Mercurial > repos > iuc > circos
diff test-data/1/1.gff3 @ 0:ef5f8bbf7730 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/circos commit a41493893bdcbe330434db9c5851719012b62fa8
author | iuc |
---|---|
date | Wed, 09 Aug 2017 09:52:52 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/1/1.gff3 Wed Aug 09 09:52:52 2017 -0400 @@ -0,0 +1,268 @@ +##gff-version 3 +# Note: See http://song.sourceforge.net +ctgA example contig 1 50001 . . . Name=ctgA +ctgA example remark 1659 1984 1110 + . Name=f07;Note=This is an example +ctgA example remark 3014 6130 999 + . Name=f06;Note=This is another example +ctgA example remark 4715 5968 444 - . Name=f05;Note=Ok! Ok! I get the message. +ctgA example remark 13280 16394 203 + . Name=f08 +ctgA example remark 15329 15533 1000 + . Name=f10 +ctgA example remark 19157 22915 100 - . Name=f13 +ctgA example remark 22132 24633 320 + . Name=f15 +ctgA example remark 23072 23185 850 + . Name=f14 +ctgA example remark 24562 28338 208 + . Name=f02 +ctgA example remark 36034 38167 100 + . Name=f09 +ctgA example remark 36649 40440 300 - . Name=f03 +ctgA example remark 37242 38653 10 + . Name=f04 +ctgA example remark 44705 47713 400 - . Name=f01 +ctgA example remark 46990 48410 100 - . Name=f11 +ctgA example remark 49758 50000 3040 - . Name=f12 + +ctgA example SNP 1000 1000 0.987 . . ID=FakeSNP1;Name=FakeSNP;Note=This is a fake SNP that should appear at 1000 with length 1 + +ctgA example remark 1000 2000 . . . Name=Remark:hga;Alias=hga +ctgA example protein_coding_primary_transcript 1100 2000 . + . Name=Gene:hga;Alias=hga +ctgA example polypeptide 1200 1900 . + . Name=Protein:HGA;Alias=hga +ctgA example protein_coding_primary_transcript 1600 3000 . - . Name=Gene:hgb;Alias=hgb +ctgA example polypeptide 1800 2900 . - . Name=Protein:HGB;Alias=hgb + +ctgA example polypeptide_domain 11911 15561 . + 502 Name=m11;Note=kinase +ctgA example polypeptide_domain 13801 14007 . - 415 Name=m05;Note=helix loop helix +ctgA example polypeptide_domain 14731 17239 . - 746 Name=m14;Note=kinase +ctgA example polypeptide_domain 15396 16159 . + 40 Name=m03;Note=zinc finger +ctgA example polypeptide_domain 17023 17675 . + 830 Name=m08;Note=7-transmembrane +ctgA example polypeptide_domain 17667 17690 . + 943 Name=m13;Note=DEAD box +ctgA example polypeptide_domain 18048 18552 . - 658 Name=m07;Note=7-transmembrane +ctgA example polypeptide_domain 21748 25612 . + 467 Name=m12;Note=kinase +ctgA example polypeptide_domain 28332 30033 . - 711 Name=m02;Note=HOX +ctgA example polypeptide_domain 28342 28447 . - 533 Name=m10;Note=DEAD box +ctgA example polypeptide_domain 30578 31748 . + 646 Name=m06;Note=SUSHI repeat +ctgA example polypeptide_domain 33325 35791 . + 479 Name=m04;Note=Ig-like +ctgA example polypeptide_domain 37497 40559 . - 711 Name=m15;Note=7-transmembrane +ctgA example polypeptide_domain 46012 48851 . + 533 Name=m09;Note=kinase +ctgA example polypeptide_domain 48253 48366 . + 646 Name=m01;Note=WD40 + +ctgA example match 32329 32359 . + 825 Name=seg01 +ctgA example match 26122 26126 . + 185 Name=seg02 +ctgA example match 26497 26869 . + 502 Name=seg02 +ctgA example match 27201 27325 . + 442 Name=seg02 +ctgA example match 27372 27433 . + 970 Name=seg02 +ctgA example match 27565 27565 . + 519 Name=seg02 +ctgA example match 27813 28091 . + 592 Name=seg02 +ctgA example match 28093 28201 . + 475 Name=seg02 +ctgA example match 28329 28377 . + 17 Name=seg02 +ctgA example match 28829 29194 . + 276 Name=seg02 +ctgA example match 29517 29702 . + 492 Name=seg02 +ctgA example match 29713 30061 . + 465 Name=seg02 +ctgA example match 30329 30774 . + 525 Name=seg02 +ctgA example