--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/extract_genomic_dna.xml	Tue Jan 19 09:34:23 2016 -0500
@@ -0,0 +1,202 @@
+<tool id="Extract genomic DNA 1" name="Extract Genomic DNA" version="3.0.0">
+    <description>using coordinates from assembled/unassembled genomes</description>
+    <requirements>
+        <requirement type="package" version="0.7.1">bx-python</requirement>
+        <requirement type="package" version="35x1">faToTwoBit</requirement>
+    </requirements>
+    <command>
+        <![CDATA[
+            #set genome = $input.metadata.dbkey
+            #set datatype = $input.datatype
+            mkdir -p output_dir &&
+            python $__tool_directory__/extract_genomic_dna.py
+            --input "$input"
+            --genome "$genome"
+            #if $input.is_of_type("gff"):
+                --input_format "gff"
+                --columns "1,4,5,7"
+                --interpret_features $interpret_features
+            #else:
+                --input_format "interval"
+                --columns "${input.metadata.chromCol},${input.metadata.startCol},${input.metadata.endCol},${input.metadata.strandCol},${input.metadata.nameCol}"
+            #end if
+            --reference_genome_source $reference_genome_cond.reference_genome_source
+            #if str($reference_genome_cond.reference_genome_source) == "cached"
+                --reference_genome $reference_genome_cond.reference_genome.fields.path
+            #else:
+                --reference_genome $reference_genome_cond.reference_genome
+            #end if
+            --output_format $output_format
+            --output $output
+        ]]>
+    </command>
+    <inputs>
+        <param name="input" type="data" format="gff,interval" label="Fetch sequences for intervals in">
+            <validator type="unspecified_build" />
+        </param>
+        <param name="interpret_features" type="select" label="Interpret features when possible" help="Applicable only when input dataset format is in the gff family">
+            <option value="yes">Yes</option>
+            <option value="no">No</option>
+        </param>
+        <conditional name="reference_genome_cond">
+            <param name="reference_genome_source" type="select" label="Choose the source for the reference genome">
+                <option value="cached">locally cached</option>
+                <option value="history">from history</option>
+            </param>
+            <when value="cached">
+                <param name="reference_genome" type="select" label="Using reference genome">
+                    <options from_data_table="twobit">
+                        <filter type="data_meta" key="dbkey" ref="input" column="0"/>
+                    </options>
+                    <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+                </param>
+            </when>
+            <when value="history">
+                <param name="reference_genome" type="data" format="fasta" label="Using reference genome">
+                    <options>
+                        <filter type="data_meta" key="dbkey" ref="input"/>
+                    </options>
+                    <validator type="no_options" message="The current history does not include a fasta dataset with the build associated with the selected input file"/>
+                </param>
+            </when>
+        </conditional>
+        <param name="output_format" type="select" label="Select output format">
+            <option value="fasta" selected="True">fasta</option>
+            <option value="interval">interval</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data name="output" format="gff">
+            <change_format>
+                <when output_format="interval" format="interval" />
+            </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="1.bed" dbkey="hg17" ftype="bed" />
+            <param name="interpret_features" value="yes"/>
+            <param name="index_source" value="cached"/>
+            <param name="out_format" value="fasta"/>
+            <output name="out_file1" file="extract_genomic_dna_out1.fasta" compare="contains" />
+        </test>
+        <test>
+            <param name="input" value="droPer1.bed" dbkey="droPer1" ftype="bed" />
+            <param name="interpret_features" value="yes"/>
+            <param name="index_source" value="cached"/>
+            <param name="out_format" value="fasta"/>
+            <output name="out_file1" file="extract_genomic_dna_out2.fasta" compare="contains" />
+        </test>
+        <test>
+            <param name="input" value="1.bed" dbkey="hg17" ftype="bed" />
+            <param name="interpret_features" value="yes"/>
+            <param name="index_source" value="cached"/>
+            <param name="out_format" value="interval"/>
+            <output name="out_file1" file="extract_genomic_dna_out3.interval" compare="contains" />
