chr1 165400000 166400000 +chr1 165450000 166450000 +chr1 165500000 166500000 +chr1 165550000 166550000 +chr1 165600000 166600000 +chr1 165650000 166650000 +chr1 165700000 166700000 +chr1 165750000 166750000 +chr1 165800000 166800000 +chr1 165850000 166850000 +chr1 165900000 166900000 +chr1 165950000 166950000 +chr1 166000000 167000000 +chr1 166050000 167050000 +chr1 166100000 167100000 +chr1 166150000 167150000 +chr1 166200000 167200000 +chr1 166250000 167250000 +chr1 166300000 167300000 +chr1 166350000 167350000 +chr1 166400000 167400000 +chr1 166450000 167450000 +chr1 166500000 167500000 +chr1 166550000 167550000 +chr1 166600000 167600000 +chr1 166650000 167650000 +chr1 166700000 167700000 +chr1 166750000 167750000 +chr1 166800000 167800000 +chr1 166850000 167850000 +chr1 166900000 167900000 +chr1 166950000 167950000 +chr1 167000000 168000000 +chr1 167050000 168050000 +chr1 167100000 168100000 +chr1 167150000 168150000 +chr1 167200000 168200000 +chr1 167250000 168250000 +chr1 167300000 168300000 +chr1 167350000 168350000 +chr1 167400000 168400000 +chr1 167450000 168450000 +chr1 167500000 168500000 +chr1 167550000 168550000 +chr1 167600000 168600000 +chr1 167650000 168650000 +chr1 167700000 168700000 +chr1 167750000 168750000 +chr1 167800000 168800000 +chr1 167850000 168850000 +chr1 167900000 168900000 +chr1 167950000 168950000 +chr1 168000000 169000000 +chr1 168050000 169050000 +chr1 168100000 169100000 +chr1 168150000 169150000 +chr1 168200000 169200000 +chr1 168250000 169250000 +chr1 168300000 169300000 +chr1 168350000 169350000 +chr1 168400000 169400000 +chr1 168450000 169450000 +chr1 168500000 169500000 +chr1 168550000 169550000 +chr1 168600000 169600000 +chr1 168650000 169650000 +chr1 168700000 169700000 +chr1 168750000 169750000 +chr1 168800000 169800000 +chr1 168850000 169850000 +chr1 168900000 169900000 +chr1 168950000 169950000 +chr1 169000000 170000000 +chr1 169050000 170050000 +chr1 169100000 170100000 +chr1 169150000 170150000 +chr1 169200000 170200000 +chr1 169250000 170250000 +chr1 169300000 170300000 +chr1 169350000 170350000 +chr1 169400000 170400000 +chr1 169450000 170450000 +chr1 169500000 170500000 +chr1 169550000 170550000 +chr1 169600000 170600000 +chr1 169650000 170650000 +chr1 169700000 170700000 +chr1 169750000 170750000 +chr1 169800000 170800000 +chr1 169850000 170850000 +chr1 169900000 170900000 +chr1 169950000 170950000 +chr1 170000000 171000000 +chr1 170050000 171050000 +chr1 170100000 171100000 +chr1 170150000 171150000 +chr1 170200000 171200000 +chr1 170250000 171250000 +chr1 170300000 171300000 +chr1 170350000 171350000 +chr1 170400000 171400000 +chr1 170450000 171450000 +chr1 170500000 171500000 +chr1 170550000 171550000 +chr1 170600000 171600000 +chr1 170650000 171650000 +chr1 170700000 171700000 +chr1 170750000 171750000 +chr1 170800000 171800000 +chr1 170850000 171850000 +chr1 170900000 171900000 +chr1 170950000 171950000 +chr1 171000000 172000000 +chr1 171050000 172050000 +chr1 171100000 172100000 +chr1 171150000 172150000 +chr1 171200000 172200000 +chr1 171250000 172250000 +chr1 171300000 172300000 +chr1 171350000 172350000 +chr1 171400000 172400000 +chr1 171450000 172450000 +chr1 171500000 172500000 +chr1 171550000 172550000 +chr1 171600000 172600000 +chr1 171650000 172650000 +chr1 171700000 172700000 +chr1 171750000 172750000 +chr1 171800000 172800000 +chr1 171850000 172850000 +chr1 171900000 172900000 +chr1 171950000 172950000 +chr1 172000000 173000000 +chr1 172050000 173050000 +chr1 172100000 173100000 +chr1 172150000 173150000 +chr1 172200000 173200000 +chr1 172250000 173250000 +chr1 172300000 173300000 +chr1 172350000 173350000 +chr1 172400000 173400000 +chr1 172450000 173450000 +chr1 172500000 173500000 +chr1 172550000 173550000 +chr1 172600000 173600000 +chr1 172650000 173650000 +chr1 172700000 173700000 +chr1 172750000 173750000 +chr1 172800000 173800000 +chr1 172850000 173850000 +chr1 172900000 173900000 +chr1 172950000 173950000 +chr1 173000000 174000000 +chr1 173050000 174050000 +chr1 173100000 174100000 +chr1 173150000 174150000 +chr1 173200000 174200000 +chr1 173250000 174250000 +chr1 173300000 174300000 +chr1 173350000 174350000 +chr1 173400000 174400000 +chr1 173450000 174450000 +chr1 173500000 174500000 +chr1 173550000 174550000 +chr1 173600000 174600000 +chr1 173650000 174650000 +chr1 173700000 174700000 +chr1 173750000 174750000 +chr1 173800000 174800000 +chr1 173850000 174850000 +chr1 173900000 174900000 +chr1 173950000 174950000 +chr1 174000000 175000000 +chr1 174050000 175050000 +chr1 174100000 175100000 +chr1 174150000 175150000 +chr1 174200000 175200000 +chr1 174250000 175250000 +chr1 174300000 175300000 +chr1 174350000 175350000 +chr1 174400000 175400000 +chr1 174450000 175450000 +chr1 174500000 175500000 +chr1 174550000 175550000 +chr1 174600000 175600000 +chr1 174650000 175650000 +chr1 174700000 175700000 +chr1 174750000 175750000 +chr1 174800000 175800000 +chr1 174850000 175850000 +chr1 174900000 175900000 +chr1 174950000 175950000 +chr1 175000000 176000000 +chr1 175050000 176050000 +chr1 175100000 176100000 +chr1 175150000 176150000 +chr1 175200000 176200000 +chr1 175250000 176250000 +chr1 175300000 176300000 +chr1 175350000 176350000 +chr1 175400000 176400000 +chr1 175450000 176450000 +chr1 175500000 176500000 +chr1 175550000 176550000 +chr1 175600000 176600000 +chr1 175650000 176650000 +chr1 175700000 176700000 +chr1 175750000 176750000 +chr1 175800000 176800000 +chr1 175850000 176850000 +chr1 175900000 176900000 +chr1 175950000 176950000 +chr1 176000000 177000000 +chr1 176050000 177050000 +chr1 176100000 177100000 +chr1 176150000 177150000 +chr1 176200000 177200000 +chr1 176250000 177250000 +chr1 176300000 177300000 +chr1 176350000 177350000 +chr1 176400000 177400000 +chr1 176450000 