--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/rgFastQC.xml	Sat Jan 18 22:33:24 2014 -0500
@@ -0,0 +1,102 @@
+<tool name="FastQC: Comprehensive QC" id="fastqc" version="0.53">
+  <description>reporting for short read sequence</description>
+  <command interpreter="python">
+    rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" 
+#if $contaminants.dataset and str($contaminants) > ''
+-c "$contaminants"
+#end if
+-e fastqc
+  </command>
+  <requirements>
+    <requirement type="package" version="0.10.1">fastqc_dist_0_10_1</requirement>
+  </requirements>
+  <inputs>
+    <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
+    <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
+      help="Letters and numbers only please - other characters will be removed">
+    <sanitizer invalid_char="">
+        <valid initial="string.letters,string.digits"/>
+    </sanitizer>
+    </param>
+    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
+           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer   CAAGCAGAAGACGGCATACGA"/>
+  </inputs>
+  <outputs>
+    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}.html" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input_file" value="1000gsample.fastq" />
+      <param name="out_prefix" value="fastqc_out" />
+      <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
+      <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: infomark
+
+**Purpose**
+Quote from FastQC_ 
+
+FastQC aims to provide a simple way to do some quality control checks on raw
+sequence data coming from high throughput sequencing pipelines. 
+It provides a modular set of analyses which you can use to give a quick
+impression of whether your data has any problems of 
+which you should be aware before doing any further analysis.
+
+The main functions of FastQC are:
+
+- Import of data from BAM, SAM or FastQ files (any variant)
+- Providing a quick overview to tell you in which areas there may be problems
+- Summary graphs and tables to quickly assess your data
+- Export of results to an HTML based permanent report
+- Offline operation to allow automated generation of reports without running the interactive application
+
+FastQC_ is the best place to look for documentation - it's very good. 
+Some features of the Galaxy wrapper you are using are described below.
+
+-----
+
+.. class:: infomark
+
+**This Galaxy Tool**
+You are using FastQC_ in Galaxy.
+This is easy because it has been packaged into a Galaxy tool by the Intergalactic Utilities Commission.
+It exposes the external package FastQC_ which is documented at FastQC_
+Kindly acknowledge it as well as this tool if you use it.
+FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
+
+The contaminants file parameter was borrowed from the independently developed
+fastqcwrapper contributed to the Galaxy Community Tool Shed by Jim Johnson.
+
+-----
+
+.. class:: infomark
+
+**Inputs and outputs**
+
+This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
+It will also take an optional file containing a list of contaminants information, in the form of
+a tab-delimited file with 2 columns, name and sequence.
+
+FastQC_ produces a single HTML output file which is slightly adjusted so it looks good in Galaxy that contains all of the results, including the following:
+
+- Basic Statistics
+- Per base sequence quality
+- Per sequence quality scores
+- Per base sequence content
+- Per base GC content
+- Per sequence GC content
+- Per base N content
+- Sequence Length Distribution
+- Sequence Duplication Levels
+- Overrepresented sequences
+- Kmer Content
+
+All except Basic Statistics and Overrepresented sequences are plots.
+ .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
+ .. _Picard-tools: http://picard.sourceforge.net/index.shtml
+
+</help>
+</tool>