Mercurial > repos > iuc > gffcompare
changeset 3:2bb86e2c417f draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/gffcompare commit c8a752199588db982182cbe7fffbcb8512313526
line wrap: on
line diff
--- a/gffcompare.xml Tue Feb 05 15:51:44 2019 -0500 +++ b/gffcompare.xml Mon May 27 13:54:15 2019 -0400 @@ -1,11 +1,15 @@ -<tool id="gffcompare" name="GffCompare" version="0.10.6"> +<tool id="gffcompare" name="GffCompare" version="@GFFCOMPARE_VERSION@"> <description>compare assembled transcripts to a reference annotation</description> - <requirements> - <requirement type="package" version="0.10.6">gffcompare</requirement> + <macros> + <token name="@GFFCOMPARE_VERSION@">0.11.2</token> + </macros> + <requirements> + <requirement type="package" version="@GFFCOMPARE_VERSION@">gffcompare</requirement> </requirements> <version_command>gffcompare -v | awk '{print $2}'</version_command> <command detect_errors="aggressive"><![CDATA[ #import re + #set escaped_element_identifiers = [re.sub('[^\w\-]', '_', str(_.element_identifier)) for _ in $gffinputs] #for $input, $escaped_element_identifier in zip($gffinputs, $escaped_element_identifiers): ln -s '$input' '$escaped_element_identifier' && @@ -18,15 +22,24 @@ #end if #end if +#if $annotation.use_ref_annotation == "Yes": + #if $annotation.ref_source.ref_source_sel == "history": + ln -s '$annotation.ref_source.reference_annotation' ref_annotation && + #else + ln -s '$annotation.ref_source.index.fields.path' ref_annotation && + #end if +#end if + gffcompare ## Use annotation reference? #if $annotation.use_ref_annotation == "Yes": - -r '$annotation.reference_annotation' + -r ref_annotation $annotation.ignore_nonoverlapping_reference $annotation.ignore_nonoverlapping_transfrags - #if not $annotation.refmap_tmap: - -T - #end if + $annotation.strict_match +#end if +#if $annotation.refmap_tmap == "": + -T #end if ## Use sequence data? @@ -35,8 +48,10 @@ #end if $discard_single_exon +$discard_duplicates -e $max_dist_exon -d $max_dist_group +$chr_stats -p '$adv_output.p' $adv_output.A $adv_output.C @@ -56,26 +71,46 @@ <option value="Yes">Yes</option> </param> <when value="Yes"> - <param argument="-r" format="gff3,gtf" help="Requires an annotation file in GFF3 or GTF format." label="Reference Annotation" name="reference_annotation" type="data" /> + <conditional name="ref_source"> + <param label="Choose the source for the reference annotation" name="ref_source_sel" type="select"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + <when value="cached"> + <param argument="-r" label="Using reference annotation" name="index" type="select"> + <options from_data_table="gene_sets"> + <filter column="1" key="dbkey" ref="gffinputs" type="data_meta" /> + </options> + <validator message="No reference annotation is available for the build associated with the selected input dataset" type="no_options" /> + </param> + </when> + <when value="history"> + <param argument="-r" format="gff3,gtf" help="Requires an annotation file in GFF3 or GTF format." label="Reference Annotation" name="reference_annotation" type="data" /> + </when> + </conditional> <param argument="-R" falsevalue="" help="consider only the reference transcripts that overlap any of the input transfrags (Sn correction)" label="Ignore reference transcripts that are not overlapped by any input transfrags" name="ignore_nonoverlapping_reference" truevalue="-R" type="boolean" /> <param argument="-Q" falsevalue="" help="consider only the input transcripts that overlap any of the reference transcripts (Sp correction). Warning: this will discard all 'novel' loci!" label="Ignore input transcripts that are not overlapped by any reference transcripts" name="ignore_nonoverlapping_transfrags" truevalue="-Q" type="boolean" /> - <param argument="-T" name="refmap_tmap" label="Generate tmap and refmap files for each input file" type="select" multiple="True"> + <param argument="--strict-match" name="strict_match" type="boolean" checked="false" truevalue="--strict-match" falsevalue="" label="the match code '=' is only assigned when all exon boundaries match" help="code '~' is assigned for intron chain match or single-exon" /> + <param argument="-T" name="refmap_tmap" label="Generate tmap or refmap file for each input file" type="select" multiple="True"> <option value="refmap" selected="True">refmap</option> <option value="tmap" selected="True">tmap</option> </param> </when> <when value="No"> + <param argument="-T" name="refmap_tmap" label="Generate tmap file for each input file" type="select" multiple="True"> + <option value="tmap" selected="True">tmap</option> + </param> </when> </conditional> <conditional name="seq_data"> <param help="Use sequence data for some optional classification functions, including the addition of the p_id attribute required by Cuffdiff." label="Use Sequence Data" name="use_seq_data" type="select"> + <option value="No">No</option> <option value="Yes">Yes</option> - <option value="No">No</option> </param> <when value="No"/> <when value="Yes"> <conditional name="seq_source"> - <param label="Choose the source for the reference list" name="index_source" type="select"> + <param label="Choose the source for the reference sequence" name="index_source" type="select"> <option value="cached">Locally cached</option> <option value="history">History</option> </param> @@ -83,8 +118,8 @@ <param argument="-s" label="Using reference genome" name="index" type="select"> <options from_data_table="fasta_indexes"> <filter column="1" key="dbkey" ref="gffinputs" type="data_meta" /> - <validator message="No reference genome is available for the build associated with the selected input dataset" type="no_options" /> </options> + <validator message="No reference genome is available for the build associated with the selected input dataset" type="no_options" /> </param> </when> <when value="history"> @@ -93,19 +128,26 @@ </conditional> </when> </conditional> - <param argument="-M/-N" label="discard (ignore) single-exon transcripts" name="discard_single_exon" type="select"> + <param name="discard_single_exon" argument="-M/-N" type="select" label="Discard single-exon transcripts" help="If -S and also --strict-match is given, exact matching of all exon boundaries is required"> <option selected="True" value="">No</option> <option value="-M">Discard single-exon transfrags and reference transcripts</option> <option value="-N">Discard single-exon reference transcripts</option> </param> + <param label="Discard duplicates" name="discard_duplicates" type="select"> + <option value="">None</option> + <option value="-D">discard 'duplicate' query transfrags within a single sample (-D)</option> + <option value="-S">Only discard 'duplicate' query or reference transcripts if their boundaries are fully contained within other, larger or identical transfrags (-S)</option> + </param> + <param name="no_merge" argument="--no-merge" type="boolean" checked="false" truevalue="--no-merge" falsevalue="" label="Disable close-exon merging" help="Default: merge exons separated by 'introns' shorter than 5 bases" /> <param argument="-e" help="max. distance (range) allowed from free ends of terminal exons of reference transcripts when assessing exon accuracy. Default: 100" label="Max. Distance for assessing exon accuracy" name="max_dist_exon" type="integer" value="100" /> <param argument="-d" help="max. distance (range) for grouping transcript start sites. Default: 100" label="Max distance for transcript grouping" name="max_dist_group" type="integer" value="100" /> - <section name="adv_output" title="Options for the annotated/combined GTF output file"> + <param name="chr_stats" argument="--chr-stats" type="boolean" checked="false" truevalue="--chr-stats" falsevalue="" label="Show summary and accuracy data separately for each reference sequence in the transcript accuracy data set" /> + <section name="adv_output" title="Options for the combined GTF output file"> <param argument="-p" type="text" value="TCONS" label="name prefix for consensus transcripts" help="for combined.gtf (default: 'TCONS')" /> - <param argument="-C" type="boolean" checked="false" truevalue="-C" falsevalue="" label="discard the 'contained' transfrags" help="i.e. collapse intron-redundant transfrags across all query files" /> + <param argument="-C" type="boolean" checked="false" truevalue="-C" falsevalue="" label="discard matching and 'contained' transfrags" help="i.e. collapse intron-redundant transfrags across all query files" /> <param argument="-A" type="boolean" checked="false" truevalue="-A" falsevalue="" label="discard the 'contained' transfrags except intron-redundant transfrags starting with a different 5' exon" help="like -C but does not discard intron-redundant transfrags if they start with a different 5' exon" /> <param argument="-X" type="boolean" checked="false" truevalue="-X" falsevalue="" label="discard the 'contained' transfrags also if ends stick out within the container's introns" help="like -C but also discard contained transfrags if transfrag ends stick out within the container's introns" /> - <param argument="-K" type="boolean" checked="false" truevalue="-A" falsevalue="" label="do NOT discard any redundant transfrag matching a reference" help="for -C/-A/-X" /> + <param argument="-K" type="boolean" checked="false" truevalue="-K" falsevalue="" label="do NOT discard any redundant transfrag matching a reference" help="for -C/-A/-X" /> </section> </inputs> <outputs> @@ -113,51 +155,292 @@ <data format="tabular" from_work_dir="gffcmp.loci" label="${tool.name} on ${on_string}: loci" name="transcripts_loci" /> <data format="tabular" from_work_dir="gffcmp.tracking" label="${tool.name} on ${on_string}: data ${gffinputs[0].hid} tracking file" name="transcripts_tracking" /> <data format="gtf" from_work_dir="gffcmp.combined.gtf" label="${tool.name} on ${on_string}: combined transcripts" name="transcripts_combined"> - <filter>isinstance(gffinputs, list)</filter> + <filter>(isinstance(gffinputs, list) and len(gffinputs) > 1) or annotation['use_ref_annotation'] == "No"</filter> </data> <data format="gtf" from_work_dir="gffcmp.annotated.gtf" label="${tool.name} on ${on_string}: annotated transcripts" name="transcripts_annotated"> - <filter>not isinstance(gffinputs, list)</filter> + <filter>not (isinstance(gffinputs, list) and len(gffinputs) > 1) and annotation['use_ref_annotation'] == "Yes"</filter> </data> <collection name="refmap_output" type="list" label="${tool.name} on ${on_string}: refmap"> <discover_datasets pattern="gffcmp\.(?P<designation>.