+        </test>
+        <!-- Test GFF file support. -->
+        <test>
+            <param name="input" value="gff_filter_by_attribute_out1.gff" dbkey="mm9" ftype="gff" />
+            <param name="interpret_features" value="no"/>
+            <param name="index_source" value="cached"/>
+            <param name="out_format" value="interval"/>
+            <output name="out_file1" file="extract_genomic_dna_out4.gff" compare="contains" />
+        </test>
+        <test>
+            <param name="input" value="gff_filter_by_attribute_out1.gff" dbkey="mm9" ftype="gff" />
+            <param name="interpret_features" value="no"/>
+            <param name="out_format" value="fasta"/>
+            <param name="index_source" value="cached"/>
+            <output name="out_file1" file="extract_genomic_dna_out5.fasta" compare="contains" />
+        </test>
+        <!-- Test custom sequences support and GFF feature interpretation. -->
+        <test>
+            <param name="input" value="cufflinks_out1.gtf" dbkey="mm9" ftype="gff" />
+            <param name="interpret_features" value="no"/>
+            <param name="index_source" value="history"/>
+            <param name="ref_file" value="tophat_in1.fasta"/>
+            <param name="out_format" value="fasta"/>
+            <output name="out_file1" file="extract_genomic_dna_out6.fasta" compare="contains" />
+        </test>
+        <test>
+            <param name="input" value="cufflinks_out1.gtf" dbkey="mm9" ftype="gff" />
+            <param name="interpret_features" value="yes"/>
+            <param name="index_source" value="history"/>
+            <param name="ref_file" value="tophat_in1.fasta"/>
+            <param name="out_format" value="fasta"/>
+            <output name="out_file1" file="extract_genomic_dna_out7.fasta" compare="contains" />
+        </test>
+    </tests>
+    <help>
+
+.. class:: warningmark
+
+This tool requires interval or gff (special tabular formatted data).  If your data is not TAB delimited, first use *Text Manipulation-&gt;Convert*.
+
+.. class:: warningmark
+
+Make sure that the genome build is specified for the dataset from which you are extracting sequences (click the pencil icon in the history item if it is not specified). 
+
+.. class:: warningmark
+
+All of the following will cause a line from the input dataset to be skipped and a warning generated.  The number of warnings and skipped lines is documented in the resulting history item.
+ - Any lines that do not contain at least 3 columns, a chromosome and numerical start and end coordinates.
+ - Sequences that fall outside of the range of a line's start and end coordinates. 
+ - Chromosome, start or end coordinates that are invalid for the specified build.
+ - Any lines whose data columns are not separated by a **TAB** character ( other white-space characters are invalid ).
+
+.. class:: infomark
+
+ **Extract genomic DNA using coordinates from ASSEMBLED genomes and UNassembled genomes** previously were achieved by two separate tools. 
+
+-----
+
+**What it does**
+
+This tool uses coordinate, strand, and build information to fetch genomic DNAs in FASTA or interval format.
+
+If strand is not defined, the default value is "+".
+
+-----
+
+**Example**
+
+If the input dataset is::
+
+    chr7  127475281  127475310  NM_000230  0  +
+    chr7  127485994  127486166  NM_000230  0  +
+    chr7  127486011  127486166  D49487     0  +
+
+Extracting sequences with **FASTA** output data type returns::
+
+    &gt;hg17_chr7_127475281_127475310_+ NM_000230
+    GTAGGAATCGCAGCGCCAGCGGTTGCAAG
+    &gt;hg17_chr7_127485994_127486166_+ NM_000230
+    GCCCAAGAAGCCCATCCTGGGAAGGAAAATGCATTGGGGAACCCTGTGCG
+    GATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATC
+    CAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAG
+    GATCAATGACATTTCACACACG
+    &gt;hg17_chr7_127486011_127486166_+ D49487
+    TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGG
+    CCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGA
+    CACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCAC
+    ACACG
+
+Extracting sequences with **Interval** output data type returns::
+
+    chr7    127475281       127475310       NM_000230       0       +       GTAGGAATCGCAGCGCCAGCGGTTGCAAG
+    chr7    127485994       127486166       NM_000230       0       +       GCCCAAGAAGCCCATCCTGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG
+    chr7    127486011       127486166       D49487  0       +       TGGGAAGGAAAATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACG
+
+    </help>
+    <citations>
+        <citation type="bibtex">
+            @unpublished{None,
+            author = {Guru Ananda,Greg Von Kuster},
+            title = {None},
+            year = {None},
+            eprint = {None},
+            url = {http://www.bx.psu.edu/~anton/labSite/}
+        }</citation>
+    </citations>
+</tool>