# HG changeset patch
# User iuc
# Date 1592170625 14400
# Node ID a618f28e14964022c38483cc1d73459a24e31000
# Parent  7ec1d063fecd8fe6b794cff75345af4719d809fc
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/chira commit 51f68a6d51d9e87f8e54021ce760b1506a3589b8"

diff -r 7ec1d063fecd -r a618f28e1496 chira_extract.xml
--- a/chira_extract.xml	Sat Jun 06 08:12:25 2020 -0400
+++ b/chira_extract.xml	Sun Jun 14 17:37:05 2020 -0400
@@ -32,9 +32,12 @@
         #end if
         $hybridize
         $seed_interaction
+        -sbp '$seed_bp'
+        -smpu '$seed_min_pu'
+        -acc '$accessibility'
+        -accw '$acc_width'
+        -m '$intarna_mode'
         $summarize
-        -a '$accessibility'
-        -m '$intarna_mode'
         -p "\${GALAXY_SLOTS:-2}"
         -o ./
     ]]></command>
@@ -93,29 +96,39 @@
         <param name="hybridize" type="boolean" truevalue="-r" falsevalue="" checked="false"
                label="Hybridize chimeric loci?"
                help="Turning this option on increases the run time of the tool significantly."/>
-        <param name="seed_interaction" type="boolean" truevalue="" falsevalue="--noSeed" checked="false"
-               label="Enforce seed interaction?"/>
-        <param name="accessibility" type="boolean" truevalue="C" falsevalue="N" checked="false"
-               label="Compute accessibility profiles for interacting sequences?"/>
         <param name="intarna_mode" type="select">
             <option value="H">Heuristic</option>
             <option value="M">Exact</option>
             <option value="S">Seed-only</option>
         </param>
+        <param name="seed_interaction" type="boolean" truevalue="" falsevalue="--noSeed" checked="true"
+               label="Enforce seed interaction?"/>
+        <param name="seed_bp" type="integer" value="5" min="2" max="20"
+               label="Number of inter-molecular base pairs within the seed region"
+               help="IntaRNA --seedBP parameter"/>
+        <param name="seed_min_pu" type="float" value="0" min="0" max="1"
+               label="Minimal unpaired probability (per sequence) a seed region may have"
+               help="IntaRNA --seedMinPu parameter"/>
+        <param name="accessibility" type="boolean" truevalue="C" falsevalue="N" checked="false"
+               label="Compute accessibility profiles for interacting sequences?"/>
+        <param name="acc_width" type="integer" value="150" min="0" max="99999"
+               label="Sliding window size for accessibility computation"
+               help="IntaRNA --accW parameter"/>
+        <param name="temperature" type="float" value="37" min="0" max="100"
+               label="IntaRNA temperature parameter in Celsius to setup the VRNA energy parameters"/>
         <param name="summarize" type="boolean" truevalue="-s" falsevalue="" checked="false"
                label="Summarize interactions at loci level?"/>
     </inputs>
 
     <outputs>
         <data format="tabular" name="chimeras" from_work_dir="chimeras" label="ChiRA chimeric reads on ${on_string}"/>
-        <data format="tabular" name="singletons" from_work_dir="singletons" label="ChiRA singleton reads on ${on_string}"/>
         <data format="tabular" name="interactions" from_work_dir="interactions" label="ChiRA interaction summary on ${on_string}">
             <filter>summarize == True</filter>
         </data>
     </outputs>
 