+)\.refmap" ext="tabular" /> - <filter>annotation['use_ref_annotation'] == 'Yes' and annotation['refmap_tmap'] != None and 'refmap' in annotation['refmap_tmap']</filter> + <filter>annotation['refmap_tmap'] != None and 'refmap' in annotation['refmap_tmap']</filter> </collection> <collection name="tmap_output" type="list" label="${tool.name} on ${on_string}: tmap"> <discover_datasets pattern="gffcmp\.(?P<designation>.+)\.tmap" ext="tabular" /> - <filter>annotation['use_ref_annotation'] == 'Yes' and annotation['refmap_tmap'] != None and 'tmap' in annotation['refmap_tmap']</filter> + <filter>annotation['refmap_tmap'] != None and 'tmap' in annotation['refmap_tmap']</filter> </collection> </outputs> <tests> + <!-- 2 inputs, no reference, default options --> + <test expect_num_outputs="5"> + <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" /> + <conditional name="annotation"> + <param name="use_ref_annotation" value="No" /> + </conditional> + <conditional name="seq_data"> + <param name="use_seq_data" value="No" /> + </conditional> + <assert_command> + <not_has_text text="-R " /> + <not_has_text text="-Q " /> + <not_has_text text="--strict-match " /> + <not_has_text text="-T " /> + <not_has_text text="-s " /> + <not_has_text text="-M " /> + <not_has_text text="-N " /> + <has_text text="-e 100 " /> + <has_text text="-d 100 " /> + <not_has_text text="-D " /> + <not_has_text text="--no-merge " /> + <has_text text="-p TCONS " /> + <not_has_text text="-C " /> + <not_has_text text="-A " /> + <not_has_text text="-X " /> + <not_has_text text="-K " /> + </assert_command> + <output file="gffcompare_out1.stats" name="transcripts_stats" /> + <output file="gffcompare_out1.loci" name="transcripts_loci" /> + <output file="gffcompare_out1.tracking" name="transcripts_tracking" /> + <output file="gffcompare_out1.gtf" name="transcripts_combined" /> + <output_collection name="tmap_output" type="list" count="2"/> + </test> + <!-- 2 inputs, no reference, with refsequence, default options (but disable tmap output) --> + <test expect_num_outputs="4"> + <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" /> + <conditional name="annotation"> + <param name="use_ref_annotation" value="No" /> + <param name="refmap_tmap" value=""/> + </conditional> + <conditional name="seq_data"> + <param name="use_seq_data" value="Yes" /> + <conditional name="seq_source"> + <param name="index_source" value="history"/> + <param name="ref_file" ftype="fasta" value="sequence.fa"/> + </conditional> + </conditional> + <assert_command> + <not_has_text text="-R " /> + <not_has_text text="-Q " /> + <has_text text="-T " /> + <has_text text="-s " /> + <not_has_text text="-M " /> + <not_has_text text="-N " /> + <has_text text="-e 100 " /> + <has_text text="-d 100 " /> + <has_text text="-p TCONS " /> + <not_has_text text="-C " /> + <not_has_text text="-A " /> + <not_has_text text="-X " /> + <not_has_text text="-K " /> + </assert_command> + <output file="gffcompare_out1.stats" name="transcripts_stats" compare="sim_size" /> + <output file="gffcompare_out1.loci" name="transcripts_loci" compare="sim_size" /> + <output file="gffcompare_out1.tracking" name="transcripts_tracking" compare="sim_size" /> + <output file="gffcompare_out1.gtf" name="transcripts_combined" compare="sim_size" /> + </test> + <!-- 2 inputs, no reference, with cached refsequence, default options (but disable tmap output) --> + <test expect_num_outputs="4"> + <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" dbkey="hg17" /> + <conditional name="annotation"> + <param name="use_ref_annotation" value="No" /> + <param name="refmap_tmap" value=""/> + </conditional> + <conditional name="seq_data"> + <param name="use_seq_data" value="Yes" /> + <conditional name="seq_source"> + <param name="index_source" value="cached"/> + <param name="index" value="test_buildid"/> + </conditional> + </conditional> + <assert_command> + <not_has_text text="-R " /> + <not_has_text text="-Q " /> + <has_text text="-T " /> + <has_text text="-s " /> + <not_has_text text="-M " /> + <not_has_text text="-N " /> + <has_text text="-e 100 " /> + <has_text text="-d 100 " /> + <has_text text="-p TCONS " /> + <not_has_text text="-C " /> + <not_has_text text="-A " /> + <not_has_text text="-X " /> + <not_has_text text="-K " /> + </assert_command> + <output file="gffcompare_out1.stats" name="transcripts_stats" compare="sim_size" /> + <output file="gffcompare_out1.loci" name="transcripts_loci" compare="sim_size" /> + <output file="gffcompare_out1.tracking" name="transcripts_tracking" compare="sim_size" /> + <output file="gffcompare_out1.gtf" name="transcripts_combined" compare="sim_size" /> + </test> + <!-- 2 inputs and reference, default options --> <test expect_num_outputs="6"> <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" /> - <param name="use_ref_annotation" value="Yes" /> <conditional name="annotation"> - <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" /> - <param name="ignore_nonoverlapping_reference" value="Yes" /> - <param name="ignore_nonoverlapping_transfrags" value="No" /> + <param name="use_ref_annotation" value="Yes" /> + <conditional name="ref_source"> + <param name="ref_source_sel" value="history"/> + <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" /> + </conditional> + </conditional> + <conditional name="seq_data"> + <param name="use_seq_data" value="No" /> </conditional> - <param name="use_seq_data" value="No" /> - <param name="discard_single_exon" value="" /> - <param name="max_dist_exon" value="100" /> - <param name="max_dist_group" value="100" /> - <output file="gffcompare_out1.stats" name="transcripts_stats" lines_diff="6" /> - <output file="gffcompare_out1.loci" name="transcripts_loci" lines_diff="2" /> - <output file="gffcompare_out1.tracking" name="transcripts_tracking" /> - <output file="gffcompare_out1.gtf" name="transcripts_combined" /> + <assert_command> + <not_has_text text="-R " /> + <not_has_text text="-Q " /> + <not_has_text text="-T " /> + <not_has_text text="-M " /> + <not_has_text text="-N " /> + <has_text text="-e 100 " /> + <has_text text="-d 100 " /> + <has_text text="-p TCONS " /> + <not_has_text text="-C " /> + <not_has_text text="-A " /> + <not_has_text text="-X " /> + <not_has_text text="-K " /> + </assert_command> + <output file="gffcompare_out2.stats" name="transcripts_stats" lines_diff="6" /> + <output file="gffcompare_out2.loci" name="transcripts_loci" lines_diff="2" /> + <output file="gffcompare_out2.tracking" name="transcripts_tracking" /> + <output file="gffcompare_out2.gtf" name="transcripts_combined" /> <output_collection name="refmap_output" type="list" count="2"> - <element name="gffcompare_in1_gtf" file="gffcompare_out1-1.refmap" ftype="tabular" /> - <element name="gffcompare_in2_gtf" file="gffcompare_out1-2.refmap" ftype="tabular" /> + <element name="gffcompare_in1_gtf" file="gffcompare_out2-1.refmap" ftype="tabular" /> + <element name="gffcompare_in2_gtf" file="gffcompare_out2-2.refmap" ftype="tabular" /> </output_collection> <output_collection name="tmap_output" type="list" count="2"> - <element name="gffcompare_in1_gtf" file="gffcompare_out1-1.tmap" ftype="tabular" /> - <element name="gffcompare_in2_gtf" file="gffcompare_out1-2.tmap" ftype="tabular" /> + <element name="gffcompare_in1_gtf" file="gffcompare_out2-1.tmap" ftype="tabular" /> + <element name="gffcompare_in2_gtf" file="gffcompare_out2-2.tmap" ftype="tabular" /> </output_collection> </test> + <!-- 2 inputs and reference (cached), non default options, only refmap output --> + <test expect_num_outputs="5"> + <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" dbkey="hg17" /> + <conditional name="annotation"> + <param name="use_ref_annotation" value="Yes" /> + <conditional name="ref_source"> + <param name="ref_source_sel" value="cached"/> + <param name="index" value="test_buildid"/> + </conditional> + <param name="ignore_nonoverlapping_reference" value="Yes" /> + <param name="ignore_nonoverlapping_transfrags" value="Yes" /> + <param name="strict_match" value="--strict-match" /> + <param name="refmap_tmap" value="refmap" /> + </conditional> + <conditional name="seq_data"> + <param name="use_seq_data" value="No" /> + </conditional> + <param name="discard_single_exon" value="-M"/> + <param name="discard_duplicates" value="-D"/> + <param name="no_merge" value="--no-merge" /> + <param name="max_dist_exon" value="101" /> + <param name="max_dist_group" value="99" /> + <param name="chr_stats" value="--chr-stats" /> + <assert_command> + <has_text text="-R " /> + <has_text text="-Q " /> + <has_text text="--strict-match " /> + <not_has_text text="-T " /> + <has_text text="-M " /> + <not_has_text text="-N " /> + <has_text text="-e 101 " /> + <has_text text="-d 99 " /> + <has_text text="-D " /> + <has_text text="--no-merge " /> + <has_text text="--chr-stats" /> + <not_has_text text="-p TCONS " /> + <not_has_text text="-C " /> + <not_has_text text="-A " /> + <not_has_text text="-X " /> + <not_has_text text="-K " /> + </assert_command> + <output file="gffcompare_out2.stats" name="transcripts_stats" compare="sim_size" /> + <output file="gffcompare_out2.loci" name="transcripts_loci" compare="sim_size" /> + <output file="gffcompare_out2.tracking" name="transcripts_tracking" compare="sim_size" /> + <output file="gffcompare_out2.gtf" name="transcripts_combined" compare="sim_size" delta="50000"/> + <output_collection name="refmap_output" type="list" count="0"/> <!-- because of -M no refmaps are created --> + </test> + <!-- 2 inputs and reference, non default advanced options, only tmap output --> + <test expect_num_outputs="5"> + <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" /> + <conditional name="annotation"> + <param name="use_ref_annotation" value="Yes" /> + <conditional name="ref_source"> + <param name="ref_source_sel" value="history"/> + <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" /> + </conditional> + <param name="refmap_tmap" value="tmap" /> + </conditional> + <conditional name="seq_data"> + <param name="use_seq_data" value="No" /> + </conditional> + <section name="adv_output"> + <param name="p" value="OTHER" /> + <param name="C" value="-C" /> + <param name="A" value="-A" /> + <param name="X" value="-X" /> + <param name="K" value="-K" /> + </section> + <assert_command> + <not_has_text text="-R " /> + <not_has_text text="-Q " /> + <not_has_text text="-T " /> + <not_has_text text="-M " /> + <not_has_text text="-N " /> + <has_text text="-e 100 " /> + <has_text text="-d 100 " /> + <has_text text="-p OTHER " /> + <has_text text="-C " /> + <has_text text="-A " /> + <has_text text="-X " /> + <has_text text="-K " /> + </assert_command> + <output file="gffcompare_out2.stats" name="transcripts_stats" compare="sim_size" /> + <output file="gffcompare_out2.loci" name="transcripts_loci" compare="sim_size" /> + <output file="gffcompare_out2.tracking" name="transcripts_tracking" compare="sim_size" /> + <output file="gffcompare_out2.gtf" name="transcripts_combined" compare="sim_size" delta="50000"/> + <output_collection name="tmap_output" type="list" count="2"/> + </test> + <!