177450000 +chr1 176500000 177500000 +chr1 176550000 177550000 +chr1 176600000 177600000 +chr1 176650000 177650000 +chr1 176700000 177700000 +chr1 176750000 177750000 +chr1 176800000 177800000 +chr1 176850000 177850000 +chr1 176900000 177900000 +chr1 176950000 177950000 +chr1 177000000 178000000 +chr1 177050000 178050000 +chr1 177100000 178100000 +chr1 177150000 178150000 +chr1 177200000 178200000 +chr1 177250000 178250000 +chr1 177300000 178300000 +chr1 177350000 178350000 +chr1 177400000 178400000 +chr1 177450000 178450000 +chr1 177500000 178500000 +chr1 177550000 178550000 +chr1 177600000 178600000 +chr1 177650000 178650000 +chr1 177700000 178700000 +chr1 177750000 178750000 +chr1 177800000 178800000 +chr1 177850000 178850000 +chr1 177900000 178900000 +chr1 177950000 178950000 +chr1 178000000 179000000 +chr1 178050000 179050000 +chr1 178100000 179100000 +chr1 178150000 179150000 +chr1 178200000 179200000 +chr1 178250000 179250000 +chr1 178300000 179300000 +chr1 178350000 179350000 +chr1 178400000 179400000 +chr1 178450000 179450000 +chr1 178500000 179500000 +chr1 178550000 179550000 +chr1 178600000 179600000 +chr1 178650000 179650000 +chr1 178700000 179700000 +chr1 178750000 179750000 +chr1 178800000 179800000 +chr1 178850000 179850000 +chr1 178900000 179900000 +chr1 178950000 179950000 +chr1 179000000 180000000 +chr1 179050000 180050000 +chr1 179100000 180100000 +chr1 179150000 180150000 +chr1 179200000 180200000 +chr1 179250000 180250000 +chr1 179300000 180300000 +chr1 179350000 180350000 +chr1 179400000 180400000 +chr1 179450000 180450000 +chr1 179500000 180500000 +chr1 179550000 180550000 +chr1 179600000 180600000 +chr1 179650000 180650000 +chr1 179700000 180700000 +chr1 179750000 180750000 +chr1 179800000 180800000 +chr1 179850000 180850000 +chr1 179900000 180900000 +chr1 179950000 180950000 +chr1 180000000 181000000 +chr1 180050000 181050000 +chr1 180100000 181100000 +chr1 180150000 181150000 +chr1 180200000 181200000 +chr1 180250000 181250000 +chr1 180300000 181300000 +chr1 180350000 181350000 +chr1 180400000 181400000 +chr1 180450000 181450000 +chr1 180500000 181500000 +chr1 180550000 181550000 +chr1 180600000 181600000 +chr1 180650000 181650000 +chr1 180700000 181700000 +chr1 180750000 181750000 +chr1 180800000 181800000 +chr1 180850000 181850000 +chr1 180900000 181900000 +chr1 180950000 181950000 +chr1 181000000 182000000 +chr1 181050000 182050000 +chr1 181100000 182100000 +chr1 181150000 182150000 +chr1 181200000 182200000 +chr1 181250000 182250000 +chr1 181300000 182300000 +chr1 181350000 182350000 +chr1 181400000 182400000 +chr1 181450000 182450000 +chr1 181500000 182500000 +chr1 181550000 182550000 +chr1 181600000 182600000 +chr1 181650000 182650000 +chr1 181700000 182700000 +chr1 181750000 182750000 +chr1 181800000 182800000 +chr1 181850000 182850000 +chr1 181900000 182900000 +chr1 181950000 182950000 +chr1 182000000 183000000 +chr1 182050000 183050000 +chr1 182100000 183100000 +chr1 182150000 183150000 +chr1 182200000 183200000 +chr1 182250000 183250000 +chr1 182300000 183300000 +chr1 182350000 183350000 +chr1 182400000 183400000 +chr1 182450000 183450000 +chr1 182500000 183500000 +chr1 182550000 183550000 +chr1 182600000 183600000 +chr1 182650000 183650000 +chr1 182700000 183700000 +chr1 182750000 183750000 +chr1 182800000 183800000 +chr1 182850000 183850000 +chr1 182900000 183900000 +chr1 182950000 183950000 +chr1 183000000 184000000 +chr1 183050000 184050000 +chr1 183100000 184100000 +chr1 183150000 184150000 +chr1 183200000 184200000 +chr1 183250000 184250000 +chr1 183300000 184300000 +chr1 183350000 184350000 +chr1 183400000 184400000 +chr1 183450000 184450000 +chr1 183500000 184500000 +chr1 183550000 184550000 +chr1 183600000 184600000 +chr1 183650000 184650000 +chr1 183700000 184700000 +chr1 183750000 184750000 +chr1 183800000 184800000 +chr1 183850000 184850000 +chr1 183900000 184900000 +chr1 183950000 184950000 +chr1 184000000 185000000 +chr1 184050000 185050000 +chr1 184100000 185100000 +chr1 184150000 185150000 +chr1 184200000 185200000 +chr1 184250000 185250000 +chr1 184300000 185300000 +chr1 184350000 185350000 +chr1 184400000 185400000 +chr1 184450000 185450000 +chr1 184500000 185500000 +chr1 184550000 185550000 +chr1 184600000 185600000 +chr1 184650000 185650000 +chr1 184700000 185700000 +chr1 184750000 185750000 +chr1 184800000 185800000 +chr1 184850000 185850000 +chr1 184900000 185900000 +chr1 184950000 185950000 +chr1 185000000 186000000 +chr1 185050000 186050000 +chr1 185100000 186100000 +chr1 185150000 186150000 +chr1 185200000 186200000 +chr1 185250000 186250000 +chr1 185300000 186300000 +chr1 185350000 186350000 +chr1 185400000 186400000 +chr1 185450000 186450000 +chr1 185500000 186500000 +chr1 185550000 186550000 +chr1 185600000 186600000 +chr1 185650000 186650000 +chr1 185700000 186700000 +chr1 185750000 186750000 +chr1 185800000 186800000 +chr1 185850000 186850000 +chr1 185900000 186900000 +chr1 185950000 186950000 +chr1 186000000 187000000 +chr1 186050000 187050000 +chr1 186100000 187100000 +chr1 186150000 187150000 +chr1 186200000 187200000 +chr1 186250000 187250000 +chr1 186300000 187300000 +chr1 186350000 187350000 +chr1 186400000 187400000 +chr1 186450000 187450000 +chr1 186500000 187500000 +chr1 186550000 187550000 +chr1 186600000 187600000 +chr1 186650000 187650000 +chr1 186700000 187700000 +chr1 186750000 187750000 +chr1 186800000 187800000 +chr1 186850000 187850000 +chr1 186900000 187900000 +chr1 186950000 187950000 +chr1 187000000 188000000 +chr1 187050000 188050000 +chr1 187100000 188100000 +chr1 187150000 188150000 +chr1 187200000 188200000 +chr1 187250000 188250000 +chr1 187300000 188300000 +chr1 187350000 188350000 +chr1 187400000 188400000 +chr1 187450000 188450000 +chr1 187500000 188500000 +chr1 187550000 188550000 +chr1 187600000 188600000 +chr1 187650000 188650000 +chr1 187700000 188700000 +chr1 187750000 188750000 +chr1 187800000 188800000 +chr1 187850000 188850000 +chr1 187900000 188900000 +chr1 187950000 188950000 +chr1 188000000 189000000 +chr1 188050000 189050000 +chr1 188100000 189100000 +chr1 188150000 189150000 +chr1 188200000 189200000 +chr1 188250000 189250000 +chr1 188300000 189300000 +chr1 188350000 189350000 +chr1 188400000 189400000 +chr1 188450000 189450000 +chr1 188500000 189500000 +chr1 188550000 189550000 +chr1 188600000 189600000 +chr1 188650000 189650000 +chr1 188700000 189700000 +chr1 188750000 189750000 +chr1 188800000 189800000 +chr1 188850000 189850000 +chr1 188900000 189900000 +chr1 188950000 189950000 +chr1 189000000 190000000 +chr1 189050000 190050000 +chr1 189100000 190100000 +chr1 189150000 190150000 +chr1 189200000 190200000 +chr1 189250000 190250000 +chr1 189300000 190300000 +chr1 189350000 190350000 +chr1 189400000 190400000 +chr1 189450000 190450000 +chr1 189500000 190500000 +chr1 189550000 190550000 +chr1 189600000 190600000 +chr1 189650000 190650000 +chr1 189700000 190700000 +chr1 189750000 190750000 +chr1 189800000 190800000 +chr1 189850000 190850000 +chr1 189900000 190900000 +chr1 189950000 190950000 +chr1 190000000 191000000 +chr1 190050000 191050000 +chr1 190100000 191100000 +chr1 190150000 191150000 +chr1 190200000 191200000 +chr1 190250000 191250000 +chr1 190300000 191300000 +chr1 190350000 191350000 +chr1 190400000 191400000 +chr1 190450000 191450000 +chr1 190500000 191500000 +chr1 190550000 191550000 +chr1 190600000 191600000 +chr1 190650000 191650000 +chr1 190700000 191700000 +chr1 190750000 191750000 +chr1 190800000 191800000 +chr1 190850000 191850000 +chr1 190900000 191900000 +chr1 190950000 191950000 +chr1 191000000 192000000 +chr1 191050000 192050000 +chr1 191100000 192100000 +chr1 191150000 192150000 +chr1 191200000 192200000 +chr1 191250000 192250000 +chr1 191300000 192300000 +chr1 191350000 192350000 +chr1 191400000 192400000 +chr1 191450000 192450000 +chr1 191500000 192500000 +chr1 191550000 192550000 +chr1 191600000 192600000 +chr1 191650000 192650000 +chr1 191700000 192700000 +chr1 191750000 192750000 +chr1 191800000 192800000 +chr1 191850000 192850000 +chr1 191900000 192900000 +chr1 191950000 192950000 +chr1 192000000 193000000 +chr1 192050000 193050000 +chr1 192100000 193100000 +chr1 192150000 193150000 +chr1 192200000 193200000 +chr1 192250000 193250000 +chr1 192300000 193300000 +chr1 192350000 193350000 +chr1 192400000 193400000 +chr1 192450000 193450000 +chr1 192500000 193500000 +chr1 192550000 193550000 +chr1 192600000 193600000 +chr1 192650000 193650000 +chr1 192700000 193700000 +chr1 192750000 193750000 +chr1 192800000 193800000 +chr1 192850000 193850000 +chr1 192900000 193900000 +chr1 192950000 193950000 +chr1 193000000 194000000 +chr1 193050000 194050000 +chr1 193100000 194100000 +chr1 193150000 194150000 +chr1 193200000 194200000 +chr1 193250000 194250000 +chr1 193300000 194300000 +chr1 193350000 194350000 +chr1 193400000 194400000 +chr1 193450000 194450000 +chr1 193500000 194500000 +chr1 193550000 194550000 +chr1 193600000 194600000 +chr1 193650000 194650000 +chr1 193700000 194700000 +chr1 193750000 194750000 +chr1 193800000 194800000 +chr1 193850000 194850000 +chr1 193900000 194900000 +chr1 193950000 194950000 +chr1 194000000 195000000 +chr1 194050000 195050000 +chr1 194100000 195100000 +chr1 194150000 195150000 +chr1 194200000 195200000 +chr1 194250000 195250000 +chr1 194300000 195300000 +chr1 194350000 195350000 +chr1 194400000 195400000 +chr1 194450000 195450000 +chr1 194500000 195500000 +chr1 194550000 195550000 +chr1 194600000 195600000 +chr1 194650000 195650000 +chr1 194700000 195700000 +chr1 194750000 195750000 +chr1 194800000 195800000 +chr1 194850000 195850000 +chr1 194900000 195900000 +chr1 194950000 195950000 +chr1 195000000 196000000 +chr1 195050000 196050000 +chr1 195100000 196100000 +chr1 195150000 196150000 +chr1 195200000 196200000 +chr1 195250000 196250000 +chr1 195300000 196300000 +chr1 195350000 196350000 +chr1 195400000 196400000 +chr1 195450000 196450000 +chr1 195500000 196500000 +chr1 195550000 196550000 +chr1 195600000 196600000 +chr1 195650000 196650000 +chr1 195700000 196700000 +chr1 195750000 196750000 +chr1 195800000 196800000 +chr1 195850000 196850000 +chr1 195900000 196900000 +chr1 195950000 196950000 +chr1 196000000 197000000 +chr1 196050000 197050000 +chr1 196100000 197100000 +chr1 196150000 197150000 +chr1 196200000 197195432 +chr1 196250000 197195432 +chr1 196300000 197195432 +chr1 196350000 197195432 +chr1 196400000 197195432 +chr1 196450000 197195432 +chr1 196500000 197195432 +chr1 196550000 197195432 +chr1 196600000 197195432 +chr1 196650000 197195432 +chr1 196700000 197195432 +chr1 196750000 197195432 +chr1 196800000 197195432 +chr1 196850000 197195432 +chr1 196900000 197195432 +chr1 196950000 197195432 +chr1 197000000 197195432 +chr1 197050000 197195432 +chr1 197100000 197195432 +chr1 197150000 197195432
