Mercurial > repos > iuc > bedtools

changeset 42:841fb4dc3ab3 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bedtools commit 4046c1da68a09c7a3c275f6fe890ec71470fd74d"
author iuc
date Wed, 12 Jan 2022 19:22:14 +0000
parents 7ab85ac5f64b
children 07e8b80f278c
files getfastaBed.xml test-data/getfastaBed_result3.bed test-data/getfastaBed_result4.bed test-data/nucBed2.bed
diffstat 4 files changed, 27 insertions(+), 1 deletions(-) [+]
line wrap: on
line diff
--- a/getfastaBed.xml	Thu Nov 04 11:36:55 2021 +0000
+++ b/getfastaBed.xml	Wed Jan 12 19:22:14 2022 +0000
@@ -1,4 +1,4 @@
-<tool id="bedtools_getfastabed" name="bedtools GetFastaBed" version="@TOOL_VERSION@" profile="@PROFILE@">
+<tool id="bedtools_getfastabed" name="bedtools getfasta" version="@TOOL_VERSION@+galaxy1" profile="@PROFILE@">
     <description>use intervals to extract sequences from a FASTA file</description>
     <macros>
         <import>macros.xml</import>
@@ -16,6 +16,7 @@
 ln -s '$fasta_file' 'input.fasta' &&
 bedtools getfasta
 $name
+$nameOnly
 $tab
 $strand
 $split
@@ -40,6 +41,8 @@
             </when>
         </conditional>
         <param argument="-name" type="boolean" truevalue="-name" falsevalue="" checked="false"
+            label="Use the 'name' column in the BED file and the coordinates for the FASTA headers in the output FASTA file" />
+        <param argument="-nameOnly" type="boolean" truevalue="-nameOnly" falsevalue="" checked="false"
             label="Use the 'name' column in the BED file for the FASTA headers in the output FASTA file" />
         <param argument="-tab" type="boolean" truevalue="-tab" falsevalue="" checked="false"
             label="Report extract sequences in a tab-delimited format instead of in FASTA format" />
@@ -61,6 +64,7 @@
             <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
             <param name="tab" value="False" />
             <param name="split" value="False" />
+            <param name="nameOnly" value="False" />
             <output name="output" file="getfastaBed_result1.bed" ftype="fasta" />
         </test>
         <test>
@@ -68,8 +72,25 @@
             <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
             <param name="tab" value="True" />
             <param name="split" value="False" />
+            <param name="nameOnly" value="False" />
             <output name="output" file="getfastaBed_result2.tabular" ftype="tabular" />
         </test>
+        <test>
+            <param name="input" value="nucBed1.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <param name="tab" value="False" />
+            <param name="split" value="False" />
+            <param name="name" value="True" />
+            <output name="output" file="getfastaBed_result3.bed" ftype="fasta" />
+        </test>
+        <test>
+            <param name="input" value="nucBed2.bed" ftype="bed" />
+            <param name="fasta" value="nucBed1.fasta" ftype="fasta" />
+            <param name="tab" value="False" />
+            <param name="split" value="False" />
+            <param name="nameOnly" value="True" />
+            <output name="output" file="getfastaBed_result4.bed" ftype="fasta" />
+        </test>
     </tests>
     <help><![CDATA[
 **What it does**
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/getfastaBed_result3.bed	Wed Jan 12 19:22:14 2022 +0000
@@ -0,0 +1,2 @@
+>::chr1:10-100
+TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/getfastaBed_result4.bed	Wed Jan 12 19:22:14 2022 +0000
@@ -0,0 +1,2 @@
+>chr1
+TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nucBed2.bed	Wed Jan 12 19:22:14 2022 +0000
@@ -0,0 +1,1 @@
+chr1	10	100	chr1