-- 2 inputs and reference, default options, no tmap or refmap output --> + <test expect_num_outputs="4"> + <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" /> + <conditional name="annotation"> + <param name="use_ref_annotation" value="Yes" /> + <conditional name="ref_source"> + <param name="ref_source_sel" value="history"/> + <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" /> + </conditional> + <param name="refmap_tmap" value="" /> + </conditional> + <conditional name="seq_data"> + <param name="use_seq_data" value="No" /> + </conditional> + <assert_command> + <not_has_text text="-R " /> + <not_has_text text="-Q " /> + <has_text text="-T " /> + <not_has_text text="-M " /> + <not_has_text text="-N " /> + <has_text text="-e 100 " /> + <has_text text="-d 100 " /> + <has_text text="-p TCONS " /> + <not_has_text text="-C " /> + <not_has_text text="-A " /> + <not_has_text text="-X " /> + <not_has_text text="-K " /> + </assert_command> + <output file="gffcompare_out2.stats" name="transcripts_stats" lines_diff="6" /> + <output file="gffcompare_out2.loci" name="transcripts_loci" lines_diff="2" /> + <output file="gffcompare_out2.tracking" name="transcripts_tracking" /> + <output file="gffcompare_out2.gtf" name="transcripts_combined" /> + </test> + <test expect_num_outputs="4"> <param ftype="gtf" name="gffinputs" value="gffcompare_in4.gtf" /> - <param name="use_ref_annotation" value="Yes" /> <conditional name="annotation"> - <param ftype="gtf" name="reference_annotation" value="gffcompare_in5.gtf" /> + <param name="use_ref_annotation" value="Yes" /> + <conditional name="ref_source"> + <param name="ref_source_sel" value="history"/> + <param ftype="gtf" name="reference_annotation" value="gffcompare_in5.gtf" /> + </conditional> <param name="ignore_nonoverlapping_reference" value="Yes" /> <param name="ignore_nonoverlapping_transfrags" value="No" /> <param name="refmap_tmap" value="" /> @@ -166,10 +449,10 @@ <param name="discard_single_exon" value="" /> <param name="max_dist_exon" value="100" /> <param name="max_dist_group" value="100" /> - <output file="gffcompare_out2.stats" name="transcripts_stats" lines_diff="6" /> - <output file="gffcompare_out2.loci" name="transcripts_loci" /> - <output file="gffcompare_out2.tracking" name="transcripts_tracking" /> - <output file="gffcompare_out2.gtf" name="transcripts_annotated" /> + <output file="gffcompare_out3.stats" name="transcripts_stats" lines_diff="6" /> + <output file="gffcompare_out3.loci" name="transcripts_loci" /> + <output file="gffcompare_out3.tracking" name="transcripts_tracking" /> + <output file="gffcompare_out3.gtf" name="transcripts_annotated" /> </test> </tests> <help> @@ -182,6 +465,8 @@ * classify transcripts from one or multiple GTF/GFF3 files as they relate to reference transcripts provided in a annotation file (also in GTF/GFF3 format) +More information can be found here: https://ccb.jhu.edu/software/stringtie/gffcompare.shtml. + The original form of this program is also distributed as part of the Cufflinks suite, under the name "CuffCompare" (see manual: http://cole-trapnell-lab.github.io/cufflinks/cuffcompare/). Most of the options and parameters of CuffCompare are supported by GffCompare, while new features will likely be added to GffCompare in the future.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fasta_indexes.loc Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,30 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +test_buildid hg17 test_displayname ${__HERE__}/sequence.fa +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gene_sets.loc Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,14 @@ +# This is a sample file distributed with featureCounts that enables it and other# tools to use gene/exon annotations in the GFF/GTF format. +# +# The gene_sets.loc file syntax is: +#<unique_build_id> <dbkey> <display_name> <path> +# +# Please ensure that the above fields are tab separated. +# +# In case you have TWO or MORE providers PER dbkey, the one mentioned +# first in the file, should have the "default" priority. +# +#Example: +# +test_buildid hg17 test_displayname ${__HERE__}/gffcompare_in3.gtf +
--- a/test-data/gffcompare_in1.gtf Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_in1.gtf Mon May 27 13:54:15 2019 -0400 @@ -1,100 +1,11 @@ -chr1 Cufflinks transcript 3111450 3111490 1000 . . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073"; -chr1 Cufflinks exon 3111450 3111490 1000 . . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073"; -chr1 Cufflinks transcript 3111546 3111576 1000 . . gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935"; -chr1 Cufflinks exon 3111546 3111576 1000 . . gene_id "CUFF.3"; transcript_id "CUFF.3.1"; exon_number "1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935"; -chr1 Cufflinks transcript 3200326 3200352 1000 . . gene_id "CUFF.5"; transcript_id "CUFF.5.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3200326 3200352 1000 . . gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3200023 3200191 1000 . . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053"; -chr1 Cufflinks exon 3200023 3200191 1000 . . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053"; -chr1 Cufflinks transcript 3201078 3201481 1000 . . gene_id "CUFF.9"; transcript_id "CUFF.9.1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139"; -chr1 Cufflinks exon 3201078 3201481 1000 . . gene_id "CUFF.9"; transcript_id "CUFF.9.1"; exon_number "1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139"; -chr1 Cufflinks transcript 3201673 3201699 1000 . . gene_id "CUFF.11"; transcript_id "CUFF.11.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3201673 3201699 1000 . . gene_id "CUFF.11"; transcript_id "CUFF.11.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3204755 3204833 1000 . . gene_id "CUFF.13"; transcript_id "CUFF.13.1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544"; -chr1 Cufflinks exon 3204755 3204833 1000 . . gene_id "CUFF.13"; transcript_id "CUFF.13.1"; exon_number "1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544"; -chr1 Cufflinks transcript 3212214 3212292 1000 . . gene_id "CUFF.15"; transcript_id "CUFF.15.1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544"; -chr1 Cufflinks exon 3212214 3212292 1000 . . gene_id "CUFF.15"; transcript_id "CUFF.15.1"; exon_number "1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544"; -chr1 Cufflinks transcript 3213096 3213192 1000 . . gene_id "CUFF.17"; transcript_id "CUFF.17.1"; FPKM "8.7105710927"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.029179"; cov "0.556701"; -chr1 Cufflinks exon 3213096 3213192 1000 . . gene_id "CUFF.17"; transcript_id "CUFF.17.1"; exon_number "1"; FPKM "8.7105710927"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.029179"; cov "0.556701"; -chr1 Cufflinks transcript 3212368 3212439 1000 . . gene_id "CUFF.19"; transcript_id "CUFF.19.1"; FPKM "29.3376873610"; frac "1.000000"; conf_lo "3.097262"; conf_hi "55.578113"; cov "1.875000"; -chr1 Cufflinks exon 3212368 3212439 1000 . . gene_id "CUFF.19"; transcript_id "CUFF.19.1"; exon_number "1"; FPKM "29.3376873610"; frac "1.000000"; conf_lo "3.097262"; conf_hi "55.578113"; cov "1.875000"; -chr1 Cufflinks transcript 3243019 3243079 1000 . . gene_id "CUFF.21"; transcript_id "CUFF.21.1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246"; -chr1 Cufflinks exon 3243019 3243079 1000 . . gene_id "CUFF.21"; transcript_id "CUFF.21.1"; exon_number "1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246"; -chr1 Cufflinks transcript 3243348 3243401 1000 . . gene_id "CUFF.23"; transcript_id "CUFF.23.1"; FPKM "23.4701498888"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.571145"; cov "1.500000"; -chr1 Cufflinks exon 3243348 3243401 1000 . . gene_id "CUFF.23"; transcript_id "CUFF.23.1"; exon_number "1"; FPKM "23.4701498888"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.571145"; cov "1.500000"; -chr1 Cufflinks transcript 3242634 3242923 1000 . . gene_id "CUFF.25"; transcript_id "CUFF.25.1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "5.354270"; conf_hi "23.781089"; cov "0.931034"; -chr1 Cufflinks exon 3242634 3242923 1000 . . gene_id "CUFF.25"; transcript_id "CUFF.25.1"; exon_number "1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "5.354270"; conf_hi "23.781089"; cov "0.931034"; -chr1 Cufflinks transcript 3256975 3257011 1000 . . gene_id "CUFF.27"; transcript_id "CUFF.27.1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189"; -chr1 Cufflinks exon 3256975 3257011 1000 . . gene_id "CUFF.27"; transcript_id "CUFF.27.1"; exon_number "1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189"; -chr1 Cufflinks transcript 3189900 3190041 1000 . . gene_id "CUFF.29"; transcript_id "CUFF.29.1"; FPKM "107.1032192108"; frac "1.000000"; conf_lo "71.402146"; conf_hi "142.804292"; cov "6.845070"; -chr1 Cufflinks exon 3189900 3190041 1000 . . gene_id "CUFF.29"; transcript_id "CUFF.29.1"; exon_number "1"; FPKM "107.1032192108"; frac "1.000000"; conf_lo "71.402146"; conf_hi "142.804292"; cov "6.845070"; -chr1 Cufflinks transcript 3190273 3190303 1000 . . gene_id "CUFF.31"; transcript_id "CUFF.31.1"; FPKM "122.6504607091"; frac "1.000000"; conf_lo "40.883487"; conf_hi "204.417435"; cov "7.838710"; -chr1 Cufflinks exon 3190273 3190303 1000 . . gene_id "CUFF.31"; transcript_id "CUFF.31.1"; exon_number "1"; FPKM "122.6504607091"; frac "1.000000"; conf_lo "40.883487"; conf_hi "204.417435"; cov "7.838710"; -chr1 Cufflinks transcript 3190455 3190481 1000 . . gene_id "CUFF.33"; transcript_id "CUFF.33.1"; FPKM "109.5273661476"; frac "1.000000"; conf_lo "26.732460"; conf_hi "192.322273"; cov "7.000000"; -chr1 Cufflinks exon 3190455 3190481 1000 . . gene_id "CUFF.33"; transcript_id "CUFF.33.1"; exon_number "1"; FPKM "109.5273661476"; frac "1.000000"; conf_lo "26.732460"; conf_hi "192.322273"; cov "7.000000"; -chr1 Cufflinks transcript 3191539 3191669 1000 . . gene_id "CUFF.35"; transcript_id "CUFF.35.1"; FPKM "96.7471827476"; frac "1.000000"; conf_lo "61.420107"; conf_hi "132.074259"; cov "6.183206"; -chr1 Cufflinks