     <tests>
-        <test expect_num_outputs="3">
+        <test expect_num_outputs="2">
             <param name="loci" value="loci.counts"/>
             <param name="ref_type" value="split"/>
             <param name="ref_fasta1" value="ref1.fasta"/>
@@ -124,7 +137,6 @@
             <param name="hybridize" value="true" />
             <param name="summarize" value="true" />
             <output name="chimeras" file="chimeras"/>
-            <output name="singletons" file="singletons"/>
             <output name="interactions" file="interactions"/>
         </test>
     </tests>
diff -r 7ec1d063fecd -r a618f28e1496 macros.xml
--- a/macros.xml	Sat Jun 06 08:12:25 2020 -0400
+++ b/macros.xml	Sun Jun 14 17:37:05 2020 -0400
@@ -1,6 +1,6 @@
 <macros>
     <token name="@WRAPPER_VERSION@">@TOOL_VERSION@+galaxy</token>
-    <token name="@TOOL_VERSION@">1.3.3</token>
+    <token name="@TOOL_VERSION@">1.3.4</token>
     <xml name="requirements">
         <requirements>
             <requirement type="package" version="@TOOL_VERSION@">chira</requirement>
diff -r 7ec1d063fecd -r a618f28e1496 test-data/chimeras
--- a/test-data/chimeras	Sat Jun 06 08:12:25 2020 -0400
+++ b/test-data/chimeras	Sun Jun 14 17:37:05 2020 -0400
@@ -1,3 +1,3 @@
 tagid	txid1	txid2	geneid1	geneid2	symbol1	symbol2	region1	region2	tx_pos_start1	tx_pos_end1	tx_pos_strand1	length1	tx_pos_start2	tx_pos_end2	tx_pos_strand2	length2	read_info	genomic_pos1	genomic_pos2	locus1	locus2	groupid1	groupid2	tpm1	tpm2	score1	score2	score	sequences	hybrid	hybrid_pos	mfe
-3|2	mmu-miR-20a-5p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	0	23	+	23	132	142	+	188	6,28,35,44,55	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	5	2	75660.00	165100.00	1.0	1.0	2.0	UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU	((((((((((&)).))))))))	1&13	-13.7
-4|1	mmu-miR-6979-3p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	2	12	+	21	32	46	+	188	30,39,2,15,54	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	7	1	165100.00	121100.00	1.0	1.0	2.0	GUGUCUGUCU&CAGGACUCUUGGCU	((((.....((&))....))))	3&1	-4
+3|2	mmu-miR-20a-5p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	0	23	+	23	132	142	+	188	6,28,35,44,55	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	5	2	75660.00	165100.00	1.0	1.0	2.0	UAAAGUGCUUAUAGUGCAGGUAG&CUGCCUGCCU	............((.((((((((&))))))))))	13&1	-13.7
+4|1	mmu-miR-6979-3p	ENSMUST00000136025	NA	NA	NA	NA	NA	NA	2	12	+	21	32	46	+	188	30,39,2,15,54	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	7	1	165100.00	121100.00	1.0	1.0	2.0	GUGUCUGUCU&CAGGACUCUUGGCU	NA	NA	NA
diff -r 7ec1d063fecd -r a618f28e1496 test-data/interactions
--- a/test-data/interactions	Sat Jun 06 08:12:25 2020 -0400
+++ b/test-data/interactions	Sun Jun 14 17:37:05 2020 -0400
@@ -1,2 +1,2 @@
-mmu-miR-20a-5p:0:23:+	ENSMUST00000136025:132:142:+	1	UAAAGUGCUUAUAGUGCAGGUAG	CUGCCUGCCU	((((((((((&)).))))))))	1&13	-13.7	75660.00	165100.00	240760.0	1.0	1.0	2.0	NA	NA	mmu-miR-20a-5p	ENSMUST00000136025
-mmu-miR-6979-3p:2:12:+	ENSMUST00000136025:32:46:+	1	GUGUCUGUCU	CAGGACUCUUGGCU	((((.....((&))....))))	3&1	-4	165100.00	121100.00	286200.0	1.0	1.0	2.0	NA	NA	mmu-miR-6979-3p	ENSMUST00000136025
+1	mmu-miR-20a-5p	0	23	+	ENSMUST00000136025	132	142	+	UAAAGUGCUUAUAGUGCAGGUAG	CUGCCUGCCU	............((.((((((((&))))))))))	-13.7	AGUGCAGGUAG	CUGCCUGCCU	13&1	mmu-miR-20a-5p	12	23	+	ENSMUST00000136025	132	142	+	75660.00	165100.00	240760.0	1.0	1.0	2.0	NA	NA	mmu-miR-20a-5p	ENSMUST00000136025
+1	mmu-miR-6979-3p	2	12	+	ENSMUST00000136025	32	46	+	GUGUCUGUCU	CAGGACUCUUGGCU	NA	NA	NA	NA	NA	mmu-miR-6979-3p	2	12	+	ENSMUST00000136025	32	46	+	165100.00	121100.00	286200.0	1.0	1.0	2.0	NA	NA	mmu-miR-6979-3p	ENSMUST00000136025
diff -r 7ec1d063fecd -r a618f28e1496 test-data/singletons
--- a/test-data/singletons	Sat Jun 06 08:12:25 2020 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4 +0,0 @@
-tagid	txid	geneid	symbol	region	tx_pos_start	tx_pos_end	tx_pos_strand	length	read_info	genomic_pos	locus	groupid	tpm	score
-2|2	mmu-miR-6898-5p	NA	NA	NA	11	21	+	NA	1,10,49	mmu-miR-6898-5p:11:21:+	mmu-miR-6898-5p:11:21:+	6	165100.00	1.00
-6|1	ENSMUST00000160533	NA	NA	NA	69	82	+	NA	43,55,55	ENSMUST00000160533:69:82:+	ENSMUST00000160533:69:82:+	4	129700.00	1.00
-7|9	ENSMUST00000182010	NA	NA	NA	24	74	+	NA	6,55,55	ENSMUST00000182010:24:74:+	ENSMUST00000182010:19:74:+	0	64850.00	1.00