--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/cialign.xml	Mon Aug 04 17:17:20 2025 +0000
@@ -0,0 +1,1224 @@
+<tool id="cialign" name="CIAlign" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="23.2">
+    <description>clean, visualise and analyse a multiple sequence alignment</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <version_command>CIAlign --version</version_command>
+    <command detect_errors="exit_code"><![CDATA[
+        #if str($input.extension) == "fasta.gz":
+        gunzip -c '$input' > input.fasta &&
+        CIAlign --infile input.fasta
+        #else:
+            CIAlign --infile '$input'
+        #end if
+                --outfile_stem 'output'
+
+                ###### Basic Options
+                $basic_options.all
+                $basic_options.clean
+                $basic_options.visualise
+                $basic_options.interpret
+                
+                ###### Cleaning Options
+                ### Remove Divergent options
+                #if str($cleaning_options.remove_divergent_cond.remove_divergent_param) == "true": 
+                    --remove_divergent
+                    --remove_divergent_minperc $cleaning_options.remove_divergent_cond.remove_divergent_minperc
+                    #for $s in $cleaning_options.remove_divergent_cond.remove_divergent_retain_seqs
+                        --remove_divergent_retain '$s.remove_divergent_retain'
+                    #end for
+                    #for $s in $cleaning_options.remove_divergent_cond.remove_divergent_retain_strings
+                        --remove_divergent_retain_str '$s.remove_divergent_retain_str'
+                    #end for
+                #end if
+
+                ### Remove Insertions options
+                #if str($cleaning_options.remove_insertions_cond.remove_insertions_param) == "true": 
+                    --remove_insertions
+                    --insertion_min_size $cleaning_options.remove_insertions_cond.insertion_min_size
+                    --insertion_max_size $cleaning_options.remove_insertions_cond.insertion_max_size
+                    --insertion_min_flank $cleaning_options.remove_insertions_cond.insertion_min_flank
+                    --insertion_min_perc $cleaning_options.remove_insertions_cond.insertion_min_perc
+                #end if
+
+                ### Crop Ends options
+                #if str($cleaning_options.crop_ends_cond.crop_ends_param) == "true":
+                    --crop_ends
+                    --crop_ends_mingap_perc $cleaning_options.crop_ends_cond.crop_ends_mingap_perc
+                    --crop_ends_redefine_perc $cleaning_options.crop_ends_cond.crop_ends_redefine_perc
+                    #for $s in $cleaning_options.crop_ends_cond.crop_ends_retain_seqs
+                        --crop_ends_retain '$s.crop_ends_retain'
+                    #end for
+                    #for $s in $cleaning_options.crop_ends_cond.crop_ends_retain_strings
+                        --crop_ends_retain_str '$s.crop_ends_retain_str'
+                    #end for
+                #end if
+
+                ### Remove Short options
+                #if str($cleaning_options.remove_short_cond.remove_short_param) == "true":
+                    --remove_short
+                    --remove_min_length $cleaning_options.remove_short_cond.remove_min_length       
+                    #for $s in $cleaning_options.remove_short_cond.remove_short_retain_seqs
+                        --remove_short_retain '$s.remove_short_retain'
+                    #end for
+                    #for $s in $cleaning_options.remove_short_cond.remove_short_retain_strings
+                        --remove_short_retain_str '$s.remove_short_retain_str'
+                    #end for
+                #end if
+
+                ### Crop Divergent options
+                #if str($cleaning_options.crop_divergent_cond.crop_divergent_param) == "true":
+                    --crop_divergent
+                    --crop_divergent_min_prop_ident $cleaning_options.crop_divergent_cond.crop_divergent_min_prop_ident
+                    --crop_divergent_min_prop_nongap $cleaning_options.crop_divergent_cond.crop_divergent_min_prop_nongap
+                    --crop_divergent_buffer_size $cleaning_options.crop_divergent_cond.crop_divergent_buffer_size
+                #end if
+                
+                ### Retain options
+                #if str($cleaning_options.retain_cond.retain_param) == "true":
+                    #for $s in $cleaning_options.retain_cond.retain_seqs
+                        --retain '$s.retain'
+                    #end for
+                    #for $s in $cleaning_options.retain_cond.retain_strings
+                        --retain_str '$s.retain_str'
+                    #end for
+                #end if
+
+                ### Keep Gap only
+                $cleaning_options.keep_gaponly
+
+                ###### Visualisation Options
+                ### basic visualisation options
+                $visualisation_options.basic_visualisation_options.plot_input
+                $visualisation_options.basic_visualisation_options.plot_output
+                $visualisation_options.basic_visualisation_options.plot_markup
+                $visualisation_options.basic_visualisation_options.plot_consensus_identity
+                $visualisation_options.basic_visualisation_options.plot_consensus_similarity
+                #if str($visualisation_options.output_settings_cond.output_settings_param) == "true":
+                    --plot_width $visualisation_options.basic_visualisation_options.output_settings_cond.plot_width
+                    --plot_height $visualisation_options.basic_visualisation_options.output_settings_cond.plot_height
+                    --plot_dpi $visualisation_options.basic_visualisation_options.output_settings_cond.plot_dpi
+                    $visualisation_options.basic_visualisation_options.output_settings_cond.plot_keep_numbers
+                    $visualisation_options.basic_visualisation_options.output_settings_cond.plot_force_numbers
+                    --plot_identity_palette '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_identity_palette'
+                    --plot_identity_gap_col '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_identity_gap_col'
+                    --plot_similarity_palette '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_similarity_palette'
+                    --plot_similarity_gap_col '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_similarity_gap_col'
+                    --plot_sub_matrix_name '$visualisation_options.basic_visualisation_options.output_settings_cond.plot_sub_matrix_name'
+                    --palette '$visualisation_options.basic_visualisation_options.output_settings_cond.palette'
+                #end if
+
+                ### Sequence logos
+                #if str($visualisation_options.sequence_logo_cond.sequence_logo_param) == "true":
+                    --make_sequence_logo
+                    --sequence_logo_type "$visualisation_options.sequence_logo_cond.sequence_logo_type"
+                    --sequence_logo_dpi $visualisation_options.sequence_logo_cond.sequence_logo_dpi
+                    --sequence_logo_font '$visualisation_options.sequence_logo_cond.sequence_logo_font'
+                    --sequence_logo_nt_per_row $visualisation_options.sequence_logo_cond.sequence_logo_nt_per_row
+                    #if $visualisation_options.sequence_logo_cond.logo_start:
+                        --logo_start $visualisation_options.sequence_logo_cond.logo_start
+                    #end if
+                    #if $visualisation_options.sequence_logo_cond.logo_end:
+                        --logo_end $visualisation_options.sequence_logo_cond.logo_end
+                    #end if
+                #end if
+
+                ### Statistics Plots
+                $visualisation_options.statistics_plots.plot_stats_input
+                $visualisation_options.statistics_plots.plot_stats_output
+                #if $visualisation_options.statistics_plots.plot_stats_input or $visualisation_options.statistics_plots.plot_stats_output
+                    --plot_stats_dpi $visualisation_options.statistics_plots.stats_settings.plot_stats_dpi
+                    --plot_stats_height $visualisation_options.statistics_plots.stats_settings.plot_stats_width
+                    --plot_stats_width $visualisation_options.statistics_plots.stats_settings.plot_stats_height
+                    --plot_stats_colour '$visualisation_options.statistics_plots.stats_settings.plot_stats_colour'
+                #end if
+
+                ###### Interpretation Functions