exon 3191539 3191669 1000 . . gene_id "CUFF.35"; transcript_id "CUFF.35.1"; exon_number "1"; FPKM "96.7471827476"; frac "1.000000"; conf_lo "61.420107"; conf_hi "132.074259"; cov "6.183206"; -chr1 Cufflinks transcript 3191877 3191945 1000 . . gene_id "CUFF.37"; transcript_id "CUFF.37.1"; FPKM "104.0850125502"; frac "1.000000"; conf_lo "53.596365"; conf_hi "154.573660"; cov "6.652174"; -chr1 Cufflinks exon 3191877 3191945 1000 . . gene_id "CUFF.37"; transcript_id "CUFF.37.1"; exon_number "1"; FPKM "104.0850125502"; frac "1.000000"; conf_lo "53.596365"; conf_hi "154.573660"; cov "6.652174"; -chr1 Cufflinks transcript 3192442 3192494 1000 . . gene_id "CUFF.39"; transcript_id "CUFF.39.1"; FPKM "23.9129829055"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.525317"; cov "1.528302"; -chr1 Cufflinks exon 3192442 3192494 1000 . . gene_id "CUFF.39"; transcript_id "CUFF.39.1"; exon_number "1"; FPKM "23.9129829055"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.525317"; cov "1.528302"; -chr1 Cufflinks transcript 3192551 3192629 1000 . . gene_id "CUFF.41"; transcript_id "CUFF.41.1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544"; -chr1 Cufflinks exon 3192551 3192629 1000 . . gene_id "CUFF.41"; transcript_id "CUFF.41.1"; exon_number "1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544"; -chr1 Cufflinks transcript 3192732 3192811 1000 . . gene_id "CUFF.43"; transcript_id "CUFF.43.1"; FPKM "10.5615674500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.497879"; cov "0.675000"; -chr1 Cufflinks exon 3192732 3192811 1000 . . gene_id "CUFF.43"; transcript_id "CUFF.43.1"; exon_number "1"; FPKM "10.5615674500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.497879"; cov "0.675000"; -chr1 Cufflinks transcript 3192941 3193042 1000 . . gene_id "CUFF.45"; transcript_id "CUFF.45.1"; FPKM "20.7089557842"; frac "1.000000"; conf_lo "2.186303"; conf_hi "39.231609"; cov "1.323529"; -chr1 Cufflinks exon 3192941 3193042 1000 . . gene_id "CUFF.45"; transcript_id "CUFF.45.1"; exon_number "1"; FPKM "20.7089557842"; frac "1.000000"; conf_lo "2.186303"; conf_hi "39.231609"; cov "1.323529"; -chr1 Cufflinks transcript 3194186 3194226 1000 . . gene_id "CUFF.47"; transcript_id "CUFF.47.1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073"; -chr1 Cufflinks exon 3194186 3194226 1000 . . gene_id "CUFF.47"; transcript_id "CUFF.47.1"; exon_number "1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073"; -chr1 Cufflinks transcript 3194303 3194329 1000 . . gene_id "CUFF.49"; transcript_id "CUFF.49.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks exon 3194303 3194329 1000 . . gene_id "CUFF.49"; transcript_id "CUFF.49.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks transcript 3195084 3195110 1000 . . gene_id "CUFF.51"; transcript_id "CUFF.51.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3195084 3195110 1000 . . gene_id "CUFF.51"; transcript_id "CUFF.51.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3195451 3195477 1000 . . gene_id "CUFF.53"; transcript_id "CUFF.53.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3195451 3195477 1000 . . gene_id "CUFF.53"; transcript_id "CUFF.53.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3197090 3197116 1000 . . gene_id "CUFF.55"; transcript_id "CUFF.55.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3197090 3197116 1000 . . gene_id "CUFF.55"; transcript_id "CUFF.55.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3197247 3197273 1000 . . gene_id "CUFF.57"; transcript_id "CUFF.57.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks exon 3197247 3197273 1000 . . gene_id "CUFF.57"; transcript_id "CUFF.57.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks transcript 3197347 3197373 1000 . . gene_id "CUFF.59"; transcript_id "CUFF.59.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks exon 3197347 3197373 1000 . . gene_id "CUFF.59"; transcript_id "CUFF.59.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks transcript 3277191 3277218 1000 . . gene_id "CUFF.61"; transcript_id "CUFF.61.1"; FPKM "45.2638604998"; frac "1.000000"; conf_lo "0.000000"; conf_hi "97.530065"; cov "2.892857"; -chr1 Cufflinks exon 3277191 3277218 1000 . . gene_id "CUFF.61"; transcript_id "CUFF.61.1"; exon_number "1"; FPKM "45.2638604998"; frac "1.000000"; conf_lo "0.000000"; conf_hi "97.530065"; cov "2.892857"; -chr1 Cufflinks transcript 3278237 3278263 1000 . . gene_id "CUFF.63"; transcript_id "CUFF.63.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks exon 3278237 3278263 1000 . . gene_id "CUFF.63"; transcript_id "CUFF.63.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000"; -chr1 Cufflinks transcript 3280687 3280741 1000 . . gene_id "CUFF.65"; transcript_id "CUFF.65.1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818"; -chr1 Cufflinks exon 3280687 3280741 1000 . . gene_id "CUFF.65"; transcript_id "CUFF.65.1"; exon_number "1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818"; -chr1 Cufflinks transcript 3290489 3290553 1000 . . gene_id "CUFF.67"; transcript_id "CUFF.67.1"; FPKM "12.9988522461"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.382005"; cov "0.830769"; -chr1 Cufflinks exon 3290489 3290553 1000 . . gene_id "CUFF.67"; transcript_id "CUFF.67.1"; exon_number "1"; FPKM "12.9988522461"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.382005"; cov "0.830769"; -chr1 Cufflinks transcript 3290940 3291023 1000 . . gene_id "CUFF.69"; transcript_id "CUFF.69.1"; FPKM "10.0586356666"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.283695"; cov "0.642857"; -chr1 Cufflinks exon 3290940 3291023 1000 . . gene_id "CUFF.69"; transcript_id "CUFF.69.1"; exon_number "1"; FPKM "10.0586356666"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.283695"; cov "0.642857"; -chr1 Cufflinks transcript 3291089 3291186 1000 . . gene_id "CUFF.71"; transcript_id "CUFF.71.1"; FPKM "8.6216877142"; frac "1.000000"; conf_lo "0.000000"; conf_hi "20.814595"; cov "0.551020"; -chr1 Cufflinks exon 3291089 3291186 1000 . . gene_id "CUFF.71"; transcript_id "CUFF.71.1"; exon_number "1"; FPKM "8.6216877142"; frac "1.000000"; conf_lo "0.000000"; conf_hi "20.814595"; cov "0.551020"; -chr1 Cufflinks transcript 3299610 3299664 1000 . . gene_id "CUFF.73"; transcript_id "CUFF.73.1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818"; -chr1 Cufflinks exon 3299610 3299664 1000 . . gene_id "CUFF.73"; transcript_id "CUFF.73.1"; exon_number "1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818"; -chr1 Cufflinks transcript 3300052 3300078 1000 . . gene_id "CUFF.75"; transcript_id "CUFF.75.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3300052 3300078 1000 . . gene_id "CUFF.75"; transcript_id "CUFF.75.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3319000 3319051 1000 . . gene_id "CUFF.77"; transcript_id "CUFF.77.1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.227507"; cov "1.038462"; -chr1 Cufflinks exon 3319000 3319051 1000 . . gene_id "CUFF.77"; transcript_id "CUFF.77.1"; exon_number "1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.227507"; cov "1.038462"; -chr1 Cufflinks transcript 3355888 3355914 1000 . . gene_id "CUFF.79"; transcript_id "CUFF.79.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3355888 3355914 1000 . . gene_id "CUFF.79"; transcript_id "CUFF.79.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3363215 3363278 1000 . . gene_id "CUFF.81"; transcript_id "CUFF.81.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750"; -chr1 Cufflinks exon 3363215 3363278 1000 . . gene_id "CUFF.81"; transcript_id "CUFF.81.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750"; -chr1 Cufflinks transcript 3363754 3363849 1000 . . gene_id "CUFF.83"; transcript_id "CUFF.83.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.446269"; cov "0.843750"; -chr1 Cufflinks exon 3363754 3363849 1000 . . gene_id "CUFF.83"; transcript_id "CUFF.83.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.446269"; cov "0.843750"; -chr1 Cufflinks transcript 3367136 3367162 1000 . . gene_id "CUFF.85"; transcript_id "CUFF.85.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3367136 3367162 1000 . . gene_id "CUFF.85"; transcript_id "CUFF.85.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3367334 3367382 1000 . . gene_id "CUFF.87"; transcript_id "CUFF.87.1"; FPKM "17.2433754285"; frac "1.000000"; conf_lo "0.000000"; conf_hi "41.629191"; cov "1.102041"; -chr1 Cufflinks exon 3367334 3367382 1000 . . gene_id "CUFF.87"; transcript_id "CUFF.87.1"; exon_number "1"; FPKM "17.2433754285"; frac "1.000000"; conf_lo "0.000000"; conf_hi "41.629191"; cov "1.102041"; -chr1 Cufflinks transcript 3377212 3377262 1000 . . gene_id "CUFF.89"; transcript_id "CUFF.89.1"; FPKM "16.5671646274"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.996674"; cov "1.058824"; -chr1 Cufflinks exon 3377212 3377262 1000 . . gene_id "CUFF.89"; transcript_id "CUFF.89.1"; exon_number "1"; FPKM "16.5671646274"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.996674"; cov "1.058824"; -chr1 Cufflinks transcript 3391326 3391352 1000 . . gene_id "CUFF.91"; transcript_id "CUFF.91.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks exon 3391326 3391352 1000 . . gene_id "CUFF.91"; transcript_id "CUFF.91.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; -chr1 Cufflinks transcript 3435842 3435880 1000 . . gene_id "CUFF.93"; transcript_id "CUFF.93.1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615"; -chr1 Cufflinks exon 3435842 3435880 1000 . . gene_id "CUFF.93"; transcript_id "CUFF.93.1"; exon_number "1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615"; -chr1 Cufflinks transcript 3447762 3447788 1000 . . gene_id "CUFF.95"; transcript_id "CUFF.95.1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000"; -chr1 Cufflinks exon 3447762 3447788 1000 . . gene_id "CUFF.95"; transcript_id "CUFF.95.1"; exon_number "1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000"; -chr1 Cufflinks transcript 3450907 3450965 1000 . . gene_id "CUFF.97"; transcript_id "CUFF.97.1"; FPKM "21.4811541355"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.285454"; cov "1.372881"; -chr1 Cufflinks exon 3450907 3450965 1000 . . gene_id "CUFF.97"; transcript_id "CUFF.97.1"; exon_number "1"; FPKM "21.4811541355"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.285454"; cov "1.372881"; -chr1 Cufflinks transcript 3451052 3451109 1000 . . gene_id "CUFF.99"; transcript_id "CUFF.99.1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.169489"; cov "0.931034"; -chr1 Cufflinks exon 3451052 3451109 1000 . . gene_id "CUFF.99"; transcript_id "CUFF.99.1"; exon_number "1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.169489"; cov "0.931034"; +chr1 Cufflinks transcript 5 10 0.000000 - . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073"; +chr1 Cufflinks exon 2 10 0.000000 - . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073"; +chr1 Cufflinks transcript 15 20 0.000000 - . gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935"; +chr1 Cufflinks exon 22 30 0.000000 - . gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000"; +chr1 Cufflinks transcript 32 37 0.000000 + . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053"; +chr1 Cufflinks exon 32 40 0.000000 + . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053"; +chr1 Cufflinks transcript 42 50 0.000000 + . gene_id "CUFF.9"; transcript_id "CUFF.9.1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139"; +chr1 Cufflinks exon 42 50 0.000000 + . gene_id "CUFF.9"; transcript_id "CUFF.9.1"; exon_number "1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139"; +chr1 Cufflinks transcript 52 60 0.000000 + . gene_id "CUFF.10"; transcript_id "CUFF.10.1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139"; +chr1 Cufflinks exon 52 60 0.000000 + . gene_id "CUFF.10"; transcript_id "CUFF.10.1"; exon_number "1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139"; +