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/makeWindowBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,100 @@ +chr1 0 1971955 +chr1 1971955 3943910 +chr1 3943910 5915865 +chr1 5915865 7887820 +chr1 7887820 9859775 +chr1 9859775 11831730 +chr1 11831730 13803685 +chr1 13803685 15775640 +chr1 15775640 17747595 +chr1 17747595 19719550 +chr1 19719550 21691505 +chr1 21691505 23663460 +chr1 23663460 25635415 +chr1 25635415 27607370 +chr1 27607370 29579325 +chr1 29579325 31551280 +chr1 31551280 33523235 +chr1 33523235 35495190 +chr1 35495190 37467145 +chr1 37467145 39439100 +chr1 39439100 41411055 +chr1 41411055 43383010 +chr1 43383010 45354965 +chr1 45354965 47326920 +chr1 47326920 49298875 +chr1 49298875 51270830 +chr1 51270830 53242785 +chr1 53242785 55214740 +chr1 55214740 57186695 +chr1 57186695 59158650 +chr1 59158650 61130605 +chr1 61130605 63102560 +chr1 63102560 65074515 +chr1 65074515 67046470 +chr1 67046470 69018425 +chr1 69018425 70990380 +chr1 70990380 72962335 +chr1 72962335 74934290 +chr1 74934290 76906245 +chr1 76906245 78878200 +chr1 78878200 80850155 +chr1 80850155 82822110 +chr1 82822110 84794065 +chr1 84794065 86766020 +chr1 86766020 88737975 +chr1 88737975 90709930 +chr1 90709930 92681885 +chr1 92681885 94653840 +chr1 94653840 96625795 +chr1 96625795 98597750 +chr1 98597750 100569705 +chr1 100569705 102541660 +chr1 102541660 104513615 +chr1 104513615 106485570 +chr1 106485570 108457525 +chr1 108457525 110429480 +chr1 110429480 112401435 +chr1 112401435 114373390 +chr1 114373390 116345345 +chr1 116345345 118317300 +chr1 118317300 120289255 +chr1 120289255 122261210 +chr1 122261210 124233165 +chr1 124233165 126205120 +chr1 126205120 128177075 +chr1 128177075 130149030 +chr1 130149030 132120985 +chr1 132120985 134092940 +chr1 134092940 136064895 +chr1 136064895 138036850 +chr1 138036850 140008805 +chr1 140008805 141980760 +chr1 141980760 143952715 +chr1 143952715 145924670 +chr1 145924670 147896625 +chr1 147896625 149868580 +chr1 149868580 151840535 +chr1 151840535 153812490 +chr1 153812490 155784445 +chr1 155784445 157756400 +chr1 157756400 159728355 +chr1 159728355 161700310 +chr1 161700310 163672265 +chr1 163672265 165644220 +chr1 165644220 167616175 +chr1 167616175 169588130 +chr1 169588130 171560085 +chr1 171560085 173532040 +chr1 173532040 175503995 +chr1 175503995 177475950 +chr1 177475950 179447905 +chr1 179447905 181419860 +chr1 181419860 183391815 +chr1 183391815 185363770 +chr1 185363770 187335725 +chr1 187335725 189307680 +chr1 189307680 191279635 +chr1 191279635 193251590 +chr1 193251590 195223545 +chr1 195223545 197195432
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/makeWindowBed_result4.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,45 @@ +chr5 60000 60667 +chr5 60667 61334 +chr5 61334 62001 +chr5 62001 62668 +chr5 62668 63335 +chr5 63335 64002 +chr5 64002 64669 +chr5 64669 65336 +chr5 65336 66003 +chr5 66003 66670 +chr5 66670 67337 +chr5 67337 68004 +chr5 68004 68671 +chr5 68671 69338 +chr5 69338 70000 +chr5 73000 74134 +chr5 74134 75268 +chr5 75268 76402 +chr5 76402 77536 +chr5 77536 78670 +chr5 78670 79804 +chr5 79804 80938 +chr5 80938 82072 +chr5 82072 83206 +chr5 83206 84340 +chr5 84340 85474 +chr5 85474 86608 +chr5 86608 87742 +chr5 87742 88876 +chr5 88876 90000 +chr5 100000 100067 +chr5 100067 100134 +chr5 100134 100201 +chr5 100201 100268 +chr5 100268 100335 +chr5 100335 100402 +chr5 100402 100469 +chr5 100469 100536 +chr5 100536 100603 +chr5 100603 100670 +chr5 100670 100737 +chr5 100737 100804 +chr5 100804 100871 +chr5 100871 100938 +chr5 100938 101000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mapBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 a1 1 + +chr1 50 60 a2 2 - +chr1 80 90 a3 3 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mapBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,5 @@ +chr1 12 14 b1 2 + +chr1 13 15 b2 5 - +chr1 16 18 b3 5 + +chr1 82 85 b4 2 - +chr1 85 87 b5 3 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mapBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 a1 1 + 4 +chr1 50 60 a2 2 - . +chr1 80 90 a3 3 - 2.5
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mapBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 a1 1 + 2,5,5 +chr1 50 60 a2 2 - . +chr1 80 90 a3 3 - 2,3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mapBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 a1 1 + 5 +chr1 50 60 a2 2 - . +chr1 80 90 a3 3 - 3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mapBed_result4.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 a1 1 + 2,5 +chr1 50 60 a2 2 - . +chr1 80 90 a3 3 - 2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/maskFastaBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,6 @@ +>chr1 +GACTCATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN +NNNNNNNNNNNNNNNNNNNNAAACAAGTACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGCGTTTATGTTGGTTTCA +TGGTTTTGTCTAACTTTATCGCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCGGCTTGTTTACGAATTAAATCGAAG +TGGACTGCTGGCGTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTTTTCTCACTTCTGTTACTCCAGCTTCTTCGGCA +CCTGTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/maskFastaBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,6 @@ +>chr1 +GACTCATGATttcttacctattagtggttgaacatcgtgatatgtatgttgacggccataaggctgcttcttgttgtcga +tagaacttcatgtgcctgtaAAACAAGTACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGCGTTTATGTTGGTTTCA +TGGTTTTGTCTAACTTTATCGCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCGGCTTGTTTACGAATTAAATCGAAG +TGGACTGCTGGCGTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTTTTCTCACTTCTGTTACTCCAGCTTCTTCGGCA +CCTGTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 100 200 +chr1 180 250 +chr1 250 500 +chr1 501 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 100 200 a1 1 + +chr1 180 250 a2 2 + +chr1 250 500 a3 3 - +chr1 501 1000 a4 4 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 100 200 +chr1 180 250 +chr1 250 500 +chr1 501 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed4.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 200 +chr1 501 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed_result.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 100 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 500 +chr1 501 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 500 +chr1 501 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 500 +chr1 501 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mergedBed_result4.