+                ### consensus sequences
+                #if str($interpretation_options.consensus_sequences_cond.consensus_sequences_param) == "true":
+                    --make_consensus
+                    --consensus_type '$interpretation_options.consensus_sequences_cond.consensus_type'
+                    $interpretation_options.consensus_sequences_cond.consensus_keep_gaps
+                #end if
+                
+                ### Position Matrices
+                $interpretation_options.position_matrices.pwm_input
+                $interpretation_options.position_matrices.pwm_output
+                #if $interpretation_options.position_matrices.matrices_settings.pwm_start:
+                    --pwm_start $interpretation_options.position_matrices.matrices_settings.pwm_start
+                #end if
+                #if $interpretation_options.position_matrices.matrices_settings.pwm_end:
+                    --pwm_end $interpretation_options.position_matrices.matrices_settings.pwm_end
+                #end if
+                #if $interpretation_options.position_matrices.pwm_input or $interpretation_options.position_matrices.pwm_output:
+                    --pwm_freqtype '$interpretation_options.position_matrices.matrices_settings.pwm_freqtype'
+                    --pwm_alphatype '$interpretation_options.position_matrices.matrices_settings.pwm_alphatype'
+                    --pwm_alphaval $interpretation_options.position_matrices.matrices_settings.pwm_alphaval
+                #end if
+                $interpretation_options.position_matrices.pwm_output_blamm
+                $interpretation_options.position_matrices.pwm_output_meme
+                
+                ### Similarity Matrices
+                $interpretation_options.similarity_matrices.make_similarity_matrix_input
+                $interpretation_options.similarity_matrices.make_similarity_matrix_output
+                #if $interpretation_options.similarity_matrices.make_similarity_matrix_input or $interpretation_options.similarity_matrices.make_similarity_matrix_output: 
+                    --make_simmatrix_keepgaps $interpretation_options.similarity_matrices.similarity_matrices_settings.make_simmatrix_keepgaps
+                    --make_simmatrix_dp $interpretation_options.similarity_matrices.similarity_matrices_settings.make_simmatrix_dp
+                    --make_simmatrix_minoverlap $interpretation_options.similarity_matrices.similarity_matrices_settings.make_simmatrix_minoverlap
+                #end if
+
+
+                ###### Editing Functions
+                #if str($editing_functions.get_section_cond.get_section_param) == "true":
+                    --get_section
+                    --section_start $editing_functions.get_section_cond.section_start
+                    --section_end $editing_functions.get_section_cond.section_end
+                #end if
+                $editing_functions.replace_input_tu
+                $editing_functions.replace_input_ut
+                $editing_functions.replace_output_tu
+                $editing_functions.replace_output_ut
+                ### Unaligning
+                $editing_functions.unalign_input
+                $editing_functions.unalign_output
+                ### Removing Duplicates
+                $editing_functions.deduplicate_ids
+                #if str($editing_functions.deduplicate_ids)
+                    --duporder '$editing_functions.duporder'
+                #end if
+    ]]></command>
+    <inputs>
+        <param name="input" type="data" format="fasta,fasta.gz" label="Input FASTA" help="Upload a multiple sequence alignment in FASTA or compressed FASTA (.gz) format."/>        <!-- BASIC options -->
+        <section name="basic_options" title="Basic Options" expanded="yes">
+            <param argument="--all" type="boolean" truevalue="--all" falsevalue="" checked="false" label="Use All Functions" help="Enable all available functions with default parameters unless overridden."/>
+            <param argument="--clean" type="boolean" truevalue="--clean" falsevalue="" checked="false" label="Use All Cleaning Functions" help="Use all available cleaning functions with default parameters unless overridden."/>
+            <param argument="--visualise" type="boolean" truevalue="--visualise" falsevalue="" checked="false" label="Use All Visualisation Functions" help="Use all available mini alignment visualisation functions with default parameters unless overridden."/>
+            <param argument="--interpret" type="boolean" truevalue="--interpret" falsevalue="" checked="false" label="Use All Interpretation Functions" help="Use all available interpretation functions with default parameters unless overridden."/>
+            <param name="log_out" type="boolean" checked="false" label="Output log file" help="Outputs the log file."/>
+        </section>
+
+        <section name="cleaning_options" title="Cleaning Options" expanded="false">
+            <!-- Remove divergent options -->
+            <conditional name="remove_divergent_cond">
+                <param name="remove_divergent_param" type="select" label="Remove divergent" help="Remove sequences with identity below a specified proportion of conserved positions.">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <param argument="--remove_divergent_minperc" type="float" value="0.65" min="0" max="1" label="Minimum Identity Proportion" help="Minimum proportion of positions that must match the most common base or amino acid for a sequence to be kept."/>
+                    <repeat name="remove_divergent_retain_seqs" title="sequences to retain" min="0">
+                        <param argument="--remove_divergent_retain" type="text" value="" label="Retain Sequence by Name" help="Always keep the sequence with this exact name. (must match a seq name)">
+                            <validator type="empty_field"/>
+                        </param>
+                    </repeat>
+                    <repeat name="remove_divergent_retain_strings" title="strings to retain" min="0">
+                        <param argument="--remove_divergent_retain_str" type="text" value="" label="Retain Sequences Containing Text" help="Always keep sequences whose names contain this text.">            
+                            <validator type="empty_field"/>
+                        </param>
+                    </repeat>
+                </when>
+                <when value="false"/>
+            </conditional>
+
+            <!-- Remove Insertions options -->
+            <conditional name="remove_insertions_cond">
+                <param name="remove_insertions_param" type="select" label="Remove Rare Insertions" help="Remove insertions not present in the majority of sequences.">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <param argument="--insertion_min_size" type="integer" value="3" min="1" label="Minimum Insertion Size" help="Only remove insertions larger than this number of residues. Must be less than or equal to the number of columns in your alignment."/>
+                    <param argument="--insertion_max_size" type="integer" value="200" min="1" max="10000" label="Maximum Insertion Size" help="Only remove insertions smaller than this number of residues."/>
+                    <param argument="--insertion_min_flank" type="integer" value="5" min="0"  label="Minimum Flank Size" help="Minimum number of bases required on each side of an insertion. Must be less than half the alignment length."/>            
+                    <param argument="--insertion_min_perc" type="float" value="0.5" min="0" max="1" label="Minimum Presence Proportion" help="Remove insertions found in less than this proportion of sequences."/>            
+                </when>
+                <when value="false"/>
+            </conditional>
+
+            <!-- Crop Ends options -->
+            <conditional name="crop_ends_cond">
+                <param name="crop_ends_param" type="select" label="Crop Sequence Ends" help="Trim ends of sequences if they are poorly aligned.">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <param argument="--crop_ends_mingap_perc" type="float" value="0.05" min="0" max="0.6" label="Minimum Gap Change Threshold" help="Minimum proportion of sequence length (excluding gaps) used to detect significant change in gap numbers."/>            
+                    <param argument="--crop_ends_redefine_perc" type="float" value="0.1" min="0" max="0.5" label="Region Proportion to Check" help="Proportion of the sequence (excluding gaps) checked at each end to redefine cropping boundaries."/>                        
+                    <repeat name="crop_ends_retain_seqs" title="sequences to retain" min="0">