--- a/test-data/gffcompare_in2.gtf Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_in2.gtf Mon May 27 13:54:15 2019 -0400 @@ -1,100 +1,9 @@ -chr1 Cufflinks transcript 3174766 3174792 1000 . . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3174766 3174792 1000 . . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3187402 3187428 1000 . . gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3187402 3187428 1000 . . gene_id "CUFF.3"; transcript_id "CUFF.3.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3188522 3188548 1000 . . gene_id "CUFF.5"; transcript_id "CUFF.5.1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672"; -chr1 Cufflinks exon 3188522 3188548 1000 . . gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672"; -chr1 Cufflinks transcript 3190859 3191434 1000 . . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500"; -chr1 Cufflinks exon 3190859 3191434 1000 . . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500"; -chr1 Cufflinks transcript 3191513 3192077 1000 . . gene_id "CUFF.9"; transcript_id "CUFF.9.1"; FPKM "34.0729325807"; frac "1.000000"; conf_lo "23.364686"; conf_hi "44.781179"; cov "1.935341"; -chr1 Cufflinks exon 3191513 3192077 1000 . . gene_id "CUFF.9"; transcript_id "CUFF.9.1"; exon_number "1"; FPKM "34.0729325807"; frac "1.000000"; conf_lo "23.364686"; conf_hi "44.781179"; cov "1.935341"; -chr1 Cufflinks transcript 3189811 3190789 1000 . . gene_id "CUFF.11"; transcript_id "CUFF.11.1"; FPKM "32.5317765567"; frac "1.000000"; conf_lo "24.582998"; conf_hi "40.480555"; cov "1.847804"; -chr1 Cufflinks exon 3189811 3190789 1000 . . gene_id "CUFF.11"; transcript_id "CUFF.11.1"; exon_number "1"; FPKM "32.5317765567"; frac "1.000000"; conf_lo "24.582998"; conf_hi "40.480555"; cov "1.847804"; -chr1 Cufflinks transcript 3192251 3192336 1000 . . gene_id "CUFF.13"; transcript_id "CUFF.13.1"; FPKM "16.5820596576"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.729373"; cov "0.941860"; -chr1 Cufflinks exon 3192251 3192336 1000 . . gene_id "CUFF.13"; transcript_id "CUFF.13.1"; exon_number "1"; FPKM "16.5820596576"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.729373"; cov "0.941860"; -chr1 Cufflinks transcript 3192650 3192676 1000 . . gene_id "CUFF.15"; transcript_id "CUFF.15.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3192650 3192676 1000 . . gene_id "CUFF.15"; transcript_id "CUFF.15.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3194707 3194733 1000 . . gene_id "CUFF.17"; transcript_id "CUFF.17.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3194707 3194733 1000 . . gene_id "CUFF.17"; transcript_id "CUFF.17.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3197426 3197452 1000 . . gene_id "CUFF.19"; transcript_id "CUFF.19.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3197426 3197452 1000 . . gene_id "CUFF.19"; transcript_id "CUFF.19.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3200431 3200457 1000 . . gene_id "CUFF.21"; transcript_id "CUFF.21.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3200431 3200457 1000 . . gene_id "CUFF.21"; transcript_id "CUFF.21.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3200057 3200144 1000 . . gene_id "CUFF.23"; transcript_id "CUFF.23.1"; FPKM "16.2051946653"; frac "1.000000"; conf_lo "0.000000"; conf_hi "34.917342"; cov "0.920455"; -chr1 Cufflinks exon 3200057 3200144 1000 . . gene_id "CUFF.23"; transcript_id "CUFF.23.1"; exon_number "1"; FPKM "16.2051946653"; frac "1.000000"; conf_lo "0.000000"; conf_hi "34.917342"; cov "0.920455"; -chr1 Cufflinks transcript 3201161 3201187 1000 . . gene_id "CUFF.25"; transcript_id "CUFF.25.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3201161 3201187 1000 . . gene_id "CUFF.25"; transcript_id "CUFF.25.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3201008 3201039 1000 . . gene_id "CUFF.26"; transcript_id "CUFF.26.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "71.725135"; cov "1.687500"; -chr1 Cufflinks exon 3201008 3201039 1000 . . gene_id "CUFF.26"; transcript_id "CUFF.26.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "71.725135"; cov "1.687500"; -chr1 Cufflinks transcript 3201597 3201666 1000 . . gene_id "CUFF.29"; transcript_id "CUFF.29.1"; FPKM "13.5814964814"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.788633"; cov "0.771429"; -chr1 Cufflinks exon 3201597 3201666 1000 . . gene_id "CUFF.29"; transcript_id "CUFF.29.1"; exon_number "1"; FPKM "13.5814964814"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.788633"; cov "0.771429"; -chr1 Cufflinks transcript 3201726 3201809 1000 . . gene_id "CUFF.31"; transcript_id "CUFF.31.1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.271655"; cov "1.285714"; -chr1 Cufflinks exon 3201726 3201809 1000 . . gene_id "CUFF.31"; transcript_id "CUFF.31.1"; exon_number "1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.271655"; cov "1.285714"; -chr1 Cufflinks transcript 3211522 3211561 1000 . . gene_id "CUFF.33"; transcript_id "CUFF.33.1"; FPKM "23.7676188425"; frac "1.000000"; conf_lo "0.000000"; conf_hi "57.380108"; cov "1.350000"; -chr1 Cufflinks exon 3211522 3211561 1000 . . gene_id "CUFF.33"; transcript_id "CUFF.33.1"; exon_number "1"; FPKM "23.7676188425"; frac "1.000000"; conf_lo "0.000000"; conf_hi "57.380108"; cov "1.350000"; -chr1 Cufflinks transcript 3212718 3212801 1000 . . gene_id "CUFF.35"; transcript_id "CUFF.35.1"; FPKM "11.3179137345"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.323861"; cov "0.642857"; -chr1 Cufflinks exon 3212718 3212801 1000 . . gene_id "CUFF.35"; transcript_id "CUFF.35.1"; exon_number "1"; FPKM "11.3179137345"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.323861"; cov "0.642857"; -chr1 Cufflinks transcript 3213119 3213242 1000 . . gene_id "CUFF.37"; transcript_id "CUFF.37.1"; FPKM "11.5004607302"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.780049"; cov "0.653226"; -chr1 Cufflinks exon 3213119 3213242 1000 . . gene_id "CUFF.37"; transcript_id "CUFF.37.1"; exon_number "1"; FPKM "11.5004607302"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.780049"; cov "0.653226"; -chr1 Cufflinks transcript 3240607 3240633 1000 . . gene_id "CUFF.39"; transcript_id "CUFF.39.1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000"; -chr1 Cufflinks exon 3240607 3240633 1000 . . gene_id "CUFF.39"; transcript_id "CUFF.39.1"; exon_number "1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000"; -chr1 Cufflinks transcript 3242480 3242512 1000 . . gene_id "CUFF.41"; transcript_id "CUFF.41.1"; FPKM "43.2138524409"; frac "1.000000"; conf_lo "0.000000"; conf_hi "93.112911"; cov "2.454545"; -chr1 Cufflinks exon 3242480 3242512 1000 . . gene_id "CUFF.41"; transcript_id "CUFF.41.1"; exon_number "1"; FPKM "43.2138524409"; frac "1.000000"; conf_lo "0.000000"; conf_hi "93.112911"; cov "2.454545"; -chr1 Cufflinks transcript 3242925 3243005 1000 . . gene_id "CUFF.43"; transcript_id "CUFF.43.1"; FPKM "23.4741914494"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.948383"; cov "1.333333"; -chr1 Cufflinks exon 3242925 3243005 1000 . . gene_id "CUFF.43"; transcript_id "CUFF.43.1"; exon_number "1"; FPKM "23.4741914494"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.948383"; cov "1.333333"; -chr1 Cufflinks transcript 3243109 3243154 1000 . . gene_id "CUFF.45"; transcript_id "CUFF.45.1"; FPKM "20.6674946457"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.895746"; cov "1.173913"; -chr1 Cufflinks exon 3243109 3243154 1000 . . gene_id "CUFF.45"; transcript_id "CUFF.45.1"; exon_number "1"; FPKM "20.6674946457"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.895746"; cov "1.173913"; -chr1 Cufflinks transcript 3254080 3254106 1000 . . gene_id "CUFF.47"; transcript_id "CUFF.47.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3254080 3254106 1000 . . gene_id "CUFF.47"; transcript_id "CUFF.47.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3277156 3277182 1000 . . gene_id "CUFF.49"; transcript_id "CUFF.49.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3277156 3277182 1000 . . gene_id "CUFF.49"; transcript_id "CUFF.49.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3277914 3278390 1000 . . gene_id "CUFF.51"; transcript_id "CUFF.51.1"; FPKM "14.9481879513"; frac "1.000000"; conf_lo "7.228977"; conf_hi "22.667399"; cov "0.849057"; -chr1 Cufflinks exon 3277914 3278390 1000 . . gene_id "CUFF.51"; transcript_id "CUFF.51.1"; exon_number "1"; FPKM "14.9481879513"; frac "1.000000"; conf_lo "7.228977"; conf_hi "22.667399"; cov "0.849057"; -chr1 Cufflinks transcript 3280118 3280144 1000 . . gene_id "CUFF.53"; transcript_id "CUFF.53.1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000"; -chr1 Cufflinks exon 3280118 3280144 1000 . . gene_id "CUFF.53"; transcript_id "CUFF.53.1"; exon_number "1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000"; -chr1 Cufflinks transcript 3280499 3280525 1000 . . gene_id "CUFF.55"; transcript_id "CUFF.55.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3280499 3280525 1000 . . gene_id "CUFF.55"; transcript_id "CUFF.55.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3282505 3282531 1000 . . gene_id "CUFF.57"; transcript_id "CUFF.57.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3282505 3282531 1000 . . gene_id "CUFF.57"; transcript_id "CUFF.57.