match 30808 31306 . + 619 Name=seg02 +ctgA example match 31516 31729 . + 248 Name=seg02 +ctgA example match 31753 32154 . + 613 Name=seg02 +ctgA example match 32595 32696 . + 701 Name=seg02 +ctgA example match 32892 32901 . + 724 Name=seg02 +ctgA example match 33127 33388 . + 977 Name=seg02 +ctgA example match 33439 33443 . + 502 Name=seg02 +ctgA example match 33759 34209 . + 415 Name=seg02 +ctgA example match 34401 34466 . + 746 Name=seg02 +ctgA example match 6885 7241 . - 40 Name=seg03 +ctgA example match 7410 7737 . - 830 Name=seg03 +ctgA example match 8055 8080 . - 943 Name=seg03 +ctgA example match 8306 8999 . - 658 Name=seg03 +ctgA example match 5233 5302 . - 467 Name=seg04 +ctgA example match 5800 6101 . - 711 Name=seg04 +ctgA example match 6442 6854 . - 533 Name=seg04 +ctgA example match 7106 7211 . - 646 Name=seg04 +ctgA example match 7695 8177 . - 479 Name=seg04 +ctgA example match 8545 8783 . - 568 Name=seg04 +ctgA example match 8869 8935 . - 62 Name=seg04 +ctgA example match 9404 9825 . - 191 Name=seg04 +ctgA example match 26503 26799 . - 645 Name=seg05 +ctgA example match 27172 27185 . - 774 Name=seg05 +ctgA example match 27448 27860 . - 643 Name=seg05 +ctgA example match 27887 28076 . - 361 Name=seg05 +ctgA example match 28225 28316 . - 444 Name=seg05 +ctgA example match 28777 29058 . - 109 Name=seg05 +ctgA example match 29513 29647 . - 67 Name=seg05 +ctgA example match 30108 30216 . - 964 Name=seg05 +ctgA example match 30465 30798 . - 563 Name=seg05 +ctgA example match 31232 31236 . - 313 Name=seg05 +ctgA example match 31421 31817 . - 530 Name=seg05 +ctgA example match 32010 32057 . - 788 Name=seg05 +ctgA example match 32208 32680 . - 441 Name=seg05 +ctgA example match 33053 33325 . - 152 Name=seg05 +ctgA example match 33438 33868 . - 226 Name=seg05 +ctgA example match 34244 34313 . - 838 Name=seg05 +ctgA example match 34605 34983 . - 529 Name=seg05 +ctgA example match 35333 35507 . - 822 Name=seg05 +ctgA example match 35642 35904 . - 107 Name=seg05 +ctgA example match 19249 19559 . + 404 Name=seg06 +ctgA example match 19975 20260 . + 882 Name=seg06 +ctgA example match 20379 20491 . + 16 Name=seg06 +ctgA example match 20533 21005 . + 645 Name=seg06 +ctgA example match 21122 21331 . + 237 Name=seg06 +ctgA example match 21682 22176 . + 36 Name=seg06 +ctgA example match 22374 22570 . + 893 Name=seg06 +ctgA example match 23025 23427 . + 169 Name=seg06 +ctgA example match 44191 44514 . - 295 Name=seg07 +ctgA example match 44552 45043 . - 645 Name=seg07 +ctgA example match 45373 45600 . - 683 Name=seg07 +ctgA example match 45897 46315 . - 580 Name=seg07 +ctgA example match 46491 46890 . - 291 Name=seg07 +ctgA example match 47126 47297 . - 880 Name=seg07 +ctgA example match 47735 47983 . - 587 Name=seg07 +ctgA example match 48447 48709 . - 159 Name=seg07 +ctgA example match 48931 49186 . - 496 Name=seg07 +ctgA example match 49472 49699 . - 921 Name=seg07 +ctgA example match 49957 50000 . - 226 Name=seg07 +ctgA example match 18509 18985 . + 915 Name=seg08 +ctgA example match 18989 19388 . + 791 Name=seg08 +ctgA example match 19496 19962 . + 600 Name=seg08 +ctgA example match 20093 20580 . + 140 Name=seg08 +ctgA example match 20970 21052 . + 460 Name=seg08 +ctgA example match 21270 21277 . + 228 Name=seg08 +ctgA example match 21685 22168 . + 373 Name=seg08 +ctgA example match 22564 22869 . + 570 Name=seg08 +ctgA example match 22958 23298 . + 831 Name=seg08 +ctgA example match 23412 23469 . + 811 Name=seg08 +ctgA example match 23932 23932 . + 22 Name=seg08 +ctgA example match 24328 24787 . + 894 Name=seg08 +ctgA example match 25228 25367 . + 463 Name=seg08 +ctgA example match 36616 37057 . - 736 Name=seg09 +ctgA example match 37208 37227 . - 409 Name=seg09 +ctgA example match 29771 29942 . + 402 Name=seg10 +ctgA example match 30042 30340 . + 513 Name=seg10 +ctgA example match 30810 31307 . + 22 Name=seg10 +ctgA example match 31761 31984 . + 228 Name=seg10 +ctgA example match 32374 32937 . + 752 Name=seg10 +ctgA example match 24228 24510 . + 35 Name=seg11 +ctgA example match 24868 25012 . + 276 Name=seg11 +ctgA example match 25212 25426 . + 709 Name=seg11 +ctgA example match 25794 25874 . + 666 Name=seg11 +ctgA example match 26075 26519 . + 604 Name=seg11 +ctgA example match 26930 26940 . + 31 Name=seg11 +ctgA example match 26975 27063 . + 764 Name=seg11 +ctgA example match 27415 27799 . + 973 Name=seg11 +ctgA example match 27880 27943 . + 823 Name=seg11 +ctgA example match 28225 28346 . + 931 Name=seg11 +ctgA example match 28375 28570 . + 697 Name=seg11 +ctgA example match 28758 29041 . + 241 Name=seg11 +ctgA example match 29101 29302 . + 343 Name=seg11 +ctgA example match 29604 29702 . + 771 Name=seg11 +ctgA example match 29867 29885 . + 147 Name=seg11 +ctgA example match 30241 30246 . + 949 Name=seg11 +ctgA example match 30575 30738 . + 928 Name=seg11 +ctgA example match 12531 12895 . + 693 Name=seg12 +ctgA example match 13122 13449 . + 750 Name=seg12 +ctgA example match 13452 13745 . + 502 Name=seg12 +ctgA example match 13908 13965 . + 177 Name=seg12 +ctgA example match 13998 14488 . + 605 Name=seg12 +ctgA example match 14564 14899 . + 939 Name=seg12 +ctgA example match 15185 15276 . + 249 Name=seg12 +ctgA example match 15639 15736 . + 597 Name=seg12 +ctgA example match 15745 15870 . + 364 Name=seg12 +ctgA example match 49406 49476 . + 706 Name=seg13 +ctgA example match 49762 50000 . + 605 Name=seg13 +ctgA example match 41137 41318 . - 729 Name=seg14 +ctgA example match 41754 41948 . - 21 Name=seg14 +ctgA example match 42057 42474 . - 63 Name=seg14 +ctgA example match 42890 43270 . - 356 Name=seg14 +ctgA example match 43395 43811 . - 70 Name=seg14 +ctgA example match 44065 44556 . - 430 Name=seg14 +ctgA example match 44763 45030 . - 730 Name=seg14 +ctgA example match 45231 45488 . - 531 Name=seg14 +ctgA example match 45790 46022 . - 247 Name=seg14 +ctgA example match 46092 46318 . - 552 Name=seg14 +ctgA example match 46816 46992 . - 547 Name=seg14 +ctgA example match 47449 47829 . - 879 Name=seg14 +ctgA example match 39265 39361 . - 750 Name=seg15 +ctgA example match 39753 40034 . - 875 Name=seg15 +ctgA example match 40515 40954 . - 135 Name=seg15 +ctgA example match 41252 41365 . - 534 Name=seg15 +ctgA example match 41492 41504 . - 653 Name=seg15 +ctgA example match 41941 42377 . - 374 Name=seg15 +ctgA example match 42748 42954 . - 847 Name=seg15 +ctgA example match 43401 43897 . - 15 Name=seg15 +ctgA example match 44043 44113 . - 905 Name=seg15 +ctgA example match 44399 44888 . - 868 Name=seg15 +ctgA example match 45281 45375 . - 462 Name=seg15 +ctgA example match 45711 46041 . - 262 Name=seg15 +ctgA example match 46425 46564 . - 823 Name=seg15 +ctgA example match 46738 47087 . - 7 Name=seg15 +ctgA example match 47329 47595 . - 928 Name=seg15 +ctgA example match 47858 47979 . - 64 Name=seg15 +ctgA example match 48169 48453 . - 305 Name=seg15 + +# single exon gene - one CDS only +ctgA bare_predicted CDS 10000 11500 . + 0 Name=Apple1;Note=CDS with no parent + +# multi-exon gene - several linked CDSs +ctgA predicted mRNA 13000 17200 . + 0 ID=cds-Apple2;Name=Apple2;Note=mRNA with CDSs but no UTRs +ctgA predicted CDS 13500 13800 . + 0 Parent=cds-Apple2 +ctgA predicted CDS 15000 15500 . + 1 Parent=cds-Apple2 +ctgA