+                        <param argument="--crop_ends_retain" type="text" value="" label="Retain Sequence by Name" help="Do not crop the sequence with this exact name. (must match a seq name)">
+                            <validator type="empty_field"/>
+                        </param>
+                    </repeat>
+                    <repeat name="crop_ends_retain_strings" title="strings to retain" min="0">
+                        <param argument="--crop_ends_retain_str" type="text" value="" label="Retain Sequences Containing Text" help="Do not crop sequences whose names contain this text. Case-sensitive."> 
+                            <validator type="empty_field"/>
+                        </param>
+                    </repeat>
+                </when>
+                <when value="false"/>
+            </conditional>
+        
+            <!-- Remove Short options -->
+            <conditional name="remove_short_cond">
+                <param name="remove_short_param" type="select" label="Remove Short Sequences" help="Remove sequences shorter than a specified length (excluding gaps).">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <param argument="--remove_min_length" type="integer" value="50" min="0" label="Minimum Sequence Length" help="Remove sequences shorter than this length, excluding gaps."/>            
+                    <repeat name="remove_short_retain_seqs" title="sequences to retain" min="0">
+                        <param argument="--remove_short_retain" type="text" value="" label="Retain Sequences by Name" help="Do not remove the sequence with this exact name. (must match a seq name)">
+                            <validator type="empty_field"/>
+                        </param>
+                    </repeat>
+                    <repeat name="remove_short_retain_strings" title="strings to retain" min="0">
+                        <param argument="--remove_short_retain_str" type="text" value="" label="Retain Sequences Containing Text" help="Do not remove sequences whose names contain this text. Case-sensitive.">
+                                <validator type="empty_field"/>
+                        </param>            
+                    </repeat>
+                </when>
+                <when value="false"/>
+            </conditional>
+
+            <!-- Crop Divergent options -->
+            <conditional name="crop_divergent_cond">
+                <param name="crop_divergent_param" type="select" label="Crop Divergent Sequences" help="Remove highly divergent regions to improve alignment quality by focusing on more conserved parts.">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <param argument="--crop_divergent_min_prop_ident" type="float" value="0.5" min="0.01" max="1" label="Minimum Identity Proportion" help="Minimum proportion of sequences that must share the same residue in a column."/>            
+                    <param argument="--crop_divergent_min_prop_nongap" type="float" value="0.5" min="0.01" max="1" label="Minimum Non-Gap Proportion" help="Minimum proportion of sequences that must contain a non-gap residue in a column."/>            
+                    <param argument="--crop_divergent_buffer_size" type="integer" value="5" min="1" label="Buffer Size" help="Number of consecutive columns that must meet the identity and non-gap criteria to retain a region."/>            
+                </when>
+                <when value="false"/>
+            </conditional>
+
+            <!-- Retain options -->
+            <conditional name="retain_cond">
+                <param name="retain_param" type="select" label="Retain Specific Sequences" help="Specify sequences that should not be edited or removed during row-wise functions.">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <repeat name="retain_seqs" title="sequences to retain" min="0">
+                        <param argument="--retain" type="text" value="" label="Retain Sequence with this Name" help="Do not edit or remove the sequence with this exact name during row-wise functions. Can be used multiple times. (must match a seq name)">
+                            <validator type="empty_field"/>
+                        </param>
+                    </repeat>
+                    <repeat name="retain_strings" title="strings to retain" min="0">
+                        <param argument="--retain_str" type="text" value="" label="Retain Sequences Containing this String" help="Do not edit or remove sequences with names containing this text. Case-sensitive.">
+                            <validator type="empty_field"/>
+                        </param>
+                    </repeat>
+                </when>
+                <when value="false"/>
+            </conditional>
+
+            <param argument="--keep_gaponly" type="boolean" truevalue="--keep_gaponly" falsevalue="" checked="false" label="Keep Gap-Only Columns" help=" Keep columns in the alignment that consist entirely of gaps."/>
+        </section>
+
+        <section name="visualisation_options" title="Visualisation Options" expanded="false">
+            <!-- Visualisation options -->
+            <section name="basic_visualisation_options" title="Basic Visualisation Options" expanded="false">
+                <param argument="--plot_input" type="boolean" checked="false" falsevalue="" truevalue="--plot_input" label="Plot input alignment" help="Visualisation of the input alignment"/>
+                <param argument="--plot_output" type="boolean" checked="false" falsevalue="" truevalue="--plot_output" label="Plot output alignment" help="Visualisation of the cleaned output alignment"/>
+                <param argument="--plot_markup" type="boolean" checked="false" falsevalue="" truevalue="--plot_markup" label="Plot markup" help="Visualisation of the input alignment with deleted rows and columns marked"/>
+                <param argument="--plot_consensus_identity" type="boolean" checked="false" falsevalue="" truevalue="--plot_consensus_identity" label="Plot consensus identity" help="Plot a mini alignment showing positions which are identical to or differ from the consensus."/>
+                <param argument="--plot_consensus_similarity" type="boolean" checked="false" falsevalue="" truevalue="--plot_consensus_similarity" label="Plot consensus similarity" help="Plot a mini alignment showing positions based on their score when when compared via a substitution matrix to the consensus."/>        
+                <conditional name="output_settings_cond">
+                    <param name="output_settings_param" type="select" label="Change output settings?" help="Change the output settings.">
+                        <option value="true">Yes</option>
+                        <option value="false" selected="true">No</option>
+                    </param>            
+                    <when value="true">
+                    <param argument="--plot_width" type="integer" value="5" min="2" max="20" label="Plot width" help="Mini alignment width in inches."/>
+                    <param argument="--plot_height" type="integer" value="3" min="2" max="15" label="Plot height" help="Mini alignment height in inches."/>
+                    <param argument="--plot_dpi" type="integer" min="72" max="1200" value="300" label="Plot DPI" help="DPI for mini alignments"/>
+                    <param argument="--plot_keep_numbers" type="boolean" checked="false" falsevalue="" truevalue="--plot_keep_numbers" label="Plot keep numbers" help="If specified, for mini alignments based on CIAlign output with smaller than 10 sequences (or if force_numbers is switched on) the rows will be labelled based on the input alignment, rather than renumbered."/>
+                    <param argument="--plot_force_numbers" type="boolean" checked="false" falsevalue="" truevalue="--plot_force_numbers" label="Plot force numbers" help="Force all rows to be numbered on the mini alignments rather than labelling e.g. every 10th row for larger plots. Will cause labels to overlap on large plots."/>
+                    <param argument="--plot_identity_palette" type="text" value="bone" label="Plot identity palette" help="Matplotlib palette name for identity mini alignments.">
+                        <validator type="regex">^[a-zA-Z_]+$</validator>
+                    </param>
+                    <param argument="--plot_identity_gap_col" type="color" value="#ffffff" label="Plot identity gap col" help="Colour for gaps in identity mini alignments.">
+                        <sanitizer invalid_char="">
+                            <valid initial="string.ascii_letters,string.digits">
+                                <add value="#" />
