Mercurial > repos > iuc > circos
comparison test-data/1/1.gff3 @ 0:ef5f8bbf7730 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/circos commit a41493893bdcbe330434db9c5851719012b62fa8
author | iuc |
---|---|
date | Wed, 09 Aug 2017 09:52:52 -0400 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:ef5f8bbf7730 |
---|---|
1 ##gff-version 3 | |
2 # Note: See http://song.sourceforge.net | |
3 ctgA example contig 1 50001 . . . Name=ctgA | |
4 ctgA example remark 1659 1984 1110 + . Name=f07;Note=This is an example | |
5 ctgA example remark 3014 6130 999 + . Name=f06;Note=This is another example | |
6 ctgA example remark 4715 5968 444 - . Name=f05;Note=Ok! Ok! I get the message. | |
7 ctgA example remark 13280 16394 203 + . Name=f08 | |
8 ctgA example remark 15329 15533 1000 + . Name=f10 | |
9 ctgA example remark 19157 22915 100 - . Name=f13 | |
10 ctgA example remark 22132 24633 320 + . Name=f15 | |
11 ctgA example remark 23072 23185 850 + . Name=f14 | |
12 ctgA example remark 24562 28338 208 + . Name=f02 | |
13 ctgA example remark 36034 38167 100 + . Name=f09 | |
14 ctgA example remark 36649 40440 300 - . Name=f03 | |
15 ctgA example remark 37242 38653 10 + . Name=f04 | |
16 ctgA example remark 44705 47713 400 - . Name=f01 | |
17 ctgA example remark 46990 48410 100 - . Name=f11 | |
18 ctgA example remark 49758 50000 3040 - . Name=f12 | |
19 | |
20 ctgA example SNP 1000 1000 0.987 . . ID=FakeSNP1;Name=FakeSNP;Note=This is a fake SNP that should appear at 1000 with length 1 | |
21 | |
22 ctgA example remark 1000 2000 . . . Name=Remark:hga;Alias=hga | |
23 ctgA example protein_coding_primary_transcript 1100 2000 . + . Name=Gene:hga;Alias=hga | |
24 ctgA example polypeptide 1200 1900 . + . Name=Protein:HGA;Alias=hga | |
25 ctgA example protein_coding_primary_transcript 1600 3000 . - . Name=Gene:hgb;Alias=hgb | |
26 ctgA example polypeptide 1800 2900 . - . Name=Protein:HGB;Alias=hgb | |
27 | |
28 ctgA example polypeptide_domain 11911 15561 . + 502 Name=m11;Note=kinase | |
29 ctgA example polypeptide_domain 13801 14007 . - 415 Name=m05;Note=helix loop helix | |
30 ctgA example polypeptide_domain 14731 17239 . - 746 Name=m14;Note=kinase | |
31 ctgA example polypeptide_domain 15396 16159 . + 40 Name=m03;Note=zinc finger | |
32 ctgA example polypeptide_domain 17023 17675 . + 830 Name=m08;Note=7-transmembrane | |
33 ctgA example polypeptide_domain 17667 17690 . + 943 Name=m13;Note=DEAD box | |
34 ctgA example polypeptide_domain 18048 18552 . - 658 Name=m07;Note=7-transmembrane | |
35 ctgA example polypeptide_domain 21748 25612 . + 467 Name=m12;Note=kinase | |
36 ctgA example polypeptide_domain 28332 30033 . - 711 Name=m02;Note=HOX | |
37 ctgA example polypeptide_domain 28342 28447 . - 533 Name=m10;Note=DEAD box | |
38 ctgA example polypeptide_domain 30578 31748 . + 646 Name=m06;Note=SUSHI repeat | |
39 ctgA example polypeptide_domain 33325 35791 . + 479 Name=m04;Note=Ig-like | |
40 ctgA example polypeptide_domain 37497 40559 . - 711 Name=m15;Note=7-transmembrane | |
41 ctgA example polypeptide_domain 46012 48851 . + 533 Name=m09;Note=kinase | |
42 ctgA example polypeptide_domain 48253 48366 . + 646 Name=m01;Note=WD40 | |
43 | |
44 ctgA example match 32329 32359 . + 825 Name=seg01 | |