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 100 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mm9.len Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,36 @@ +chr1 197195432 +chr2 181748087 +chr3 159599783 +chr4 155630120 +chr5 152537259 +chr6 149517037 +chr7 152524553 +chr8 131738871 +chr9 124076172 +chr10 129993255 +chr11 121843856 +chr12 121257530 +chr13 120284312 +chr14 125194864 +chr15 103494974 +chr16 98319150 +chr17 95272651 +chr18 90772031 +chr19 61342430 +chrX 166650296 +chrY 15902555 +chrM 16299 +chr13_random 400311 +chr16_random 3994 +chr17_random 628739 +chr1_random 1231697 +chr3_random 41899 +chr4_random 160594 +chr5_random 357350 +chr7_random 362490 +chr8_random 849593 +chr9_random 449403 +chrUn_random 5900358 +chrX_random 1785075 +chrY_random 58682461 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mm9_chr1.len Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 197195432
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiCov1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +dummy_chr 1 100 +dummy_chr 1000 1000000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiCovBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +dummy_chr 1 100 0 0 +dummy_chr 1000 1000000 2 2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiIntersectBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 6 12 +chr1 10 20 +chr1 22 27 +chr1 24 30
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiIntersectBed1.len Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 5000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiIntersectBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 12 32 +chr1 14 30
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiIntersectBed3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 8 15 +chr1 10 14 +chr1 32 34
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiIntersectBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,8 @@ +chr1 6 8 1 1 1 0 0 +chr1 8 12 2 1,3 1 0 1 +chr1 12 15 3 1,2,3 1 1 1 +chr1 15 20 2 1,2 1 1 0 +chr1 20 22 1 2 0 1 0 +chr1 22 30 2 1,2 1 1 0 +chr1 30 32 1 2 0 1 0 +chr1 32 34 1 3 0 0 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiIntersectBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,9 @@ +chrom start end num list /tmp/tmpTVZ0hffiles/000/dataset_5.dat /tmp/tmpTVZ0hffiles/000/dataset_6.dat /tmp/tmpTVZ0hffiles/000/dataset_7.dat +chr1 6 8 1 1 1 0 0 +chr1 8 12 2 1,3 1 0 1 +chr1 12 15 3 1,2,3 1 1 1 +chr1 15 20 2 1,2 1 1 0 +chr1 20 22 1 2 0 1 0 +chr1 22 30 2 1,2 1 1 0 +chr1 30 32 1 2 0 1 0 +chr1 32 34 1 3 0 0 1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/multiIntersectBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,10 @@ +chr1 0 6 0 none 0 0 0 +chr1 6 8 1 1 1 0 0 +chr1 8 12 2 1,3 1 0 1 +chr1 12 15 3 1,2,3 1 1 1 +chr1 15 20 2 1,2 1 1 0 +chr1 20 22 1 2 0 1 0 +chr1 22 30 2 1,2 1 1 0 +chr1 30 32 1 2 0 1 0 +chr1 32 34 1 3 0 0 1 +chr1 34 5000 0 none 0 0 0
--- a/test-data/mygenome.bed Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -chr1 1000 -chr2 800
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nucBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 10 100
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nucBed1.fasta Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,6 @@ +>chr1 +GACTCATGATTTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGA +TAGAACTTCATGTGCCTGTAAAACAAGTACCAACCAGAACGTGAAAAAGCGTCCTGCGTGTAGCGTTTATGTTGGTTTCA +TGGTTTTGTCTAACTTTATCGCTTTACCGTCTTTCCAGAAATTGTTCCAAGTATCGGCTTGTTTACGAATTAAATCGAAG +TGGACTGCTGGCGTTATAACGCCGAAGCGGTAAAAATTTTTATTTTTTTTCTCACTTCTGTTACTCCAGCTTCTTCGGCA +CCTGTGGCCTGTTGATTCTAAAGGTTAGTTTCTTCACGC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nucBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +#1_usercol 2_usercol 3_usercol 4_pct_at 5_pct_gc 6_num_A 7_num_C 8_num_G 9_num_T 10_num_N 11_num_oth 12_seq_len +chr1 10 100 0.588889 0.411111 19 16 21 34 0 0 90
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nucBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +#1_usercol 2_usercol 3_usercol 4_pct_at 5_pct_gc 6_num_A 7_num_C 8_num_G 9_num_T 10_num_N 11_num_oth 12_seq_len 13_seq +chr1 10 100 0.588889 0.411111 19 16 21 34 0 0 90 TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/overlapBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 100 200 chr1 500 1000 -300
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/randomBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 115594142 115594147 1 5 + +chr1 167415497 167415502 2 5 - +chr1 191692404 191692409 3 5 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reldistBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +reldist count total fraction +0.00 1 1 1.000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shuffleBed.len Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 10000 +chr2 8000 +chr3 5000 +chr4 2000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shuffleBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 0 100 a1 1 + +chr1 0 1000 a2 2 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shuffleBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 0 100
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shuffleBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr2 5070 5170 a1 1 + +chr1 2199 3199 a2 2 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shuffleBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 9383 9483 a1 1 + +chr1 886 1886 a2 2 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shuffleBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr2 5070 5170 a1 1 + +chr1 2199 3199 a2 2 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shuffleBed_result4.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr2 5070 5170 a1 1 + +chr3 4411 5000 a2 2 -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slopBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 95 205 +chr1 175 255 +chr1 245 505 +chr1 496 1005
