--- a/rgFastQC.xml	Sat Jan 18 22:33:36 2014 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,102 +0,0 @@
-<tool name="FastQC: Comprehensive QC" id="fastqc" version="0.53">
-  <description>reporting for short read sequence</description>
-  <command interpreter="python">
-    rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" 
-#if $contaminants.dataset and str($contaminants) > ''
--c "$contaminants"
-#end if
--e fastqc
-  </command>
-  <requirements>
-    <requirement type="package" version="0.10.1">fastqc_dist_0_10_1</requirement>
-  </requirements>
-  <inputs>
-    <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
-    <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
-      help="Letters and numbers only please - other characters will be removed">
-    <sanitizer invalid_char="">
-        <valid initial="string.letters,string.digits"/>
-    </sanitizer>
-    </param>
-    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
-           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer   CAAGCAGAAGACGGCATACGA"/>
-  </inputs>
-  <outputs>
-    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}.html" />
-  </outputs>
-  <tests>
-    <test>
-      <param name="input_file" value="1000gsample.fastq" />
-      <param name="out_prefix" value="fastqc_out" />
-      <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
-      <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
-    </test>
-  </tests>
-  <help>
-
-.. class:: infomark
-
-**Purpose**
-Quote from FastQC_ 
-
-FastQC aims to provide a simple way to do some quality control checks on raw
-sequence data coming from high throughput sequencing pipelines. 
-It provides a modular set of analyses which you can use to give a quick
-impression of whether your data has any problems of 
-which you should be aware before doing any further analysis.
-
-The main functions of FastQC are:
-
-- Import of data from BAM, SAM or FastQ files (any variant)
-- Providing a quick overview to tell you in which areas there may be problems
-- Summary graphs and tables to quickly assess your data
-- Export of results to an HTML based permanent report
-- Offline operation to allow automated generation of reports without running the interactive application
-
-FastQC_ is the best place to look for documentation - it's very good. 
-Some features of the Galaxy wrapper you are using are described below.
-
------
-
-.. class:: infomark
-
-**This Galaxy Tool**
-You are using FastQC_ in Galaxy.
-This is easy because it has been packaged into a Galaxy tool by the Intergalactic Utilities Commission.
-It exposes the external package FastQC_ which is documented at FastQC_
-Kindly acknowledge it as well as this tool if you use it.
-FastQC incorporates the Picard-tools_ libraries for sam/bam processing.
-
-The contaminants file parameter was borrowed from the independently developed
-fastqcwrapper contributed to the Galaxy Community Tool Shed by Jim Johnson.
-
------
-
-.. class:: infomark
-
-**Inputs and outputs**
-
-This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
-It will also take an optional file containing a list of contaminants information, in the form of
-a tab-delimited file with 2 columns, name and sequence.
-
-FastQC_ produces a single HTML output file which is slightly adjusted so it looks good in Galaxy that contains all of the results, including the following:
-
-- Basic Statistics
-- Per base sequence quality
-- Per sequence quality scores
-- Per base sequence content
-- Per base GC content
-- Per sequence GC content
-- Per base N content
-- Sequence Length Distribution
-- Sequence Duplication Levels
-- Overrepresented sequences
-- Kmer Content
-
-All except Basic Statistics and Overrepresented sequences are plots.
- .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
- .. _Picard-tools: http://picard.sourceforge.net/index.shtml
-
-</help>
-</tool>