45 ctgA example match 26122 26126 . + 185 Name=seg02 | |
46 ctgA example match 26497 26869 . + 502 Name=seg02 | |
47 ctgA example match 27201 27325 . + 442 Name=seg02 | |
48 ctgA example match 27372 27433 . + 970 Name=seg02 | |
49 ctgA example match 27565 27565 . + 519 Name=seg02 | |
50 ctgA example match 27813 28091 . + 592 Name=seg02 | |
51 ctgA example match 28093 28201 . + 475 Name=seg02 | |
52 ctgA example match 28329 28377 . + 17 Name=seg02 | |
53 ctgA example match 28829 29194 . + 276 Name=seg02 | |
54 ctgA example match 29517 29702 . + 492 Name=seg02 | |
55 ctgA example match 29713 30061 . + 465 Name=seg02 | |
56 ctgA example match 30329 30774 . + 525 Name=seg02 | |
57 ctgA example match 30808 31306 . + 619 Name=seg02 | |
58 ctgA example match 31516 31729 . + 248 Name=seg02 | |
59 ctgA example match 31753 32154 . + 613 Name=seg02 | |
60 ctgA example match 32595 32696 . + 701 Name=seg02 | |
61 ctgA example match 32892 32901 . + 724 Name=seg02 | |
62 ctgA example match 33127 33388 . + 977 Name=seg02 | |
63 ctgA example match 33439 33443 . + 502 Name=seg02 | |
64 ctgA example match 33759 34209 . + 415 Name=seg02 | |
65 ctgA example match 34401 34466 . + 746 Name=seg02 | |
66 ctgA example match 6885 7241 . - 40 Name=seg03 | |
67 ctgA example match 7410 7737 . - 830 Name=seg03 | |
68 ctgA example match 8055 8080 . - 943 Name=seg03 | |
69 ctgA example match 8306 8999 . - 658 Name=seg03 | |
70 ctgA example match 5233 5302 . - 467 Name=seg04 | |
71 ctgA example match 5800 6101 . - 711 Name=seg04 | |
72 ctgA example match 6442 6854 . - 533 Name=seg04 | |
73 ctgA example match 7106 7211 . - 646 Name=seg04 | |
74 ctgA example match 7695 8177 . - 479 Name=seg04 | |
75 ctgA example match 8545 8783 . - 568 Name=seg04 | |
76 ctgA example match 8869 8935 . - 62 Name=seg04 | |
77 ctgA example match 9404 9825 . - 191 Name=seg04 | |
78 ctgA example match 26503 26799 . - 645 Name=seg05 | |
79 ctgA example match 27172 27185 . - 774 Name=seg05 | |
80 ctgA example match 27448 27860 . - 643 Name=seg05 | |
81 ctgA example match 27887 28076 . - 361 Name=seg05 | |
82 ctgA example match 28225 28316 . - 444 Name=seg05 | |
83 ctgA example match 28777 29058 . - 109 Name=seg05 | |
84 ctgA example match 29513 29647 . - 67 Name=seg05 | |
85 ctgA example match 30108 30216 . - 964 Name=seg05 | |
86 ctgA example match 30465 30798 . - 563 Name=seg05 | |
87 ctgA example match 31232 31236 . - 313 Name=seg05 | |
88 ctgA example match 31421 31817 . - 530 Name=seg05 | |
89 ctgA example match 32010 32057 . - 788 Name=seg05 | |
90 ctgA example match 32208 32680 . - 441 Name=seg05 | |
91 ctgA example match 33053 33325 . - 152 Name=seg05 | |
92 ctgA example match 33438 33868 . - 226 Name=seg05 | |
93 ctgA example match 34244 34313 . - 838 Name=seg05 | |
94 ctgA example match 34605 34983 . - 529 Name=seg05 | |
95 ctgA example match 35333 35507 . - 822 Name=seg05 | |
96 ctgA example match 35642 35904 . - 107 Name=seg05 | |
97 ctgA example match 19249 19559 . + 404 Name=seg06 | |
98 ctgA example match 19975 20260 . + 882 Name=seg06 | |
99 ctgA example match 20379 20491 . + 16 Name=seg06 | |
100 ctgA example match 20533 21005 . + 645 Name=seg06 | |
101 ctgA example match 21122 21331 . + 237 Name=seg06 | |
102 ctgA example match 21682 22176 . + 36 Name=seg06 | |