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slopBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 98 203 +chr1 178 253 +chr1 248 503 +chr1 499 1003
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sortBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 800 1000 +chr1 80 180 +chr1 1 10 +chr1 750 10000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sortBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,4 @@ +chr1 1 10 +chr1 80 180 +chr1 750 10000 +chr1 800 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/subtractBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 +chr1 100 200 +chr1 301 400
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/subtractBed2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 0 30 +chr1 180 300
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/subtractBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 180 +chr1 301 400
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/subtractBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 200 +chr1 301 400
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/subtractBed_result3.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 301 400
--- a/test-data/t Tue Nov 04 01:45:04 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ -chr1 100 200 nasty 1 - -chr2 500 1000 ugly 2 + -chr3 1000 5000 big 3 - -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tagBed1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,3 @@ +dummy_chr 1100 1479 foo +dummy_chr 120882 127882 bar +dummy_chr 5590013 5596013 42
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs1.bg Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 1000 1500 10 +chr1 2000 2100 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs1.len Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 5000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs2.bg Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 900 1600 60 +chr1 1700 2050 50
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs3.bg Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 1980 2070 80 +chr1 2090 2100 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs_result1.bg Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,5 @@ +chr1 1000 1500 10 N/A N/A +chr1 1980 2000 N/A N/A 80 +chr1 2000 2070 20 N/A 80 +chr1 2070 2090 20 N/A N/A +chr1 2090 2100 20 N/A 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs_result2.bg Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,6 @@ +chrom start end +chr1 1000 1500 10 N/A N/A +chr1 1980 2000 N/A N/A 80 +chr1 2000 2070 20 N/A 80 +chr1 2070 2090 20 N/A N/A +chr1 2090 2100 20 N/A 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs_result3.bg Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,8 @@ +chr1 0 1000 N/A N/A N/A +chr1 1000 1500 10 N/A N/A +chr1 1500 1980 N/A N/A N/A +chr1 1980 2000 N/A N/A 80 +chr1 2000 2070 20 N/A 80 +chr1 2070 2090 20 N/A N/A +chr1 2090 2100 20 N/A 20 +chr1 2100 5000 N/A N/A N/A
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/unionBedGraphs_result4.bg Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,8 @@ +chr1 0 1000 N/A N/A N/A +chr1 1000 1500 10 N/A N/A +chr1 1500 1980 N/A N/A N/A +chr1 1980 2000 N/A N/A 80 +chr1 2000 2070 20 N/A 80 +chr1 2070 2090 20 N/A N/A +chr1 2090 2100 20 N/A 20 +chr1 2100 5000 N/A N/A N/A
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/windowBed_result1.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,1 @@ +chr1 100 200 chr1 500 1000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/windowBed_result2.bed Thu Jan 08 14:25:51 2015 -0500 @@ -0,0 +1,2 @@ +chr1 100 200 chr1 500 1000 +chr1 100 200 chr1 1300 2000
--- a/tool_dependencies.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/tool_dependencies.xml Thu Jan 08 14:25:51 2015 -0500 @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> - <package name="bedtools" version="2.19.1"> - <repository changeset_revision="fb3a854c7104" name="package_bedtools_2_19" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + <package name="bedtools" version="2.22"> + <repository changeset_revision="960f83563956" name="package_bedtools_2_22" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency>
--- a/unionBedGraphs.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/unionBedGraphs.xml Thu Jan 08 14:25:51 2015 -0500 @@ -1,106 +1,106 @@ -<tool id="bedtools_mergebedgraph" name="Merge BedGraph files" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_unionbedgraph" name="Merge BedGraph files" version="@WRAPPER_VERSION@.0"> <description></description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements" /> <expand macro="stdio" /> - <command>unionBedGraphs + <command> +<![CDATA[ + unionBedGraphs $header - -filler '$filler' + -filler "${filler}" #if $zero.value == True: -empty - -g ${chromInfo} - #end if - - -i '$input1' - '$input2' - #for $q in $bedgraphs - '${q.input}' - #end for - - -names - #if $name1.choice == "tag": - '${input1.name}' - #else - '${name1.custom_name}' + -g $genome #end if - #if $name2.choice == "tag": - '${input2.name}' - #else - '${name2.custom_name}' + #if str($tag.tag_select) == "tag": + #set files = '" "'.join( [ str( $file ) for $file in $tag.inputs ] ) + -i "${files}" + #else: + -i + #for $bg in $tag.bedgraphs: + "${bg.input}" + #end for + -names + #for $bg in $tag.bedgraphs: + "${bg.custom_name}" + #end for #end if - - #for $q in $bedgraphs - #if $q.name.choice == "tag": - '${q.input.name}' - #else - '${q.input.custom_name}' - #end if - #end for - > '$output' + > "${output}" +]]> </command> <inputs> - <!-- Make it easy for the user, first two input files are always shown --> - <!