predicted CDS 16500 17000 . + 2 Parent=cds-Apple2 + +ctgA exonerate mRNA 17400 23000 . + . ID=rna-Apple3;Name=Apple3;Note=mRNA with both CDSs and UTRs +ctgA exonerate UTR 17400 17999 . + . Parent=rna-Apple3 +ctgA exonerate CDS 18000 18800 . + 0 Parent=rna-Apple3 +ctgA exonerate CDS 19000 19500 . + 1 Parent=rna-Apple3 +ctgA exonerate CDS 21000 21200 . + 2 Parent=rna-Apple3 +ctgA exonerate UTR 21201 23000 . + . Parent=rna-Apple3 + +ctgA example gene 1050 9000 . + . ID=EDEN;Name=EDEN;Note=protein kinase +ctgA example mRNA 1050 9000 . + . ID=EDEN.1;Parent=EDEN;Name=EDEN.1;Note=Eden splice form 1;Index=1 +ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.1 +ctgA example CDS 1201 1500 . + 0 Parent=EDEN.1 +ctgA example CDS 3000 3902 . + 0 Parent=EDEN.1 +ctgA example CDS 5000 5500 . + 0 Parent=EDEN.1 +ctgA example CDS 7000 7608 . + 0 Parent=EDEN.1 +ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.1 + +ctgA example mRNA 1050 9000 . + . ID=EDEN.2;Parent=EDEN;Name=EDEN.2;Note=Eden splice form 2;Index=1 +ctgA example five_prime_UTR 1050 1200 . + . Parent=EDEN.2 +ctgA example CDS 1201 1500 . + 0 Parent=EDEN.2 +ctgA example CDS 5000 5500 . + 0 Parent=EDEN.2 +ctgA example CDS 7000 7608 . + 0 Parent=EDEN.2 +ctgA example three_prime_UTR 7609 9000 . + . Parent=EDEN.2 + +ctgA example mRNA 1300 9000 . + . ID=EDEN.3;Parent=EDEN;Name=EDEN.3;Note=Eden splice form 3;Index=1 +ctgA example five_prime_UTR 1300 1500 . + . Parent=EDEN.3 +ctgA example five_prime_UTR 3000 3300 . + . Parent=EDEN.3 +ctgA example CDS 3301 3902 . + 0 Parent=EDEN.3 +ctgA example CDS 5000 5500 . + 1 Parent=EDEN.3 +ctgA example CDS 7000 7600 . + 1 Parent=EDEN.3 +ctgA example three_prime_UTR 7601 9000 . + . Parent=EDEN.3 + +ctgA example BAC 1000 20000 . . . ID=b101.2;Name=b101.2;Note=Fingerprinted BAC with end reads +ctgA example clone_start 1000 1500 . + . Parent=b101.2 +ctgA example clone_end 19500 20000 . - . Parent=b101.2 + +ctgA est EST_match 1050 3202 . + . ID=Match1;Name=agt830.5;Target=agt830.5 1 654 +ctgA est match_part 1050 1500 . + . Parent=Match1;Name=agt830.5;Target=agt830.5 1 451 +ctgA est match_part 3000 3202 . + . Parent=Match1;Name=agt830.5;Target=agt830.5 452 654 + +ctgA est EST_match 5410 7503 . - . ID=Match2;Name=agt830.3;Target=agt830.3 1 595 +ctgA est match_part 5410 5500 . - . Parent=Match2;Name=agt830.3;Target=agt830.3 505 595 +ctgA est match_part 7000 7503 . - . Parent=Match2;Name=agt830.3;Target=agt830.3 1 504 + +ctgA est EST_match 1050 7300 . + . ID=Match3;Name=agt221.5;Target=agt221.5 1 1253 +ctgA est match_part 1050 1500 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 1 451 +ctgA est match_part 5000 5500 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 452 952 +ctgA est match_part 7000 7300 . + . Parent=Match3;Name=agt221.5;Target=agt221.5 953 1253 + +ctgA est EST_match 7500 8000 . - . ID=Match4;Name=agt221.3;Target=agt221.3 1 501 + +ctgA est EST_match 1150 7200 . + . ID=Match5;Name=agt767.5;Target=agt767.5 1 1153 +ctgA est match_part 1150 1500 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 1 351 +ctgA est match_part 5000 5500 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 352 852 +ctgA est match_part 7000 7200 . + . Parent=Match5;Name=agt767.5;Target=agt767.5 853 1153 + +ctgA est EST_match 8000 9000 . - . ID=Match6;Name=agt767.3;Target=agt767.3 1 1001 + + + +ctgB example contig 1 6079 . . . Name=ctgB +ctgB example remark 1659 1984 . + . Name=f07;Note=This is an example +ctgB example remark 3014 6130 . + . Name=f06;Note=This is another example +ctgB example remark 4715 5968 . - . Name=f05;Note=ああ、この機能は、世界中を旅しています! +##FASTA +>foobar +ACTGATGATCGCTAGATGCTCGACTAGC