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3282651 3282677 1000 . . gene_id "CUFF.59"; transcript_id "CUFF.59.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3282651 3282677 1000 . . gene_id "CUFF.59"; transcript_id "CUFF.59.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3282761 3282832 1000 . . gene_id "CUFF.61"; transcript_id "CUFF.61.1"; FPKM "13.2042326903"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.877838"; cov "0.750000"; -chr1 Cufflinks exon 3282761 3282832 1000 . . gene_id "CUFF.61"; transcript_id "CUFF.61.1"; exon_number "1"; FPKM "13.2042326903"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.877838"; cov "0.750000"; -chr1 Cufflinks transcript 3284967 3284993 1000 . . gene_id "CUFF.63"; transcript_id "CUFF.63.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3284967 3284993 1000 . . gene_id "CUFF.63"; transcript_id "CUFF.63.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3290799 3290859 1000 . . gene_id "CUFF.65"; transcript_id "CUFF.65.1"; FPKM "31.1706476623"; frac "1.000000"; conf_lo "0.000000"; conf_hi "62.341295"; cov "1.770492"; -chr1 Cufflinks exon 3290799 3290859 1000 . . gene_id "CUFF.65"; transcript_id "CUFF.65.1"; exon_number "1"; FPKM "31.1706476623"; frac "1.000000"; conf_lo "0.000000"; conf_hi "62.341295"; cov "1.770492"; -chr1 Cufflinks transcript 3299444 3299640 1000 . . gene_id "CUFF.67"; transcript_id "CUFF.67.1"; FPKM "15.6813507371"; frac "1.000000"; conf_lo "3.378764"; conf_hi "27.983938"; cov "0.890700"; -chr1 Cufflinks exon 3299444 3299640 1000 . . gene_id "CUFF.67"; transcript_id "CUFF.67.1"; exon_number "1"; FPKM "15.6813507371"; frac "1.000000"; conf_lo "3.378764"; conf_hi "27.983938"; cov "0.890700"; -chr1 Cufflinks transcript 3290920 3291273 1000 . . gene_id "CUFF.69"; transcript_id "CUFF.69.1"; FPKM "18.7992465421"; frac "1.000000"; conf_lo "8.750627"; conf_hi "28.847866"; cov "1.067797"; -chr1 Cufflinks exon 3290920 3291273 1000 . . gene_id "CUFF.69"; transcript_id "CUFF.69.1"; exon_number "1"; FPKM "18.7992465421"; frac "1.000000"; conf_lo "8.750627"; conf_hi "28.847866"; cov "1.067797"; -chr1 Cufflinks transcript 3299692 3299733 1000 . . gene_id "CUFF.71"; transcript_id "CUFF.71.1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "54.647722"; cov "1.285714"; -chr1 Cufflinks exon 3299692 3299733 1000 . . gene_id "CUFF.71"; transcript_id "CUFF.71.1"; exon_number "1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "54.647722"; cov "1.285714"; -chr1 Cufflinks transcript 3307749 3307775 1000 . . gene_id "CUFF.73"; transcript_id "CUFF.73.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3307749 3307775 1000 . . gene_id "CUFF.73"; transcript_id "CUFF.73.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3318621 3318647 1000 . . gene_id "CUFF.75"; transcript_id "CUFF.75.1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000"; -chr1 Cufflinks exon 3318621 3318647 1000 . . gene_id "CUFF.75"; transcript_id "CUFF.75.1"; exon_number "1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000"; -chr1 Cufflinks transcript 3330528 3330554 1000 . . gene_id "CUFF.77"; transcript_id "CUFF.77.1"; FPKM "17.6056435870"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.816931"; cov "1.000000"; -chr1 Cufflinks exon 3330528 3330554 1000 . . gene_id "CUFF.77"; transcript_id "CUFF.77.1"; exon_number "1"; FPKM "17.6056435870"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.816931"; cov "1.000000"; -chr1 Cufflinks transcript 3351241 3351311 1000 . . gene_id "CUFF.79"; transcript_id "CUFF.79.1"; FPKM "13.3902077986"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.326821"; cov "0.760563"; -chr1 Cufflinks exon 3351241 3351311 1000 . . gene_id "CUFF.79"; transcript_id "CUFF.79.1"; exon_number "1"; FPKM "13.3902077986"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.326821"; cov "0.760563"; -chr1 Cufflinks transcript 3355908 3356119 1000 . . gene_id "CUFF.81"; transcript_id "CUFF.81.1"; FPKM "11.2111409634"; frac "1.000000"; conf_lo "1.183592"; conf_hi "21.238690"; cov "0.636792"; -chr1 Cufflinks exon 3355908 3356119 1000 . . gene_id "CUFF.81"; transcript_id "CUFF.81.1"; exon_number "1"; FPKM "11.2111409634"; frac "1.000000"; conf_lo "1.183592"; conf_hi "21.238690"; cov "0.636792"; -chr1 Cufflinks transcript 3356181 3356225 1000 . . gene_id "CUFF.83"; transcript_id "CUFF.83.1"; FPKM "21.1267723045"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.004540"; cov "1.200000"; -chr1 Cufflinks exon 3356181 3356225 1000 . . gene_id "CUFF.83"; transcript_id "CUFF.83.1"; exon_number "1"; FPKM "21.1267723045"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.004540"; cov "1.200000"; -chr1 Cufflinks transcript 3363077 3363176 1000 . . gene_id "CUFF.85"; transcript_id "CUFF.85.1"; FPKM "19.0140950740"; frac "1.000000"; conf_lo "0.000000"; conf_hi "38.028190"; cov "1.080000"; -chr1 Cufflinks exon 3363077 3363176 1000 . . gene_id "CUFF.85"; transcript_id "CUFF.85.1"; exon_number "1"; FPKM "19.0140950740"; frac "1.000000"; conf_lo "0.000000"; conf_hi "38.028190"; cov "1.080000"; -chr1 Cufflinks transcript 3363388 3363446 1000 . . gene_id "CUFF.87"; transcript_id "CUFF.87.1"; FPKM "24.1704598398"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.080103"; cov "1.372881"; -chr1 Cufflinks exon 3363388 3363446 1000 . . gene_id "CUFF.87"; transcript_id "CUFF.87.1"; exon_number "1"; FPKM "24.1704598398"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.080103"; cov "1.372881"; -chr1 Cufflinks transcript 3364872 3364919 1000 . . gene_id "CUFF.89"; transcript_id "CUFF.89.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "64.015126"; cov "1.687500"; -chr1 Cufflinks exon 3364872 3364919 1000 . . gene_id "CUFF.89"; transcript_id "CUFF.89.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "64.015126"; cov "1.687500"; -chr1 Cufflinks transcript 3367211 3367237 1000 . . gene_id "CUFF.91"; transcript_id "CUFF.91.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3367211 3367237 1000 . . gene_id "CUFF.91"; transcript_id "CUFF.91.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3369581 3369607 1000 . . gene_id "CUFF.93"; transcript_id "CUFF.93.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3369581 3369607 1000 . . gene_id "CUFF.93"; transcript_id "CUFF.93.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3375002 3375028 1000 . . gene_id "CUFF.95"; transcript_id "CUFF.95.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3375002 3375028 1000 . . gene_id "CUFF.95"; transcript_id "CUFF.95.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3379889 3379915 1000 . . gene_id "CUFF.97"; transcript_id "CUFF.97.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks exon 3379889 3379915 1000 . . gene_id "CUFF.97"; transcript_id "CUFF.97.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; -chr1 Cufflinks transcript 3386740 3386836 1000 . . gene_id "CUFF.99"; transcript_id "CUFF.99.1"; FPKM "19.6021598701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.204320"; cov "1.113402"; -chr1 Cufflinks exon 3386740 3386836 1000 . . gene_id "CUFF.99"; transcript_id "CUFF.99.1"; exon_number "1"; FPKM "19.6021598701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.204320"; cov "1.113402"; +chr1 Cufflinks transcript 5 10 1000 - . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; +chr1 Cufflinks exon 2 10 1000 - . gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; +chr1 Cufflinks transcript 15 20 1000 + . gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; +chr1 Cufflinks exon 12 20 0.000000 + . gene_id "CUFF.3"; transcript_id "CUFF.3.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000"; +chr1 Cufflinks transcript 25 30 1000 - . gene_id "CUFF.5"; transcript_id "CUFF.5.1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672"; +chr1 Cufflinks exon 22 30 0.000000 - . gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672"; +chr1 Cufflinks transcript 42 47 1000 + . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500"; +chr1 Cufflinks exon 42 47 0.000000 + . gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500"; +
--- a/test-data/gffcompare_in3.gtf Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_in3.gtf Mon May 27 13:54:15 2019 -0400 @@ -1,100 +1,10 @@ -chr1 mm9_refFlat stop_codon 3206103 3206105 0.000000 - . gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat CDS 3206106 3207049 0.000000 - 2 gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat exon 3204563 3207049 0.000000 - . gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat CDS 3411783 3411982 0.000000 - 1 gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat exon 3411783 3411982 0.000000 - . gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat CDS 3660633 3661429 0.000000 - 0 gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat start_codon 3661427 3661429 0.000000 - . gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat exon 3660633 3661579 0.000000 - . gene_id "Xkr4"; transcript_id "Xkr4"; -chr1 mm9_refFlat stop_codon 4334681 4334683 0.000000 - . gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat CDS 4334684 4340172 0.000000 - 2 gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat exon 4334224 4340172 0.000000 - . gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat CDS 4341991 4342162 0.000000 - 0 gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat exon 4341991 4342162 0.000000 - . gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat CDS 4342283 4342906 0.000000 - 0 gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat start_codon 4342904 4342906 0.000000 - . gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat exon 4342283 4342918 0.000000 - . gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat exon 4350281 4350473 0.000000 - . gene_id "Rp1"; transcript_id "Rp1"; -chr1 mm9_refFlat stop_codon 4481797 4481799 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat CDS 4481800 4482749 0.000000 - 2 gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat exon 4481009 4482749 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat CDS 4483181 4483487 0.000000 - 0 gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat start_codon 4483485 4483487 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat exon 4483181 4483547 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat exon 4483853 4483944 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat exon 4485217 4486023 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat exon 4486372 4486494 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; -chr1 mm9_refFlat stop_codon 