Mercurial > repos > iuc > bp_genbank2gff3

diff test-data/seq.gb.0.gff @ 3:19c318403f13 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bioperl commit 0ddf7187a84073a5e01170106e6c1cbab18d23e5
author iuc
date Sat, 19 Aug 2017 08:44:34 -0400
parents f79bcd53b9a3
children 11c3eb512633
line wrap: on
line diff
--- a/test-data/seq.gb.0.gff	Thu Apr 21 14:04:02 2016 -0400
+++ b/test-data/seq.gb.0.gff	Sat Aug 19 08:44:34 2017 -0400
@@ -1,10 +1,12 @@
+# Input: /tmp/tmp1YCbBQ/files/000/dataset_1.dat
 ##gff-version 3
 ##sequence-region NC_014662 1 165540
 # conversion-by bp_genbank2gff3.pl
 # organism Enterobacteria phage CC31
 # Note Enterobacteria phage CC31, complete genome.
 # date 12-NOV-2010
-NC_014662	GenBank	region	1	165540	.	+	1	ID=NC_014662;Dbxref=BioProject:PRJNA60119,taxon:709484;Name=NC_014662;Note=Enterobacteria phage CC31%2C complete genome.,PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;comment1=PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;date=12-NOV-2010;host=Escherichia coli;mol_type=genomic DNA;organism=Enterobacteria phage CC31
+# working on contig:NC_014662, Enterobacteria phage CC31, Enterobacteria phage CC31, complete genome., 12-NOV-2010
+NC_014662	GenBank	contig	1	165540	.	+	1	ID=NC_014662;Dbxref=BioProject:PRJNA60119,taxon:709484;Name=NC_014662;Note=Enterobacteria phage CC31%2C complete genome.,PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;comment1=PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;date=12-NOV-2010;host=Escherichia coli;mol_type=genomic DNA;organism=Enterobacteria phage CC31
 NC_014662	GenBank	gene	1	2214	.	-	1	ID=CC31p001;Dbxref=GeneID:9926434;Name=rIIA;locus_tag=CC31p001
 NC_014662	GenBank	mRNA	1	2214	.	-	1	ID=CC31p001.t01;Parent=CC31p001
 NC_014662	GenBank	CDS	1	2214	.	-	1	ID=CC31p001.p01;Parent=CC31p001.t01;Dbxref=GI:311992993,GeneID:9926434;Name=rIIA;codon_start=1;locus_tag=CC31p001;product=membrane-associated affects host membrane ATPase;protein_id=YP_004009859.1;transl_table=11;translation=length.737
@@ -1145,6 +1147,7 @@
 NC_014662	GenBank	mRNA	164610	165521	.	-	1	ID=CC31p279.t01;Parent=CC31p279
 NC_014662	GenBank	CDS	164610	165521	.	-	1	ID=CC31p279.p01;Parent=CC31p279.t01;Dbxref=GI:311993271,GeneID:9926433;Name=rIIB;codon_start=1;locus_tag=CC31p279;product=protector from prophage-induced early lysis;protein_id=YP_004010137.1;transl_table=11;translation=length.303
 NC_014662	GenBank	exon	164610	165521	.	-	1	Parent=CC31p279.t01
+# GFF3 saved to stdout2829
 ##FASTA
 >NC_014662
 TTACTCATCTTCATCTTTACCTTTTAAGGAAGGAGCGCTTTCCAGCGCTCTCATAATACG