103 ctgA example match 22374 22570 . + 893 Name=seg06 | |
104 ctgA example match 23025 23427 . + 169 Name=seg06 | |
105 ctgA example match 44191 44514 . - 295 Name=seg07 | |
106 ctgA example match 44552 45043 . - 645 Name=seg07 | |
107 ctgA example match 45373 45600 . - 683 Name=seg07 | |
108 ctgA example match 45897 46315 . - 580 Name=seg07 | |
109 ctgA example match 46491 46890 . - 291 Name=seg07 | |
110 ctgA example match 47126 47297 . - 880 Name=seg07 | |
111 ctgA example match 47735 47983 . - 587 Name=seg07 | |
112 ctgA example match 48447 48709 . - 159 Name=seg07 | |
113 ctgA example match 48931 49186 . - 496 Name=seg07 | |
114 ctgA example match 49472 49699 . - 921 Name=seg07 | |
115 ctgA example match 49957 50000 . - 226 Name=seg07 | |
116 ctgA example match 18509 18985 . + 915 Name=seg08 | |
117 ctgA example match 18989 19388 . + 791 Name=seg08 | |
118 ctgA example match 19496 19962 . + 600 Name=seg08 | |
119 ctgA example match 20093 20580 . + 140 Name=seg08 | |
120 ctgA example match 20970 21052 . + 460 Name=seg08 | |
121 ctgA example match 21270 21277 . + 228 Name=seg08 | |
122 ctgA example match 21685 22168 . + 373 Name=seg08 | |
123 ctgA example match 22564 22869 . + 570 Name=seg08 | |
124 ctgA example match 22958 23298 . + 831 Name=seg08 | |
125 ctgA example match 23412 23469 . + 811 Name=seg08 | |
126 ctgA example match 23932 23932 . + 22 Name=seg08 | |
127 ctgA example match 24328 24787 . + 894 Name=seg08 | |
128 ctgA example match 25228 25367 . + 463 Name=seg08 | |
129 ctgA example match 36616 37057 . - 736 Name=seg09 | |
130 ctgA example match 37208 37227 . - 409 Name=seg09 | |
131 ctgA example match 29771 29942 . + 402 Name=seg10 | |
132 ctgA example match 30042 30340 . + 513 Name=seg10 | |
133 ctgA example match 30810 31307 . + 22 Name=seg10 | |
134 ctgA example match 31761 31984 . + 228 Name=seg10 | |
135 ctgA example match 32374 32937 . + 752 Name=seg10 | |
136 ctgA example match 24228 24510 . + 35 Name=seg11 | |
137 ctgA example match 24868 25012 . + 276 Name=seg11 | |
138 ctgA example match 25212 25426 . + 709 Name=seg11 | |
139 ctgA example match 25794 25874 . + 666 Name=seg11 | |
140 ctgA example match 26075 26519 . + 604 Name=seg11 | |
141 ctgA example match 26930 26940 . + 31 Name=seg11 | |
142 ctgA example match 26975 27063 . + 764 Name=seg11 | |
143 ctgA example match 27415 27799 . + 973 Name=seg11 | |
144 ctgA example match 27880 27943 . + 823 Name=seg11 | |
145 ctgA example match 28225 28346 . + 931 Name=seg11 | |
146 ctgA example match 28375 28570 . + 697 Name=seg11 | |
147 ctgA example match 28758 29041 . + 241 Name=seg11 | |
148 ctgA example match 29101 29302 . + 343 Name=seg11 | |
149 ctgA example match 29604 29702 . + 771 Name=seg11 | |
150 ctgA example match 29867 29885 . + 147 Name=seg11 | |
151 ctgA example match 30241 30246 . + 949 Name=seg11 | |
152 ctgA example match 30575 30738 . + 928 Name=seg11 | |
153 ctgA example match 12531 12895 . + 693 Name=seg12 | |
154 ctgA example match 13122 13449 . + 750 Name=seg12 | |
155 ctgA example match 13452 13745 . + 502 Name=seg12 | |
156 ctgA example match 13908 13965 . + 177 Name=seg12 | |
157 ctgA example match 13998 14488 . + 605 Name=seg12 | |
158 ctgA example match 14564 14899 . + 939 Name=seg12 | |