+                            </valid>
+                        </sanitizer>
+                    </param>
+                    <param argument="--plot_similarity_palette" type="text" value="bone" label="Plot similarity palette" help="Matplotlib palette name for similarity mini alignments.">
+                        <validator type="regex">^[a-zA-Z_]+$</validator>
+                    </param>
+                    <param argument="--plot_similarity_gap_col" type="color" value="#ffffff" label="Plot similarity gap col" help="Colour for gaps in similarity mini alignments.">
+                        <sanitizer invalid_char="">
+                            <valid initial="string.ascii_letters,string.digits">
+                                <add value="#" />
+                            </valid>
+                        </sanitizer>
+                    </param>
+                    <param argument="--plot_sub_matrix_name" type="select" label="Substitution matrix to use for similarity plots" help="BLOSUM62 for amino acid, NUC.4.4 for nucleotide">
+                        <option value="BLOSUM62">BLOSUM62</option>
+                        <option value="NUC.4.4" selected="true">NUC.4.4</option>
+                    </param>
+                    <param argument="--palette" type="select" value="CBS" label="Colour palette" help="Colour palette. Currently implemented CBS (colour blind safe) or bright.">
+                        <option value="CBS" selected="true">CBS</option>
+                    </param>
+                    </when>
+                    <when value="false"/>
+                </conditional>
+             </section>
+
+            <!-- Sequence Logos -->
+            <conditional name="sequence_logo_cond">
+                <param name="sequence_logo_param" type="select" label="Make sequence logo?" help="Draw a sequence logo.">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <param argument="--sequence_logo_type" type="select" label="Type of sequence logo" help="Type of sequence logo to plot">
+                        <option value="bar">Bar</option>
+                        <option value="text" selected="true">Text</option>
+                        <option value="both">Both (Bar and Text)</option>
+                    </param> 
+                    <param argument="--sequence_logo_dpi" type="integer" min="72" max="1200" value="300" label="Resolution (DPI)" help="DPI (dots per inch) for sequence logo."/>
+                    <param argument="--sequence_logo_font" type="text" value="monospace" label="Logo Font" help="Font for bases / amino acids in a text based sequence logo">
+                        <validator type="regex">^[a-zA-Z\- ]+$</validator>
+                    </param>
+                    <param argument="--sequence_logo_nt_per_row" type="integer" value="50" label="Number of Bases/amino acids per row" help="Number of bases / amino acids to show per row in the sequence logo, where the logo is too large to show on a single line"/>
+                    <param argument="--logo_start" type="integer" optional="true" label="Logo Start" help="Start sequence logo"/>
+                    <param argument="--logo_end" type="integer" optional="true" label="Logo End" help="End sequence logo"/>
+                </when>
+                <when value="false"/>
+            </conditional>
+
+            <!-- Statistics Plots -->
+            <section name="statistics_plots" title="Statistics Plots" expanded="false">
+                <param argument="--plot_stats_input" type="boolean" checked="false" falsevalue="" truevalue="--plot_stats_input" label="Plot stats input" help="Plot the statistics for the input MSA"/>        
+                <param argument="--plot_stats_output" type="boolean" checked="false" falsevalue="" truevalue="--plot_stats_output" label="Plot stats output" help="Plot the statistics for the output MSA"/>        
+                <section name="stats_settings" title="Statistics Plots Settings" expanded="false">
+                    <param argument="--plot_stats_dpi" type="integer" value="300" min="72" max="1200" label="DPI" help="DPI for coverage plot"/>
+                    <param argument="--plot_stats_width" type="integer" min="2" max="20" value="5" label="Plot width" help="Width for coverage plot (inches)"/>
+                    <param argument="--plot_stats_height" type="integer" min="2" max="15" value="3" label="Plot height" help="Height for coverage plot (inches)"/>
+                    <param argument="--plot_stats_colour" type="text" value="#0000ff" label="Colour" help="Colour for coverage plot (hex code or name)">
+                        <sanitizer invalid_char="">
+                            <valid initial="string.ascii_letters,string.digits">
+                                <add value="#" />
+                            </valid>
+                        </sanitizer>
+                    </param>
+                </section>
+            </section>
+        </section>
+        
+        
+        <section name="interpretation_options" title="Interpretation Options" expanded="false">
+            <!-- Consensus Sequences -->
+            <conditional name="consensus_sequences_cond">
+                <param name="consensus_sequences_param" type="select" label="Consensus Sequences" help="This generates a consensus sequence based on the cleaned alignment.">
+                    <option value="true">Yes</option>
+                    <option value="false" selected="true">No</option>
+                </param>            
+                <when value="true">
+                    <!-- consensus_sequences -->
+                    <param argument="--consensus_type" type="select" label="Type of consensus sequence" help="Can be majority, to use the most common character at each position in the consensus, even if this is a gap, or majority_nongap, to use the most common non-gap character at each position">
+                        <option value="majority" selected="true">majority</option>
+                        <option value="majority_nongap">majority_nongap</option>
+                    </param> 
+                    <param argument="--consensus_keep_gaps" type="boolean" truevalue="--consensus_keep_gaps" falsevalue="" checked="false" label="Include gaps?" help="Should gaps be included in the consensus"/>            
+                </when>
+                <when value="false"/>
+            </conditional>
+
+            <!-- Position Matrices -->
+            <section name="position_matrices" title="Position Matrices" expanded="false">
+                <param argument="--pwm_input" type="boolean" checked="false" falsevalue="" truevalue="--pwm_input" label="Generate input matrices" help="Generate a position frequency matrix, position probability matrix and position weight matrix based on the input alignment"/>        
+                <param argument="--pwm_output" type="boolean" checked="false" falsevalue="" truevalue="--pwm_output" label="Generate output matrices" help="Generate a position frequency matrix, position probability matrix and position weight matrix based on the cleaned output alignment"/>        
+                <section name="matrices_settings" title="Position Matrices Settings" expanded="false">
+                    <param argument="--pwm_start" type="integer" optional="true" label="Start the PWM" help="Start the PWM and other matrices from this column of the input alignment"/>
+                    <param argument="--pwm_end" type="integer" optional="true" label="End the PWM" help="End the PWM and other matrices at this column of the input alignment"/>
+                    <param argument="--pwm_freqtype" type="select" label="Background frequency matrix" help="Choose how to compute background frequencies for the PWM: - equal: assume all residues are equally common  
+                    - calc: derive from the input PFM  - calc2: derive from the full alignment (same as calc if no bounds)  - user: provide your own frequencies (check https://davetang.org/muse/2013/10/01/position-weight-matrix/)">
+                        <option value="user">user</option>
+                        <option value="equal" selected="true">equal</option>
+                        <option value="calc">calc</option>
+                        <option value="calc2">calc2</option>
+                    </param> 
+                    <param argument="--pwm_alphatype" type="select" label="Pseudocount type" help="If alphatype is 'calc', alpha is calculated as frequency(base), If alpha type is 'user' the user provides the value of alpha as pwm_alphatype. To run without pseudocounts set pwm_alphatype as user and pwm_alphaval as 0.">
+                        <option value="user">user</option>