4766545 4766547 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat CDS 4766548 4766882 0.000000 - 2 gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat exon 4763279 4766882 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat CDS 4767606 4767729 0.000000 - 0 gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat exon 4767606 4767729 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat CDS 4772649 4772814 0.000000 - 1 gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat exon 4772649 4772814 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat CDS 4774032 4774186 0.000000 - 0 gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat exon 4774032 4774186 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat CDS 4775654 4775758 0.000000 - 0 gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat start_codon 4775756 4775758 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat exon 4775654 4775807 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15"; -chr1 mm9_refFlat stop_codon 4764533 4764535 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat CDS 4764536 4764597 0.000000 - 2 gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat exon 4763279 4764597 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat CDS 4767606 4767729 0.000000 - 0 gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat exon 4767606 4767729 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat CDS 4772649 4772814 0.000000 - 1 gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat exon 4772649 4772814 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat CDS 4774032 4774186 0.000000 - 0 gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat exon 4774032 4774186 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat CDS 4775654 4775758 0.000000 - 0 gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat start_codon 4775756 4775758 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat exon 4775654 4775807 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; -chr1 mm9_refFlat exon 4763279 4764597 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; -chr1 mm9_refFlat exon 4767606 4767729 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; -chr1 mm9_refFlat exon 4772649 4772814 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; -chr1 mm9_refFlat exon 4775654 4775807 0.000000 - . gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; -chr1 mm9_refFlat start_codon 4797995 4797997 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4797995 4798063 0.000000 + 0 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4797974 4798063 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4798536 4798567 0.000000 + 0 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4798536 4798567 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4818665 4818730 0.000000 + 1 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4818665 4818730 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4820349 4820396 0.000000 + 1 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4820349 4820396 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4822392 4822462 0.000000 + 1 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4822392 4822462 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4827082 4827155 0.000000 + 2 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4827082 4827155 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4829468 4829569 0.000000 + 0 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4829468 4829569 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4831037 4831213 0.000000 + 0 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4831037 4831213 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat CDS 4835044 4835094 0.000000 + 0 gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat stop_codon 4835095 4835097 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat exon 4835044 4836816 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; -chr1 mm9_refFlat start_codon 4847995 4847997 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4847995 4848057 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4847775 4848057 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4857551 4857613 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4857551 4857613 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4868108 4868213 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4868108 4868213 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4876825 4876912 0.000000 + 2 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4876825 4876912 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4879538 4879683 0.000000 + 1 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4879538 4879683 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4880821 4880877 0.000000 + 2 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4880821 4880877 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4881996 4882150 0.000000 + 2 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4881996 4882150 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4883498 4883644 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4883498 4883644 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4885015 4885086 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4885015 4885086 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat CDS 4886437 4886442 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat stop_codon 4886443 4886445 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat exon 4886437 4887987 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1"; -chr1 mm9_refFlat start_codon 4847995 4847997 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1_dup1"; -chr1 mm9_refFlat CDS 4847995 4848057 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1_dup1"; -chr1 mm9_refFlat exon 4847775 4848057 0.000000 + . gene_id "Tcea1"; transcript_id "Tcea1_dup1"; -chr1 mm9_refFlat CDS 4857551 4857613 0.000000 + 0 gene_id "Tcea1"; transcript_id "Tcea1_dup1"; +chr1 mm9_refFlat CDS 5 10 0.000000 - 0 gene_id "Xkr4"; transcript_id "Xkr4"; +chr1 mm9_refFlat exon 2 10 0.000000 - . gene_id "Xkr4"; transcript_id "Xkr4"; +chr1 mm9_refFlat CDS 15 20 0.000000 - 0 gene_id "Rp1"; transcript_id "Rp1"; +chr1 mm9_refFlat exon 12 20 0.000000 - . gene_id "Rp1"; transcript_id "Rp1"; +chr1 mm9_refFlat CDS 25 30 0.000000 - 0 gene_id "Sox17"; transcript_id "Sox17"; +chr1 mm9_refFlat exon 22 30 0.000000 - . gene_id "Sox17"; transcript_id "Sox17"; +chr1 mm9_refFlat CDS 32 37 0.000000 + 0 gene_id "Lypla1"; transcript_id "Lypla1"; +chr1 mm9_refFlat exon 32 40 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1"; +chr1 mm9_refFlat CDS 42 50 0.000000 + 0 gene_id "Lypla1"; transcript_id "Lypla1"; +chr1 mm9_refFlat exon 42 50 0.000000 + . gene_id "Lypla1"; transcript_id "Lypla1";
--- a/test-data/gffcompare_out1-1.refmap Tue Feb 05 15:51:44 2019 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -ref_gene_id ref_id class_code qry_id_list -Xkr4 Xkr4 c CUFF.13|CUFF.13.1
--- a/test-data/gffcompare_out1-1.tmap Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out1-1.tmap Mon May 27 13:54:15 2019 -0400 @@ -1,51 +1,7 @@ ref_gene_id ref_id class_code qry_gene_id qry_id num_exons FPKM TPM cov len major_iso_id ref_match_len -- - u CUFF.1 CUFF.1.1 1 20.607936 0.000000 1.317073 41 CUFF.1.1 - -- - u CUFF.3 CUFF.3.1 1 27.255658 0.000000 1.741935 31 CUFF.3.1 - -- - u CUFF.5 CUFF.5.1 1 31.293533 0.000000 2.000000 27 CUFF.5.1 - -- - u CUFF.7 CUFF.7.1 1 9.999117 0.000000 0.639053 169 CUFF.7.1 - -- - u CUFF.9 CUFF.9.1 1 17.776896 0.000000 1.136139 404 CUFF.9.1 - -- - u CUFF.11 CUFF.11.1 1 31.293533 0.000000 2.000000 27 CUFF.11.1 - -Xkr4 Xkr4 c CUFF.13 CUFF.13.1 1 10.695258 0.000000 0.683544 79 CUFF.13.1 3634 -Xkr4 Xkr4 i CUFF.15 CUFF.15.1 1 10.695258 0.000000 0.683544 79 CUFF.15.1 3634 -Xkr4 Xkr4 i CUFF.17 CUFF.17.1 1 8.710571 0.000000 0.556701 97 CUFF.17.1 3634 -Xkr4 Xkr4 i CUFF.19 CUFF.19.1 1 29.337687 0.000000 1.875000 72 CUFF.19.1 3634 -Xkr4 Xkr4 i CUFF.21 CUFF.21.1 1 13.851236 0.000000 0.885246 61 CUFF.21.1 3634 -Xkr4 Xkr4 i CUFF.23 CUFF.23.1 1 23.470150 0.000000 1.500000 54 CUFF.23.1 3634 -Xkr4 Xkr4 i CUFF.25 CUFF.25.1 1 14.567679 0.000000 0.931034 290 CUFF.25.1 3634 -Xkr4 Xkr4 i CUFF.27 CUFF.27.1 1 34.253732 0.000000 2.189189 37 CUFF.27.1 3634 -- - u CUFF.29 CUFF.29.1 1 107.103219 0.000000 6.845070 142 CUFF.29.1 - -- - u CUFF.31 CUFF.31.1 1 122.650461 0.000000 7.838710 31 CUFF.31.1 - -- - u CUFF.33 CUFF.33.1 1 109.527366 0.000000 7.000000 27 CUFF.33.1 - -- - u CUFF.35 CUFF.35.1 1 96.747183 0.000000 6.183206 131 CUFF.35.1 - -- - u CUFF.37 CUFF.37.1 1 104.085013 0.000000 6.652174 69 CUFF.37.1 - -- - u CUFF.39 CUFF.39.1 1 23.912983 0.000000 1.528302 53 CUFF.39.1 - -- - u CUFF.41 CUFF.41.1 1 10.695258 0.000000 0.683544 79 CUFF.41.1 - -- - u CUFF.43 CUFF.43.1 1 10.561567 0.000000 0.675000 80 CUFF.43.1 - -- - u CUFF.45 CUFF.45.1 1 20.708956 0.000000 1.323529 102 CUFF.45.1 - -- - u CUFF.47 CUFF.47.1 1 20.607936 0.000000 1.317073 41 CUFF.47.1 - -- - u CUFF.49 CUFF.49.1 1 15.646767 0.000000 1.000000 27 CUFF.49.1 - -- - u CUFF.51 CUFF.51.1 1 31.293533 0.000000 2.000000 27 CUFF.51.1 - -- - u CUFF.53 CUFF.53.1 1 31.293533 0.000000 2.000000 27 CUFF.53.1 - -- - u CUFF.55 CUFF.55.1 1 31.293533 0.000000 2.000000 27 CUFF.55.1 - -- - u CUFF.57 CUFF.57.1 1 15.646767 0.000000 1.000000 27 CUFF.57.1 - -- - u CUFF.59 CUFF.59.1 1 15.646767 0.000000 1.000000 27 CUFF.59.1 - -Xkr4 Xkr4 i CUFF.61 CUFF.61.1 1 45.263860 0.000000 2.892857 28 CUFF.61.1 3634 -Xkr4 Xkr4 i CUFF.63 CUFF.63.1 1 15.646767 0.000000 1.000000 27 CUFF.63.1 3634 -Xkr4 Xkr4 i CUFF.65 CUFF.65.1 1 15.362280 0.000000 0.981818 55 CUFF.65.1 3634 -Xkr4 Xkr4 i CUFF.67 CUFF.67.1 1 12.998852 0.000000 0.830769 65 CUFF.67.1 3634 -Xkr4 Xkr4 i CUFF.69 CUFF.69.1 1 10.058636 0.000000 0.642857 84 CUFF.69.1 3634 -Xkr4 Xkr4 i CUFF.71 CUFF.71.1 1 8.621688 0.000000 0.551020 98 CUFF.71.1 3634 -Xkr4 Xkr4 i CUFF.73 CUFF.73.1 1 15.362280 0.000000 0.981818 55 CUFF.73.1 3634 -Xkr4 Xkr4 i CUFF.75 CUFF.75.1 1 31.293533 0.000000 2.000000 27 CUFF.75.1 3634 -Xkr4 Xkr4 i CUFF.77 CUFF.77.1 1 16.248565 0.000000 1.038462 52 CUFF.77.1 3634 -Xkr4 Xkr4 i CUFF.79 CUFF.79.1 1 31.293533 0.000000 2.000000 27 CUFF.79.1 3634 -Xkr4 Xkr4 i CUFF.81 CUFF.81.1 1 13.201959 0.000000 0.843750 64 CUFF.81.1 3634 -Xkr4 Xkr4 i CUFF.83 CUFF.83.1 1 13.201959 0.000000 0.843750 96 CUFF.83.1 3634 -Xkr4 Xkr4 i CUFF.85 CUFF.85.1 1 31.293533 0.000000 2.000000 27 CUFF.85.1 3634 -Xkr4 Xkr4 i CUFF.87 CUFF.87.1 1 17.243375 0.000000 1.102041 49 CUFF.87.1 3634 -Xkr4 Xkr4 i CUFF.89 CUFF.89.1 1 16.567165 0.000000 1.058824 51 CUFF.89.1 3634 -Xkr4 Xkr4 i CUFF.91 CUFF.91.1 1 31.293533 0.000000 2.000000 27 CUFF.91.1 3634 -Xkr4 Xkr4 i CUFF.93 CUFF.93.1 1 21.664754 0.000000 1.384615 39 CUFF.93.1 3634 -Xkr4 Xkr4 i CUFF.95 CUFF.95.1 1 46.940300 0.000000 3.000000 27 CUFF.95.1 3634 -Xkr4 Xkr4 i CUFF.97 CUFF.97.1 1 21.481154 0.000000 1.372881 59 CUFF.97.1 3634 -Xkr4 Xkr4 i CUFF.99 CUFF.99.1 1 14.567679 0.000000 0.931034 58 CUFF.99.1 3634 +- - u CUFF.1 CUFF.1.1 1 20.607936 0.000000 1.317073 9 CUFF.1.1 - +- - u CUFF.3 CUFF.3.1 1 27.255658 0.000000 1.741935 6 CUFF.3.1 - +- - u CUFF.5 CUFF.5.1 1 31.293533 0.000000 2.000000 9 CUFF.5.1 - +- - u CUFF.7 CUFF.7.1 1 9.999117 0.000000 0.639053 9 CUFF.7.1 - +- - u CUFF.9 CUFF.9.1 1 17.776896 0.000000 1.136139 9 CUFF.9.1 - +- - u CUFF.10 CUFF.10.1 1 17.776896 0.000000 1.136139 9 CUFF.10.1 -
