Mercurial > repos > iuc > fastqc
diff rgFastQC.xml @ 3:5fb45d8bbc07 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fastqc commit dd2bada7005c72c16cd3ea047cdc64896c1f8977
author | iuc |
---|---|
date | Wed, 13 Jan 2016 17:57:35 -0500 |
parents | 2611a96c30b7 |
children |
line wrap: on
line diff
--- a/rgFastQC.xml Sat Jan 18 22:33:36 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,102 +0,0 @@ -<tool name="FastQC: Comprehensive QC" id="fastqc" version="0.53"> - <description>reporting for short read sequence</description> - <command interpreter="python"> - rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -#if $contaminants.dataset and str($contaminants) > '' --c "$contaminants" -#end if --e fastqc - </command> - <requirements> - <requirement type="package" version="0.10.1">fastqc_dist_0_10_1</requirement> - </requirements> - <inputs> - <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> - <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80" - help="Letters and numbers only please - other characters will be removed"> - <sanitizer invalid_char=""> - <valid initial="string.letters,string.digits"/> - </sanitizer> - </param> - <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" - help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> - </inputs> - <outputs> - <data format="html" name="html_file" label="${out_prefix}_${input_file.name}.html" /> - </outputs> - <tests> - <test> - <param name="input_file" value="1000gsample.fastq" /> - <param name="out_prefix" value="fastqc_out" /> - <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> - <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> - </test> - </tests> - <help> - -.. class:: infomark - -**Purpose** -Quote from FastQC_ - -FastQC aims to provide a simple way to do some quality control checks on raw -sequence data coming from high throughput sequencing pipelines. -It provides a modular set of analyses which you can use to give a quick -impression of whether your data has any problems of -which you should be aware before doing any further analysis. - -The main functions of FastQC are: - -- Import of data from BAM, SAM or FastQ files (any variant) -- Providing a quick overview to tell you in which areas there may be problems -- Summary graphs and tables to quickly assess your data -- Export of results to an HTML based permanent report -- Offline operation to allow automated generation of reports without running the interactive application - -FastQC_ is the best place to look for documentation - it's very good. -Some features of the Galaxy wrapper you are using are described below. - ------ - -.. class:: infomark - -**This Galaxy Tool** -You are using FastQC_ in Galaxy. -This is easy because it has been packaged into a Galaxy tool by the Intergalactic Utilities Commission. -It exposes the external package FastQC_ which is documented at FastQC_ -Kindly acknowledge it as well as this tool if you use it. -FastQC incorporates the Picard-tools_ libraries for sam/bam processing. - -The contaminants file parameter was borrowed from the independently developed -fastqcwrapper contributed to the Galaxy Community Tool Shed by Jim Johnson. - ------ - -.. class:: infomark - -**Inputs and outputs** - -This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check. -It will also take an optional file containing a list of contaminants information, in the form of -a tab-delimited file with 2 columns, name and sequence. - -FastQC_ produces a single HTML output file which is slightly adjusted so it looks good in Galaxy that contains all of the results, including the following: - -- Basic Statistics -- Per base sequence quality -- Per sequence quality scores -- Per base sequence content -- Per base GC content -- Per sequence GC content -- Per base N content -- Sequence Length Distribution -- Sequence Duplication Levels -- Overrepresented sequences -- Kmer Content - -All except Basic Statistics and Overrepresented sequences are plots. - .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ - .. _Picard-tools: http://picard.sourceforge.net/index.shtml - -</help> -</tool>