+                        <option value="calc" selected="true">calc</option>
+                    </param>
+                    <param argument="--pwm_alphaval" type="integer" value="1" label="Alpha value" help="User defined value of the alpha parameter to use as a pseudocount in the PPM."/>
+                </section>
+                <param argument="--pwm_output_blamm" type="boolean" checked="false" falsevalue="" truevalue="--pwm_output_blamm" label="Output for BLAM" help="Output PPM formatted for BLAMM software"/>        
+                <param argument="--pwm_output_meme" type="boolean" checked="false" falsevalue="" truevalue="--pwm_output_meme" label="Output for MEME" help="Output PPM formatted for MEME software"/>        
+            </section>
+
+            <!-- Similarity Matrices -->
+            <section name="similarity_matrices" title="Similarity Matrices" expanded="false">
+                <param argument="--make_similarity_matrix_input" type="boolean" checked="false" falsevalue="" truevalue="--make_similarity_matrix_input" label="Input similarity matrix" help="Make a similarity matrix for the input alignment"/>        
+                <param argument="--make_similarity_matrix_output" type="boolean" checked="false" falsevalue="" truevalue="--make_similarity_matrix_output" label="Output similarity matrix" help="Make a similarity matrix for the output alignment"/>        
+                <section name="similarity_matrices_settings" title="Similarity Matrices Settings" expanded="false">
+                    <param argument="--make_simmatrix_keepgaps" type="select" label="Keep gaps" help="0 - exclude positions which are gaps in either or both sequences from similarity calculations, 1 - exclude positions which are gaps in both sequences, 2 - include all positions">
+                        <option value="0" selected="true">0</option>
+                        <option value="1">1</option>
+                        <option value="2">2</option>
+                    </param>
+                    <param argument="--make_simmatrix_dp" type="integer" min="0" max="10" value="4" label="Decimal places" help="Number of decimal places to display in the similarity matrix output file"/>
+                    <param argument="--make_simmatrix_minoverlap" type="integer" value="1" label="Minimum overlap" help="Minimum overlap between two sequences to have non-zero similarity in the similarity matrix"/>
+                </section>
+            </section>
+        </section>
+
+        <!-- Editing Functions -->
+        <section name="editing_functions" title="Editing Options" expanded="false">
+            <!-- get section -->
+            <conditional name="get_section_cond">
+            <param name="get_section_param" type="select" label="Retrieve and process a section of the alignment?">
+                <option value="true" >Yes</option>
+                <option value="false" selected="true">No</option>
+            </param>            
+            <when value="true">
+                <param argument="--section_start" type="integer" label="Section start" help="Start position in the original alignment for the section to be extracted"/>        
+                <param argument="--section_end" type="integer" label="Section end" help="End position in the original alignment for the section to be extracted"/>        
+            </when>
+            <when value="false"/>
+            </conditional>
+            <!-- replace bases-->
+            <param argument="--replace_input_tu" type="boolean" checked="false" falsevalue="" truevalue="--replace_input_tu" label="Replace input T - U " help="Generates a copy of the input alignment with U's instead of T's"/>        
+            <param argument="--replace_input_ut" type="boolean" checked="false" falsevalue="" truevalue="--replace_input_ut" label="Replace input U - T " help="Generates a copy of the input alignment with T's instead of U's"/>        
+            <param argument="--replace_output_tu" type="boolean" checked="false" falsevalue="" truevalue="--replace_output_tu" label="Replace output T - U " help="Generates a copy of the output alignment with U's instead of T's"/>        
+            <param argument="--replace_output_ut" type="boolean" checked="false" falsevalue="" truevalue="--replace_output_ut" label="Replace output U -T " help="Generates a copy of the output alignment with T's instead of U's"/>        
+            <!-- Unaligning -->
+            <param argument="--unalign_input" type="boolean" checked="false" falsevalue="" truevalue="--unalign_input" label="Input alignment with no gaps " help="Generates a copy of the input alignment with no gaps"/>        
+            <param argument="--unalign_output" type="boolean" checked="false" falsevalue="" truevalue="--unalign_output" label="Out alignment with no gaps " help="Generates a copy of the output alignment with no gaps"/>        
+            <param argument="--deduplicate_ids" type="boolean" checked="false" falsevalue="" truevalue="--deduplicate_ids" label="Remove duplicates" help="Remove sequences with duplicate names from the input."/>        
+            <param argument="--duporder" type="select" label="Duplicates order" help="Set to first to keep the first instance of the sequence name and last to keep the last">
+                    <option value="first" selected="true">first</option>
+                    <option value="last">last</option>
+            </param>
+        </section>
+    </inputs>
+
+    <outputs>
+        <data name="output_cleaned" format="fasta" from_work_dir="output_cleaned.fasta" label="${tool.name} on ${on_string}: Cleaned Alignment"/>
+        <data name="output_removed" format="txt" from_work_dir="output_removed.txt" label="${tool.name} on ${on_string}: Removed Sequences"/>
+        <data name="output_log" format="txt" from_work_dir="output_log.txt" label="${tool.name} on ${on_string}: Log File">
+            <filter>basic_options['log_out']</filter>
+        </data>
+        <!-- Visualisation Options Simple Outputs -->
+        <data name="plot_input" format="png" from_work_dir="output_input.png" label="${tool.name} on ${on_string}: Input Plot">
+            <filter>visualisation_options['basic_visualisation_options']['plot_input'] or basic_options['visualise'] or basic_options['all']</filter>
+        </data>
+        <data name="plot_output" format="png" from_work_dir="output_output.png" label="${tool.name} on ${on_string}: Output Plot">
+            <filter>visualisation_options['basic_visualisation_options']['plot_output'] or basic_options['visualise'] or basic_options['all']</filter>
+        </data>
+        <data name="plot_markup" format="png" from_work_dir="output_markup.png" label="${tool.name} on ${on_string}: Markup Plot">
+            <filter>visualisation_options['basic_visualisation_options']['plot_markup'] or basic_options['visualise'] or basic_options['all']</filter>
+        </data>
+        <data name="plot_markup_legend" format="png" from_work_dir="output_markup_legend.png" label="${tool.name} on ${on_string}: Markup Legend">
+            <filter>visualisation_options['basic_visualisation_options']['plot_markup'] or basic_options['visualise'] or basic_options['all']</filter>
+        </data>
+        <data name="plot_consensus_identity" format="png" from_work_dir="output_consensus_identity.png" label="${tool.name} on ${on_string}: Consensus Identity Plot">
+            <filter>visualisation_options['basic_visualisation_options']['plot_consensus_identity'] or basic_options['all']</filter>
+        </data>
+        <data name="plot_consensus_similarity" format="png" from_work_dir="output_consensus_similarity.png" label="${tool.name} on ${on_string}: Consensus Similarity Plot">
+            <filter>visualisation_options['basic_visualisation_options']['plot_consensus_similarity']</filter>
+        </data>
+        <!-- Visualisation Options Outputs -->
+        <data name="logo_bar" format="png" from_work_dir="output_logo_bar.png" label="${tool.name} on ${on_string}: Logo Bar Chart">
+            <filter>(visualisation_options['sequence_logo_cond']['sequence_logo_param'] == 'true' and (visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'bar' or visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'both'))</filter>
+        </data>
+        <data name="logo_text" format="png" from_work_dir="output_logo_text.png" label="${tool.name} on ${on_string}: Logo Text Chart">
+            <filter>(visualisation_options['sequence_logo_cond']['sequence_logo_param'] == 'true' and (visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'text' or visualisation_options['sequence_logo_cond']['sequence_logo_type'] == 'both'))</filter>