159 ctgA example match 15185 15276 . + 249 Name=seg12 | |
160 ctgA example match 15639 15736 . + 597 Name=seg12 | |
161 ctgA example match 15745 15870 . + 364 Name=seg12 | |
162 ctgA example match 49406 49476 . + 706 Name=seg13 | |
163 ctgA example match 49762 50000 . + 605 Name=seg13 | |
164 ctgA example match 41137 41318 . - 729 Name=seg14 | |
165 ctgA example match 41754 41948 . - 21 Name=seg14 | |
166 ctgA example match 42057 42474 . - 63 Name=seg14 | |
167 ctgA example match 42890 43270 . - 356 Name=seg14 | |
168 ctgA example match 43395 43811 . - 70 Name=seg14 | |
169 ctgA example match 44065 44556 . - 430 Name=seg14 | |
170 ctgA example match 44763 45030 . - 730 Name=seg14 | |
171 ctgA example match 45231 45488 . - 531 Name=seg14 | |
172 ctgA example match 45790 46022 . - 247 Name=seg14 | |
173 ctgA example match 46092 46318 . - 552 Name=seg14 | |
174 ctgA example match 46816 46992 . - 547 Name=seg14 | |
175 ctgA example match 47449 47829 . - 879 Name=seg14 | |
176 ctgA example match 39265 39361 . - 750 Name=seg15 | |
177 ctgA example match 39753 40034 . - 875 Name=seg15 | |
178 ctgA example match 40515 40954 . - 135 Name=seg15 | |
179 ctgA example match 41252 41365 . - 534 Name=seg15 | |
180 ctgA example match 41492 41504 . - 653 Name=seg15 | |
181 ctgA example match 41941 42377 . - 374 Name=seg15 | |
182 ctgA example match 42748 42954 . - 847 Name=seg15 | |
183 ctgA example match 43401 43897 . - 15 Name=seg15 | |
184 ctgA example match 44043 44113 . - 905 Name=seg15 | |
185 ctgA example match 44399 44888 . - 868 Name=seg15 | |
186 ctgA example match 45281 45375 . - 462 Name=seg15 | |
187 ctgA example match 45711 46041 . - 262 Name=seg15 | |
188 ctgA example match 46425 46564 . - 823 Name=seg15 | |
189 ctgA example match 46738 47087 . - 7 Name=seg15 | |
190 ctgA example match 47329 47595 . - 928 Name=seg15 | |
191 ctgA example match 47858 47979 . - 64 Name=seg15 | |
192 ctgA example match 48169 48453 . - 305 Name=seg15 | |
193 | |
194 # single exon gene - one CDS only | |
195 ctgA bare_predicted CDS 10000 11500 . + 0 Name=Apple1;Note=CDS with no parent | |
196 | |
197 # multi-exon gene - several linked CDSs | |
198 ctgA predicted mRNA 13000 17200 . + 0 ID=cds-Apple2;Name=Apple2;Note=mRNA with CDSs but no UTRs | |
199 ctgA predicted CDS 13500 13800 . + 0 Parent=cds-Apple2 | |
200 ctgA predicted CDS 15000 15500 . + 1 Parent=cds-Apple2 | |
201 ctgA predicted CDS 16500 17000 . + 2 Parent=cds-Apple2 | |
202 | |
203 ctgA exonerate mRNA 17400 23000 . + . ID=rna-Apple3;Name=Apple3;Note=mRNA with both CDSs and UTRs | |
204 ctgA exonerate UTR 17400 17999 . + . Parent=rna-Apple3 | |
205 ctgA exonerate CDS 18000 18800 . + 0 Parent=rna-Apple3 | |
206 ctgA exonerate CDS 19000 19500 . + 1 Parent=rna-Apple3 | |
207 ctgA exonerate CDS 21000 21200 . + 2 Parent=rna-Apple3 | |
208 ctgA exonerate UTR 21201 23000 . + . Parent=rna-Apple3 | |
209 | |
210 ctgA example gene 1050 9000 . + . ID=EDEN;Name=EDEN;Note=protein kinase | |
211 ctgA example mRNA 1050 9000 . + . ID=EDEN.1;Parent=EDEN;Name=EDEN.1;Note=Eden splice form 1;Index=1 | |
212 ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.1 | |
213 ctgA example CDS 1201 1500 . + 0 Parent=EDEN.1 | |
214 ctgA example CDS 3000 3902 . + 0 Parent=EDEN.1 | |