-- INPUT 1 --> - <param name="input1" format="bedgraph" type="data" label="First BedGraph file" /> - - <conditional name="name1"> - <param name="choice" type="select" label="Sample name"> + <conditional name="tag"> + <param name="tag_select" type="select" label="Sample name"> <option value="tag" selected="true">Use input's tag</option> - <option value="custom">Enter custom table name</option> + <option value="custom">Enter custom name per file</option> </param> <when value="tag"> + <param name="inputs" format="bedgraph" type="data" multiple="True" label="BedGraph files" /> </when> <when value="custom"> - <param name="custom_name" type="text" area="false" label="Custom sample name"/> - </when> - </conditional> - - <!-- INPUT 2 --> - <param name="input2" format="bedgraph" type="data" label="Second BedGraph file" /> - - <conditional name="name2"> - <param name="choice" type="select" label="Sample name"> - <option value="tag" selected="true">Use input's tag</option> - <option value="custom">Enter custom table name</option> - </param> - <when value="tag"> - </when> - <when value="custom"> - <param name="custom_name" type="text" area="false" label="Custom sample name"/> + <repeat name="bedgraphs" title="Add BedGraph files" min="2" > + <param name="input" format="bedgraph" type="data" multiple="True" label="BedGraph file" /> + <param name="custom_name" type="text" area="false" label="Custom sample name"/> + </repeat> </when> </conditional> - - <!-- Additional files, if the user needs more --> - <repeat name="bedgraphs" title="Add'l BedGraph files" > - <param name="input" format="bedgraph" type="data" label="BedGraph file" /> - <conditional name="name"> - <param name="choice" type="select" label="Sample name"> - <option value="tag" selected="true">Use input's tag</option> - <option value="custom">Enter custom table name</option> - </param> - <when value="tag"> - </when> - <when value="custom"> - <param name="custom_name" type="text" area="false" label="Custom sample name"/> - </when> - </conditional> - </repeat> - - <param name="header" type="boolean" checked="true" truevalue="-header" falsevalue="" label="Print header line" help="The first line will include the name of each sample." /> - - <param name="zero" type="boolean" checked="true" label="Report regions with zero coverage" help="If set, regions without any coverage will also be reported. Requires a valid organism key for all input datasets" /> - - <param name="filler" type="text" value="0" label="Text to use for no-coverage value" help="Can be 0.0, N/A, - or any other value." /> + <expand macro="genome" /> + <param name="zero" type="boolean" checked="true" + label="Report regions with zero coverage" + help="If set, regions without any coverage will also be reported. Requires a valid organism key for all input datasets" /> + <param name="filler" type="text" value="N/A" + label="Text to use for no-coverage value" + help="Can be 0.0, N/A, - or any other value. (-filler)" /> + <expand macro="print_header" /> </inputs> - <outputs> - <data format="tabular" name="output" metadata_source="input1" label="Merged BedGraphs of ${input1.name}, ${input2.name} and so on." /> + <data name="output" format="bedgraph" /> </outputs> + <tests> + <test> + <param name="tag_select" value="tag"/> + <param name="inputs" value="unionBedGraphs1.bg,unionBedGraphs2.bg,unionBedGraphs3.bg" ftype="bedgraph" /> + <param name="zero" value="False"/> + <output name="output" file="unionBedGraphs_result1.bg" ftype="bedgraph" /> + </test> + <test> + <param name="tag_select" value="tag"/> + <param name="inputs" value="unionBedGraphs1.bg,unionBedGraphs2.bg,unionBedGraphs3.bg" ftype="bedgraph" /> + <param name="header" value="True"/> + <param name="zero" value="False"/> + <output name="output" file="unionBedGraphs_result2.bg" ftype="bedgraph" /> + </test> + <test> + <param name="tag_select" value="tag"/> + <param name="inputs" value="unionBedGraphs1.bg,unionBedGraphs2.bg,unionBedGraphs3.bg" ftype="bedgraph" /> + <param name="zero" value="True"/> + <param name="genome" value="unionBedGraphs1.len"/> + <output name="output" file="unionBedGraphs_result3.bg" ftype="bedgraph" /> + </test> + <test> + <param name="tag_select" value="custom"/> + <repeat name="bedgraphs"> + <param name="input" value="unionBedGraphs1.bg" /> + <param name="custom_name" value="first" /> + </repeat> + <repeat name="bedgraphs"> + <param name="input" value="unionBedGraphs2.bg" /> + <param name="custom_name" value="second" /> + </repeat> + <repeat name="bedgraphs"> + <param name="input" value="unionBedGraphs3.bg" /> + <param name="custom_name" value="third" /> + </repeat> + <param name="zero" value="True"/> + <param name="genome" value="unionBedGraphs1.len"/> + <output name="output" file="unionBedGraphs_result4.bg" ftype="bedgraph" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool merges multiple BedGraph files, allowing direct and fine-scale coverage comparisons among many samples/files. The BedGraph files need not represent the same intervals; the tool will identify both common and file-specific intervals. In addition, the BedGraph values need not be numeric: one can use any text as the BedGraph value and the tool will compare the values from multiple files. @@ -226,7 +226,7 @@ chr1 600 700 0 0.43 @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/windowBed.xml Tue Nov 04 01:45:04 2014 -0500 +++ b/windowBed.xml Thu Jan 08 14:25:51 2015 -0500 @@ -6,6 +6,7 @@ <expand macro="requirements" /> <expand macro="stdio" /> <command> +<![CDATA[ bedtools window #if $inputA.ext == "bam": -abam $inputA @@ -13,38 +14,42 @@ -a $inputA #end if -b $inputB - $ubam $bed $strandB - #if $addition.addition_select == 'b': - -w $addition.b + #if $addition.addition_select == 'window': + -w $addition.w #elif $addition.addition_select == 'lr': - -l $addition.l - -r $addition.r + -l $addition.l + -r $addition.r #end if $original $number $nooverlaps $header - > $output + > $output +]]> </command> <inputs> <param format="bed,bam,vcf,gff,gff3" name="inputA" type="data" label="BED/VCF/GFF/BAM file"/> <param format="bed,gff,vcf,gff3" name="inputB" type="data" label="BED/VCF/GFF file"/> - <param name="ubam" type="boolean" checked="false" truevalue="-ubam" falsevalue="" label="Write uncompressed BAM output" /> - <param name="bed" type="boolean" checked="false" truevalue="bed" falsevalue="" label="When using BAM input, write output as BED. The default is to write output in BAM when using a bam file" /> + <param name="bed" type="boolean" checked="false" truevalue="-bed" falsevalue="" + label="When using BAM input, write output as BED. The default is to write output in BAM when using a bam file" + help="(-bed)" /> <conditional name="addition"> <param name="addition_select" type="select" label="Choose what you want to do"> - <option value="huhn" selected="True">Do not change added base pairs</option> - <option value="b">Add Base pairs for **both** upstream and downstream of each entry in A when searching for overlaps in B</option> + <option value="window">Add Base pairs for **both** upstream and downstream of each entry in A when searching for overlaps in B</option> <option value="lr">Add Base pairs **separately** for upstream and downstream of each entry in A when searching for overlaps in B</option> </param> - <when value="b"> - <param name="b" label="Give Value" type="integer" value="1000" /> + <when value="window"> + <param name="w" type="integer" value="1000" label="Base pairs to add upstream and downstream" /> </when> <when value="lr"> - <param name="l" label="Base pairs added upstream (left of) of each entry in A when searching for overlaps in B. Allows one to create assymetrical “windows”. Default is 1000bp" type="integer" value="1000" /> - <param name="r" label="Base pairs added downstream (right of) of each entry in A when searching for overlaps in B. Allows one to create assymetrical “windows”. Default is 1000bp" type="integer" value="1000" /> + <param name="l" type="integer" value="1000" + label="Base pairs added upstream (left) of each entry in A when searching for overlaps in B" + help="Allows one to create assymetrical “windows”. Default is 1000bp. (-l)" /> + <param name="r" type="integer" value="1000" + label="Base pairs added downstream (right) of each entry in A when searching for overlaps in B" + help="Allows one to create assymetrical “windows”. Default is 1000bp. (-r)" /> </when> </conditional> <param name="strandB" type="select" label="Calculation based on strandedness?"> @@ -52,17 +57,43 @@ <option value="-sm">Only report hits in B that overlap A on the **same** strand</option> <option value="-Sm">Only report hits in B that overlap A on the **opposite** strand</option> </param> - <param name="original" type="boolean" checked="false" truevalue="-u" falsevalue="" label="Write original A entry once if any overlaps found in B. In other words, just report the fact at least one overlap was found in B" /> - <param name="number" type="boolean" checked="false" truevalue="-c" falsevalue="" label="For each entry in A, report the number of hits in B while restricting to -f. Reports 0 for A entries that have no overlap with B" /> - <param name="nooverlaps" type="boolean" checked="false" truevalue="-v" falsevalue="" label="Only report those entries in A that have no overlaps with B" /> - <param name="header" type="boolean" checked="false" truevalue="-header" falsevalue="" label="Print the header from the A file prior to results" /> - + <param name="original" type="boolean" checked="false" truevalue="-u" falsevalue="" + label="Write original A entry once if any overlaps found in B" + help="In other words, just report the fact at least one overlap was found in B. (-u)" /> + <param name="number" type="boolean" checked="false" truevalue="-c" falsevalue="" + label="For each entry in A, report the number of hits in B" + help="Reports 0 for A entries that have no overlap with B (-c)" /> + <param name="nooverlaps" type="boolean" checked="false" truevalue="-v" falsevalue="" + label="Only report those entries in A that have no overlaps with B" help="(-v)" /> + <expand macro="print_header" /> </inputs> <outputs> <data format_source="inputA" name="output" metadata_source="inputA" label=""/> </outputs> + <tests> + <test> + <param name="inputA" value="windowBedA.bed" ftype="bed" /> + <param name="inputB" value="windowBedB.bed" ftype="bed" /> + <output name="output" file="windowBed_result1.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="windowBedA.bed" ftype="bed" /> + <param name="inputB" value="windowBedB.bed" ftype="bed" /> + <param name="addition_select" value="window" /> + <param name="w" value="5000" /> + <output name="output" file="windowBed_result2.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="windowBedA.bed" ftype="bed" /> + <param name="inputB" value="windowBedB.bed" ftype="bed" /> + <param name="addition_select" value="lr" /> + <param name="l" value="200" /> + <param name="r" value="20000" /> + <output name="output" file="windowBed_result2.bed" ftype="bed" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Similar to bedtools intersect, window searches for overlapping features in A and B. However, window adds a specified number (1000, by default) of base pairs upstream and downstream of each feature in A. In effect, this allows features in B that are “near” features in A to be detected. @@ -70,6 +101,7 @@ .. image:: $PATH_TO_IMAGES/window-glyph.png @REFERENCES@ +]]> </help> <expand macro="citations" /> </tool>