+        </data>
+        
+        <!-- Statistics plots of the input -->
+        <collection name="plot_stats_input" type="list" label="Input stats plots">
+            <discover_datasets pattern="(output_input_)(?P&lt;designation&gt;.+)\.png$" format="png" directory="." visible="false"/>
+            <filter>visualisation_options['statistics_plots']['plot_stats_input'] or basic_options['interpret'] or basic_options['all']</filter>
+        </collection>
+
+        <!-- Statistics plots of the output -->
+        <collection name="plot_stats_outputs" type="list" label="Output stats plots">
+            <discover_datasets pattern="(output_output_)(?P&lt;designation&gt;.+)\.png$" format="png" directory="." visible="false"/>
+            <filter>visualisation_options['statistics_plots']['plot_stats_output'] or basic_options['interpret'] or basic_options['all']</filter>
+        </collection>
+
+        <!-- Interpretaion Options Outputs -->
+        <data name="output_consensus" format="fasta" from_work_dir="output_consensus.fasta" label="${tool.name} on ${on_string}: Consensus Sequence">
+            <filter>interpretation_options['consensus_sequences_cond']['consensus_sequences_param'] == 'true' or basic_options['interpret'] or basic_options['all']</filter>
+        </data>
+        <data name="output_with_consensus" format="fasta" from_work_dir="output_with_consensus.fasta" label="${tool.name} on ${on_string}: Cleaned + Consensus">
+            <filter>interpretation_options['consensus_sequences_cond']['consensus_sequences_param'] == 'true' or basic_options['interpret'] or basic_options['all']</filter>
+        </data>
+        <data name="pwm_input" format="txt" from_work_dir="output_pwm_input.txt" label="${tool.name} on ${on_string}: PWM Input">
+            <filter>interpretation_options['position_matrices']['pwm_input']</filter>
+        </data>
+        <data name="ppm_input" format="txt" from_work_dir="output_ppm_input.txt" label="${tool.name} on ${on_string}: PPM Input">
+            <filter>interpretation_options['position_matrices']['pwm_input']</filter>
+        </data>
+        <data name="pfm_input" format="txt" from_work_dir="output_pfm_input.txt" label="${tool.name} on ${on_string}: PFM Input">
+            <filter>interpretation_options['position_matrices']['pwm_input']</filter>
+        </data>
+        <data name="ppm_meme_input" format="txt" from_work_dir="output_ppm_meme_input.txt" label="${tool.name} on ${on_string}: PPM for MEME (Input)">
+            <filter>interpretation_options['position_matrices']['pwm_input'] and interpretation_options['position_matrices']['pwm_output_meme']</filter>
+        </data>
+        <data name="blamm_input" format="txt" from_work_dir="output_pfm_blamm_input.txt" label="${tool.name} on ${on_string}: PFM for BLAMM (Input)">
+            <filter>interpretation_options['position_matrices']['pwm_input'] and interpretation_options['position_matrices']['pwm_output_blamm']</filter>
+        </data>
+        <data name="pwm_output" format="txt" from_work_dir="output_pwm_output.txt" label="${tool.name} on ${on_string}: PWM Output">
+            <filter>interpretation_options['position_matrices']['pwm_output']</filter>
+        </data>
+        <data name="ppm_output" format="txt" from_work_dir="output_ppm_output.txt" label="${tool.name} on ${on_string}: PPM Output">
+            <filter>interpretation_options['position_matrices']['pwm_output']</filter>
+        </data>
+        <data name="pfm_output" format="txt" from_work_dir="output_pfm_output.txt" label="${tool.name} on ${on_string}: PFM Output">
+            <filter>interpretation_options['position_matrices']['pwm_output']</filter>
+        </data>
+        <data name="ppm_meme_output" format="txt" from_work_dir="output_ppm_meme_output.txt" label="${tool.name} on ${on_string}: PPM for MEME (Output)">
+            <filter>interpretation_options['position_matrices']['pwm_output'] and interpretation_options['position_matrices']['pwm_output_meme']</filter>
+        </data>
+        <data name="blamm_output" format="txt" from_work_dir="output_pfm_blamm_output.txt" label="${tool.name} on ${on_string}: PFM for BLAMM (Output)">
+            <filter>interpretation_options['position_matrices']['pwm_output'] and interpretation_options['position_matrices']['pwm_output_blamm']</filter>
+        </data>
+        <data name="input_similarity" format="tsv" from_work_dir="output_input_similarity.tsv" label="${tool.name} on ${on_string}: Input Similarity">
+            <filter>interpretation_options['similarity_matrices']['make_similarity_matrix_input'] or basic_options['interpret'] or basic_options['all']</filter>
+        </data>
+        <data name="output_similarity" format="tsv" from_work_dir="output_output_similarity.tsv" label="${tool.name} on ${on_string}: Output Similarity">
+            <filter>interpretation_options['similarity_matrices']['make_similarity_matrix_output'] or basic_options['interpret'] or basic_options['all']</filter>
+        </data>
+        <data name="output_output_column_stats" format="tsv" from_work_dir="output_output_column_stats.tsv" label="${tool.name} on ${on_string}: Output column stats">
+            <filter>basic_options['interpret'] or basic_options['all']</filter>
+        </data>        
+        <data name="output_input_column_stats" format="tsv" from_work_dir="output_output_column_stats.tsv" label="${tool.name} on ${on_string}: Input column stats">
+            <filter>basic_options['interpret'] or basic_options['all']</filter>
+        </data>
+        <!-- Editing Options Outputs -->
+        <data name="U_input" format="fasta" from_work_dir="output_U_input.fasta" label="${tool.name} on ${on_string}: Input: U instead of T">
+            <filter>editing_functions['replace_input_tu']</filter>
+        </data>
+        <data name="T_input" format="fasta" from_work_dir="output_T_input.fasta" label="${tool.name} on ${on_string}: Input: T instead of U">
+            <filter>editing_functions['replace_input_ut']</filter>
+        </data>
+        <data name="U_output" format="fasta" from_work_dir="output_U_output.fasta" label="${tool.name} on ${on_string}: Output: U instead of T">
+            <filter>editing_functions['replace_output_tu']</filter>
+        </data>
+        <data name="T_output" format="fasta" from_work_dir="output_T_output.fasta" label="${tool.name} on ${on_string}: Output: T instead of U">
+            <filter>editing_functions['replace_output_ut']</filter>
+        </data>
+        <data name="unaligned_input" format="fasta" from_work_dir="output_unaligned_input.fasta" label="${tool.name} on ${on_string}: Unaligned Input">
+            <filter>editing_functions['unalign_input']</filter>
+        </data>
+        <data name="unaligned_output" format="fasta" from_work_dir="output_unaligned_output.fasta" label="${tool.name} on ${on_string}: Unaligned Output">
+            <filter>editing_functions['unalign_output']</filter>
+        </data>
+    </outputs>
+    <tests>
+        <!-- Test 1 gzip files -->
+        <test expect_num_outputs="3">
+            <param name="input" value="example3.fasta.gz" ftype="fasta"/>
+            <section name="basic_options">
+                <param name="log_out" value="true"/>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="4"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="0"/>
+                </assert_contents>
+            </output>
+            <output name="output_log">
+                 <assert_contents>
+                        <has_text text="Command Line Args:"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 2 to check clean mode -->
+        <test expect_num_outputs="3">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="basic_options">
+                <param name="clean" value="true"/>
+                <param name="log_out" value="true"/>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="10"/>
+                    <has_line_matching expression="AUUCUAUCUGGGUGACUAUUCGUUAUCUCUACUUACUAUCUUACUUACUUACUUACGCUACGUACUAGCUUACGUACUGACUU" />
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="7"/>
+                    <has_line_matching expression="remove_gap_only\s+89,90,91" />
+                </assert_contents>
+            </output>
+            <output name="output_log">
+                 <assert_contents>
+                        <has_text text="Command Line Args:"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 3 to clean amino acid -->
+        <test expect_num_outputs="3">
+            <param name="input" value="example2.fasta" ftype="fasta"/>
+            <section name="basic_options">
+                <param name="clean" value="true"/>