215 ctgA example CDS 5000 5500 . + 0 Parent=EDEN.1 | |
216 ctgA example CDS 7000 7608 . + 0 Parent=EDEN.1 | |
217 ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.1 | |
218 | |
219 ctgA example mRNA 1050 9000 . + . ID=EDEN.2;Parent=EDEN;Name=EDEN.2;Note=Eden splice form 2;Index=1 | |
220 ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.2 | |
221 ctgA example CDS 1201 1500 . + 0 Parent=EDEN.2 | |
222 ctgA example CDS 5000 5500 . + 0 Parent=EDEN.2 | |
223 ctgA example CDS 7000 7608 . + 0 Parent=EDEN.2 | |
224 ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.2 | |
225 | |
226 ctgA example mRNA 1300 9000 . + . ID=EDEN.3;Parent=EDEN;Name=EDEN.3;Note=Eden splice form 3;Index=1 | |
227 ctgA example five_prime_UTR 1300 1500 . + . Parent=EDEN.3 | |
228 ctgA example five_prime_UTR 3000 3300 . + . Parent=EDEN.3 | |
229 ctgA example CDS 3301 3902 . + 0 Parent=EDEN.3 | |
230 ctgA example CDS 5000 5500 . + 1 Parent=EDEN.3 | |
231 ctgA example CDS 7000 7600 . + 1 Parent=EDEN.3 | |
232 ctgA example three_prime_UTR 7601 9000 . + . Parent=EDEN.3 | |
233 | |
234 ctgA example BAC 1000 20000 . . . ID=b101.2;Name=b101.2;Note=Fingerprinted BAC with end reads | |
235 ctgA example clone_start 1000 1500 . + . Parent=b101.2 | |
236 ctgA example clone_end 19500 20000 . - . Parent=b101.2 | |
237 | |
238 ctgA est EST_match 1050 3202 . + . ID=Match1;Name=agt830.5;Target=agt830.5 1 654 | |
239 ctgA est match_part 1050 1500 . + . Parent=Match1;Name=agt830.5;Target=agt830.5 1 451 | |
240 ctgA est match_part 3000 3202 . + . Parent=Match1;Name=agt830.5;Target=agt830.5 452 654 | |
241 | |
242 ctgA est EST_match 5410 7503 . - . ID=Match2;Name=agt830.3;Target=agt830.3 1 595 | |
243 ctgA est match_part 5410 5500 . - . Parent=Match2;Name=agt830.3;Target=agt830.3 505 595 | |
244 ctgA est match_part 7000 7503 . - . Parent=Match2;Name=agt830.3;Target=agt830.3 1 504 | |
245 | |
246 ctgA est EST_match 1050 7300 . + . ID=Match3;Name=agt221.5;Target=agt221.5 1 1253 | |
247 ctgA est match_part 1050 1500 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 1 451 | |
248 ctgA est match_part 5000 5500 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 452 952 | |
249 ctgA est match_part 7000 7300 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 953 1253 | |
250 | |
251 ctgA est EST_match 7500 8000 . - . ID=Match4;Name=agt221.3;Target=agt221.3 1 501 | |
252 | |
253 ctgA est EST_match 1150 7200 . + . ID=Match5;Name=agt767.5;Target=agt767.5 1 1153 | |
254 ctgA est match_part 1150 1500 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 1 351 | |
255 ctgA est match_part 5000 5500 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 352 852 | |
256 ctgA est match_part 7000 7200 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 853 1153 | |
257 | |
258 ctgA est EST_match 8000 9000 . - . ID=Match6;Name=agt767.3;Target=agt767.3 1 1001 | |
259 | |
260 | |
261 | |
262 ctgB example contig 1 6079 . . . Name=ctgB | |
263 ctgB example remark 1659 1984 . + . Name=f07;Note=This is an example | |
264 ctgB example remark 3014 6130 . + . Name=f06;Note=This is another example | |
265 ctgB example remark 4715 5968 . - . Name=f05;Note=ああ、この機能は、世界中を旅しています! | |
266 ##FASTA | |
267 >foobar | |
268 ACTGATGATCGCTAGATGCTCGACTAGC |