+                <param name="log_out" value="true"/>
+            </section>
+            <section name="cleaning_options">
+                <conditional name="retain_cond">
+                    <param name="retain_param" value="true"/>
+                    <repeat name="retain_seqs">
+                        <param name="retain" value="seq1"/>
+                    </repeat>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line_matching expression="MKTAIKDLGTEYKLTVAEYFR" />
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line_matching expression="remove_gap_only\s+3,4" />
+                </assert_contents>
+            </output>
+            <output name="output_log">
+                 <assert_contents>
+                        <has_text text="Amino acid alignment detected"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 4 to check visualise mode  -->
+        <test expect_num_outputs="7">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="basic_options">
+                <param name="visualise" value="true"/>
+                <param name="log_out" value="true"/>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression="AGUCUAUCUGGGGUACUAUCUA------UCGCUACGUACUAGCUUACGUACUGACUUA--CGCUACGUACUAGCUUACGUACUGACUUA----"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                    <has_line_matching expression="remove_gap_only\s+89,90,91" />
+                </assert_contents>
+            </output>
+            <output name="output_log">
+                 <assert_contents>
+                        <has_text text="Command Line Args:"/>
+                </assert_contents>
+            </output>
+            <output name="plot_input" ftype="png">
+                <assert_contents>
+                    <has_size size="17k" delta="1k"/>
+                </assert_contents>
+            </output>
+            <output name="plot_output" ftype="png">
+                <assert_contents>
+                    <has_size size="17k" delta="1k"/>
+                </assert_contents>
+            </output>
+            <output name="plot_markup" ftype="png">
+                <assert_contents>
+                    <has_size size="18k" delta="1k"/>
+                </assert_contents>
+            </output>
+            <output name="plot_markup_legend" ftype="png">
+                <assert_contents>
+                    <has_size size="11k" delta="1k"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 5 "remove divergent"" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="cleaning_options">
+                <conditional name="remove_divergent_cond">
+                    <param name="remove_divergent_param" value="true"/>
+                    <param name="remove_divergent_minperc" value="0.9"/>
+                    <repeat name="remove_divergent_retain_seqs">
+                        <param name="remove_divergent_retain" value="Seq1"/>
+                    </repeat>
+                    <repeat name="remove_divergent_retain_seqs">
+                        <param name="remove_divergent_retain" value="Seq2"/>
+                    </repeat>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="10"/>
+                    <not_has_text text="Seq4"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_text text="remove_divergent"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 6 "remove rare insertion"" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="cleaning_options">
+                <conditional name="remove_insertions_cond">
+                    <param name="remove_insertions_param" value="true"/>
+                    <param name="insertion_min_size" value="3"/>
+                    <param name="insertion_max_size" value="150"/>
+                    <param name="insertion_min_flank" value="5"/>
+                    <param name="insertion_min_perc" value="0.6"/>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression="AGUCUAUCUGGGGUACUAUCUAUCGCUACGUACUAGCUUACGUACUGACUUA--CGCUACGUACUAGCUUACGUACUGACUUA----"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line_matching expression="remove_gap_only\s+89,90,91"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 7 "Crop Sequence Ends"" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="cleaning_options">
+                <conditional name="crop_ends_cond">
+                    <param name="crop_ends_param" value="true"/>
+                    <param name="crop_ends_mingap_perc" value="0.05"/>
+                    <param name="crop_ends_redefine_perc" value="0.1"/>
+                    <repeat name="crop_ends_retain_strings">
+                        <param name="crop_ends_retain_str" value="q7"/>
+                    </repeat>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression="AUUCUAUCUGGGUACUAUUGGG------UUAUCUCUACUUACUAUCUUACAGACUUGGUUA----------------------------AAAA"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line_matching expression="remove_gap_only\s+89,90,91"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 8 "Remove Short Sequences"" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="cleaning_options">
+                <conditional name="remove_short_cond">
+                    <param name="remove_short_param" value="true"/>
+                    <param name="remove_min_length" value="70"/>
+                    <repeat name="remove_short_retain_seqs">
+                        <param name="remove_short_retain" value="Seq1"/>
+                    </repeat>
+                    <repeat name="remove_short_retain_strings">
+                        <param name="remove_short_retain_str" value="q2"/>
+                    </repeat>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="8"/>
+                    <not_has_text text="Seq5"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_text text="remove_too_short"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 9 "Crop Divergent" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="cleaning_options">
+                <conditional name="crop_divergent_cond">
+                    <param name="crop_divergent_param" value="true"/>
+                    <param name="crop_divergent_min_prop_ident" value="0.5"/>
+                    <param name="crop_divergent_min_prop_nongap" value="0.5"/>
+                    <param name="crop_divergent_buffer_size" value="5"/>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression="AUUCUAUC------UAUUGG--------UUAUCU-------------------------------------------------------"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                    <has_line_matching expression="crop_divergent\s+89,90,91,92,93,94,95"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 10 "Retain" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="cleaning_options">
+                <conditional name="remove_short_cond">
+                    <param name="remove_short_param" value="true"/>
+                    <param name="remove_min_length" value="90"/>
+                </conditional>
+                <conditional name="retain_cond">
+                    <param name="retain_param" value="true"/>
+                    <repeat name="retain_seqs">
+                        <param name="retain" value="Seq1"/>
+                    </repeat>
+                    <repeat name="retain_strings">
+                        <param name="retain_str" value="q2"/>
+                    </repeat>
+                </conditional>
+                <param name="keep_gaponly" value="true"/>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="4"/>
+                    <not_has_text text="Seq3"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                    <has_text text="remove_too_short"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 11 "Visualise basic options + settings" -->
+        <test expect_num_outputs="6">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="visualisation_options">
+                <section name="basic_visualisation_options">
+                    <param name="plot_consensus_identity" value="true"/>
+                    <param name="plot_consensus_similarity" value="true"/>
+                    <param name="plot_markup" value="true"/>
+                    <conditional name="output_settings_cond">
+                        <param name="output_settings_param" value="true"/>
+                        <param name="plot_width" value="5"/>
+                        <param name="plot_height" value="3"/>
+                        <param name="plot_dpi" value="300"/>
+                        <param name="plot_keep_numbers" value="true"/>
+                        <param name="plot_force_numbers" value="false"/>
+                        <param name="plot_identity_palette" value="bone"/>
+                        <param name="plot_identity_gap_col" value="#ffffff"/>
+                        <param name="plot_similarity_palette" value="bone"/>
+                        <param name="plot_similarity_gap_col" value="#ffffff"/>
+                        <param name="palette" value="CBS"/>
+                    </conditional>
+                </section>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                    <has_line_matching expression="remove_gap_only\s+89,90,91"/>
+                </assert_contents>
+            </output>
+            <output name="plot_consensus_identity" ftype="png">
+                <assert_contents>
+                    <has_size size="14k" delta="1k"/>
+                </assert_contents>
+            </output>
+            <output name="plot_consensus_similarity" ftype="png">
+                <assert_contents>
+                    <has_size size="14k" delta="1k"/>
+                </assert_contents>
+            </output>
+            <output name="plot_markup" ftype="png">
+                <assert_contents>
+                    <has_size size="17k" delta="2k"/>
+                </assert_contents>
+            </output>
+            <output name="plot_markup_legend" ftype="png">
+                <assert_contents>
+                    <has_size size="11k" delta="1k"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 14 "Visualise statistics plots and settings" -->
+         <test expect_num_outputs="3">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="visualisation_options">
+                <section name="statistics_plots">
+                    <param name="plot_stats_input" value="true"/>
+                    <section name="stats_settings">
+                        <param name="plot_stats_dpi" value="300"/>
+                        <param name="plot_stats_width" value="5"/>
+                        <param name="plot_stats_height" value="3"/>
+                    </section>
+                </section>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plot_stats_input" type="list" count="5">
+                <element name="changefreq" ftype="png">
+                    <assert_contents>
+                        <has_size size="61k" delta="3k"/>
+                    </assert_contents>
+                </element>
+                <element name="coverage" ftype="png">
+                    <assert_contents>
+                        <has_size size="63k" delta="3k"/>
+                    </assert_contents>
+                </element>
+                <element name="information_content" ftype="png">
+                    <assert_contents>
+                        <has_size size="89k" delta="3k"/>
+                    </assert_contents>
+                </element>
+                <element name="shannon_entropy" ftype="png">
+                    <assert_contents>
+                        <has_size size="91k" delta="3k"/>
+                    </assert_contents>
+                </element>
+                <element name="resfreq" ftype="png">
+                    <assert_contents>
+                        <has_size size="77k" delta="3k"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+        </test>
+        <!-- Test 15 "Consensus Sequences" -->
+        <test expect_num_outputs="4">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="interpretation_options">
+                <conditional name="consensus_sequences_cond">
+                    <param name="consensus_sequences_param" value="true"/>
+                    <param name="consensus_type" value="majority"/>
+                    <param name="consensus_keep_gaps" value="true"/>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+            <output name="output_consensus" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line_matching expression=">consensus"/>
+                </assert_contents>
+            </output>
+            <output name="output_with_consensus" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="16"/>
+                    <has_line_matching expression=">consensus"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 16 "Position Matrices" -->
+        <test expect_num_outputs="7">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="interpretation_options">
+                <section name="position_matrices">
+                    <param name="pwm_input" value="true"/>
+                    <section name="matrices_settings">
+                        <param name="pwm_start" value="1"/>
+                        <param name="pwm_end" value="100"/>
+                        <param name="pwm_freqtype" value="equal"/>
+                        <param name="pwm_alphatype" value="calc"/>
+                        <param name="pwm_alphaval" value="1"/>
+                    </section>
+                    <param name="pwm_output_blamm" value="true"/>
+                    <param name="pwm_output_meme" value="true"/>
+                </section>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+            <output name="pwm_input" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="5"/>
+                </assert_contents>
+            </output>
+            <output name="ppm_input" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="5"/>
+                </assert_contents>
+            </output>
+            <output name="pfm_input" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="5"/>
+                </assert_contents>
+            </output>
+            <output name="ppm_meme_input" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="103"/>
+                </assert_contents>
+            </output>
+            <output name="blamm_input" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="5"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 17 "Similarity Sequences" -->
+        <test expect_num_outputs="3">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="interpretation_options">
+                <section name="similarity_matrices">
+                    <param name="make_similarity_matrix_input" value="true"/>
+                    <section name="similarity_matrices_settings">
+                        <param name="make_simmatrix_keepgaps" value="0"/>
+                        <param name="make_simmatrix_dp" value="4"/>
+                        <param name="make_simmatrix_minoverlap" value="1"/>
+                    </section>
+                </section>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+            <output name="input_similarity" ftype="tsv">
+                <assert_contents>
+                    <has_n_lines n="8"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 18 "Extract Part of Alignment" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="editing_functions">
+                <conditional name="get_section_cond">
+                    <param name="get_section_param" value="true"/>
+                    <param name="section_start" value="10"/>
+                    <param name="section_end" value="50"/>
+                </conditional>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 19 "Replace U ↔ T" -->
+        <test expect_num_outputs="3">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="editing_functions">
+                <param name="replace_input_ut" value="true"/>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+            <output name="T_input" ftype="fasta">
+                <assert_contents>
+                    <not_has_text text="U"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 20 "Unalign (remove gaps)" -->
+        <test expect_num_outputs="3">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="editing_functions">
+                <param name="unalign_input" value="true"/>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+            <output name="unaligned_input" ftype="fasta">
+                <assert_contents>
+                    <not_has_text text="-"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 21 "Remove Duplicates" -->
+        <test expect_num_outputs="2">
+            <param name="input" value="example1.fasta" ftype="fasta"/>
+            <section name="editing_functions">
+                <param name="deduplicate_ids" value="true"/>
+            </section>
+            <output name="output_cleaned" ftype="fasta">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line_matching expression=">Seq1"/>
+                </assert_contents>
+            </output>
+            <output name="output_removed" ftype="txt">
+                <assert_contents>
+                    <has_n_lines n="1"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <expand macro="help"/>
+    <citations>
+        <citation type="doi">10.7717/peerj.12983</citation>
+    </citations>
+    <expand macro="creator"/>
+</tool>