--- a/test-data/gffcompare_out1-2.refmap Tue Feb 05 15:51:44 2019 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -ref_gene_id ref_id class_code qry_id_list
--- a/test-data/gffcompare_out1-2.tmap Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out1-2.tmap Mon May 27 13:54:15 2019 -0400 @@ -1,51 +1,5 @@ ref_gene_id ref_id class_code qry_gene_id qry_id num_exons FPKM TPM cov len major_iso_id ref_match_len -- - u CUFF.1 CUFF.1.1 1 35.211287 0.000000 2.000000 27 CUFF.1.1 - -- - u CUFF.3 CUFF.3.1 1 35.211287 0.000000 2.000000 27 CUFF.3.1 - -- - u CUFF.5 CUFF.5.1 1 21.226627 0.000000 1.205672 27 CUFF.5.1 - -- - u CUFF.7 CUFF.7.1 1 29.709524 0.000000 1.687500 576 CUFF.7.1 - -- - u CUFF.9 CUFF.9.1 1 34.072933 0.000000 1.935341 565 CUFF.9.1 - -- - u CUFF.11 CUFF.11.1 1 32.531777 0.000000 1.847804 979 CUFF.11.1 - -- - u CUFF.13 CUFF.13.1 1 16.582060 0.000000 0.941860 86 CUFF.13.1 - -- - u CUFF.15 CUFF.15.1 1 35.211287 0.000000 2.000000 27 CUFF.15.1 - -- - u CUFF.17 CUFF.17.1 1 35.211287 0.000000 2.000000 27 CUFF.17.1 - -- - u CUFF.19 CUFF.19.1 1 35.211287 0.000000 2.000000 27 CUFF.19.1 - -- - u CUFF.21 CUFF.21.1 1 35.211287 0.000000 2.000000 27 CUFF.21.1 - -- - u CUFF.23 CUFF.23.1 1 16.205195 0.000000 0.920455 88 CUFF.23.1 - -- - u CUFF.25 CUFF.25.1 1 35.211287 0.000000 2.000000 27 CUFF.25.1 - -- - u CUFF.26 CUFF.26.1 1 29.709524 0.000000 1.687500 32 CUFF.26.1 - -- - u CUFF.29 CUFF.29.1 1 13.581496 0.000000 0.771429 70 CUFF.29.1 - -- - u CUFF.31 CUFF.31.1 1 22.635827 0.000000 1.285714 84 CUFF.31.1 - -Xkr4 Xkr4 i CUFF.33 CUFF.33.1 1 23.767619 0.000000 1.350000 40 CUFF.33.1 3634 -Xkr4 Xkr4 i CUFF.35 CUFF.35.1 1 11.317914 0.000000 0.642857 84 CUFF.35.1 3634 -Xkr4 Xkr4 i CUFF.37 CUFF.37.1 1 11.500461 0.000000 0.653226 124 CUFF.37.1 3634 -Xkr4 Xkr4 i CUFF.39 CUFF.39.1 1 52.816931 0.000000 3.000000 27 CUFF.39.1 3634 -Xkr4 Xkr4 i CUFF.41 CUFF.41.1 1 43.213852 0.000000 2.454545 33 CUFF.41.1 3634 -Xkr4 Xkr4 i CUFF.43 CUFF.43.1 1 23.474191 0.000000 1.333333 81 CUFF.43.1 3634 -Xkr4 Xkr4 i CUFF.45 CUFF.45.1 1 20.667495 0.000000 1.173913 46 CUFF.45.1 3634 -Xkr4 Xkr4 i CUFF.47 CUFF.47.1 1 35.211287 0.000000 2.000000 27 CUFF.47.1 3634 -Xkr4 Xkr4 i CUFF.49 CUFF.49.1 1 35.211287 0.000000 2.000000 27 CUFF.49.1 3634 -Xkr4 Xkr4 i CUFF.51 CUFF.51.1 1 14.948188 0.000000 0.849057 477 CUFF.51.1 3634 -Xkr4 Xkr4 i CUFF.53 CUFF.53.1 1 52.816931 0.000000 3.000000 27 CUFF.53.1 3634 -Xkr4 Xkr4 i CUFF.55 CUFF.55.1 1 35.211287 0.000000 2.000000 27 CUFF.55.1 3634 -Xkr4 Xkr4 i CUFF.57 CUFF.57.1 1 35.211287 0.000000 2.000000 27 CUFF.57.1 3634 -Xkr4 Xkr4 i CUFF.59 CUFF.59.1 1 35.211287 0.000000 2.000000 27 CUFF.59.1 3634 -Xkr4 Xkr4 i CUFF.61 CUFF.61.1 1 13.204233 0.000000 0.750000 72 CUFF.61.1 3634 -Xkr4 Xkr4 i CUFF.63 CUFF.63.1 1 35.211287 0.000000 2.000000 27 CUFF.63.1 3634 -Xkr4 Xkr4 i CUFF.65 CUFF.65.1 1 31.170648 0.000000 1.770492 61 CUFF.65.1 3634 -Xkr4 Xkr4 i CUFF.67 CUFF.67.1 1 15.681351 0.000000 0.890700 197 CUFF.67.1 3634 -Xkr4 Xkr4 i CUFF.69 CUFF.69.1 1 18.799247 0.000000 1.067797 354 CUFF.69.1 3634 -Xkr4 Xkr4 i CUFF.71 CUFF.71.1 1 22.635827 0.000000 1.285714 42 CUFF.71.1 3634 -Xkr4 Xkr4 i CUFF.73 CUFF.73.1 1 35.211287 0.000000 2.000000 27 CUFF.73.1 3634 -Xkr4 Xkr4 i CUFF.75 CUFF.75.1 1 52.816931 0.000000 3.000000 27 CUFF.75.1 3634 -Xkr4 Xkr4 i CUFF.77 CUFF.77.1 1 17.605644 0.000000 1.000000 27 CUFF.77.1 3634 -Xkr4 Xkr4 i CUFF.79 CUFF.79.1 1 13.390208 0.000000 0.760563 71 CUFF.79.1 3634 -Xkr4 Xkr4 i CUFF.81 CUFF.81.1 1 11.211141 0.000000 0.636792 212 CUFF.81.1 3634 -Xkr4 Xkr4 i CUFF.83 CUFF.83.1 1 21.126772 0.000000 1.200000 45 CUFF.83.1 3634 -Xkr4 Xkr4 i CUFF.85 CUFF.85.1 1 19.014095 0.000000 1.080000 100 CUFF.85.1 3634 -Xkr4 Xkr4 i CUFF.87 CUFF.87.1 1 24.170460 0.000000 1.372881 59 CUFF.87.1 3634 -Xkr4 Xkr4 i CUFF.89 CUFF.89.1 1 29.709524 0.000000 1.687500 48 CUFF.89.1 3634 -Xkr4 Xkr4 i CUFF.91 CUFF.91.1 1 35.211287 0.000000 2.000000 27 CUFF.91.1 3634 -Xkr4 Xkr4 i CUFF.93 CUFF.93.1 1 35.211287 0.000000 2.000000 27 CUFF.93.1 3634 -Xkr4 Xkr4 i CUFF.95 CUFF.95.1 1 35.211287 0.000000 2.000000 27 CUFF.95.1 3634 -Xkr4 Xkr4 i CUFF.97 CUFF.97.1 1 35.211287 0.000000 2.000000 27 CUFF.97.1 3634 -Xkr4 Xkr4 i CUFF.99 CUFF.99.1 1 19.602160 0.000000 1.113402 97 CUFF.99.1 3634 +- - u CUFF.1 CUFF.1.1 1 35.211287 0.000000 2.000000 9 CUFF.1.1 - +- - u CUFF.3 CUFF.3.1 1 35.211287 0.000000 2.000000 9 CUFF.3.1 - +- - u CUFF.5 CUFF.5.1 1 21.226627 0.000000 1.205672 9 CUFF.5.1 - +- - u CUFF.7 CUFF.7.1 1 29.709524 0.000000 1.687500 6 CUFF.7.1 -
--- a/test-data/gffcompare_out1.gtf Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out1.gtf Mon May 27 13:54:15 2019 -0400 @@ -1,200 +1,16 @@ -chr1 Cufflinks transcript 3204755 3204833 . - . transcript_id "TCONS_00000001"; gene_id "XLOC_000001"; gene_name "Xkr4"; oId "CUFF.13.1"; cmp_ref "Xkr4"; class_code "c"; tss_id "TSS1"; -chr1 Cufflinks exon 3204755 3204833 . - . transcript_id "TCONS_00000001"; gene_id "XLOC_000001"; exon_number "1"; -chr1 Cufflinks transcript 3111450 3111490 . . . transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; oId "CUFF.1.1"; class_code "u"; tss_id "TSS2"; -chr1 Cufflinks exon 3111450 3111490 . . . transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; exon_number "1"; -chr1 Cufflinks transcript 3111546 3111576 . . . transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS3"; -chr1 Cufflinks exon 3111546 3111576 . . . transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; exon_number "1"; -chr1 Cufflinks transcript 3174766 3174792 . . . transcript_id "TCONS_00000051"; gene_id "XLOC_000004"; oId "CUFF.1.1"; class_code "u"; tss_id "TSS4"; -chr1 Cufflinks exon 3174766 3174792 . . . transcript_id "TCONS_00000051"; gene_id "XLOC_000004"; exon_number "1"; -chr1 Cufflinks transcript 3187402 3187428 . . . transcript_id "TCONS_00000052"; gene_id "XLOC_000005"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS5"; -chr1 Cufflinks exon 3187402 3187428 . . . transcript_id "TCONS_00000052"; gene_id "XLOC_000005"; exon_number "1"; -chr1 Cufflinks transcript 3188522 3188548 . . . transcript_id "TCONS_00000053"; gene_id "XLOC_000006"; oId "CUFF.5.1"; class_code "u"; tss_id "TSS6"; -chr1 Cufflinks exon 3188522 3188548 . . . transcript_id "TCONS_00000053"; gene_id "XLOC_000006"; exon_number "1"; -chr1 Cufflinks transcript 3189811 3190789 . . . transcript_id "TCONS_00000054"; gene_id "XLOC_000007"; oId "CUFF.11.1"; class_code "u"; tss_id "TSS7"; -chr1 Cufflinks exon 3189811 3190789 . . . transcript_id "TCONS_00000054"; gene_id "XLOC_000007"; exon_number "1"; -chr1 Cufflinks transcript 3189900 3190041 . . . transcript_id "TCONS_00000004"; gene_id "XLOC_000007"; oId "CUFF.29.1"; contained_in "TCONS_00000054"; class_code "u"; tss_id "TSS7"; -chr1 Cufflinks exon 3189900 3190041 . . . transcript_id "TCONS_00000004"; gene_id "XLOC_000007"; exon_number "1"; -chr1 Cufflinks transcript 3190273 3190303 . . . transcript_id "TCONS_00000005"; gene_id "XLOC_000007"; oId "CUFF.31.1"; contained_in "TCONS_00000054"; class_code "u"; tss_id "TSS8"; -chr1 Cufflinks exon 3190273 3190303 . . . transcript_id "TCONS_00000005"; gene_id "XLOC_000007"; exon_number "1"; -chr1 Cufflinks transcript 3190455 3190481 . . . transcript_id "TCONS_00000006"; gene_id "XLOC_000007"; oId "CUFF.33.1"; contained_in "TCONS_00000054"; class_code "u"; tss_id "TSS9"; -chr1 Cufflinks exon 3190455 3190481 . . . transcript_id "TCONS_00000006"; gene_id "XLOC_000007"; exon_number "1"; -chr1 Cufflinks transcript 3190859 3191434 . . . transcript_id "TCONS_00000055"; gene_id "XLOC_000008"; oId "CUFF.7.1"; class_code "u"; tss_id "TSS10"; -chr1 Cufflinks exon 3190859 3191434 . . . transcript_id "TCONS_00000055"; gene_id "XLOC_000008"; exon_number "1"; -chr1 Cufflinks transcript 3191513 3192077 . . . transcript_id "TCONS_00000056"; gene_id "XLOC_000009"; oId "CUFF.9.1"; class_code "u"; tss_id "TSS11"; -chr1 Cufflinks exon 3191513 3192077 . . . transcript_id "TCONS_00000056"; gene_id "XLOC_000009"; exon_number "1"; -chr1 Cufflinks transcript 3191539 3191669 . . . transcript_id "TCONS_00000007"; gene_id "XLOC_000009"; oId "CUFF.35.1"; contained_in "TCONS_00000056"; class_code "u"; tss_id "TSS11"; -chr1 Cufflinks exon 3191539 3191669 . . . transcript_id "TCONS_00000007"; gene_id "XLOC_000009"; exon_number "1"; -chr1 Cufflinks transcript 3191877 3191945 . . . transcript_id "TCONS_00000008"; gene_id "XLOC_000009"; oId "CUFF.37.1"; contained_in "TCONS_00000056"; class_code "u"; tss_id "TSS12"; -chr1 Cufflinks exon 3191877 3191945 . . . transcript_id "TCONS_00000008"; gene_id "XLOC_000009"; exon_number "1"; -chr1 Cufflinks transcript 3192251 3192336 . . . transcript_id "TCONS_00000057"; gene_id "XLOC_000010"; oId "CUFF.13.1"; class_code "u"; tss_id "TSS13"; -chr1 Cufflinks exon 3192251 3192336 . . . transcript_id "TCONS_00000057"; gene_id "XLOC_000010"; exon_number "1"; -chr1 Cufflinks transcript 3192442 3192494 . . . transcript_id "TCONS_00000009"; gene_id "XLOC_000011"; oId "CUFF.39.1"; class_code "u"; tss_id "TSS14"; -chr1 Cufflinks exon 3192442 3192494 . . . transcript_id "TCONS_00000009"; gene_id "XLOC_000011"; exon_number "1"; -chr1 Cufflinks transcript 3192551 3192629 . . . transcript_id "TCONS_00000010"; gene_id "XLOC_000012"; oId "CUFF.41.1"; class_code "u"; tss_id "TSS15"; -chr1 Cufflinks exon 3192551 3192629 . . . transcript_id "TCONS_00000010"; gene_id "XLOC_000012"; exon_number "1"; -chr1 Cufflinks transcript 3192650 3192676 . . . transcript_id "TCONS_00000058"; gene_id "XLOC_000013"; oId "CUFF.15.1"; class_code "u"; tss_id "TSS16"; -chr1 Cufflinks exon 3192650 3192676 . . . transcript_id "TCONS_00000058"; gene_id "XLOC_000013"; exon_number "1"; -chr1 Cufflinks transcript 3192732 3192811 . . . transcript_id "TCONS_00000011"; gene_id "XLOC_000014"; oId "CUFF.43.1"; class_code "u"; tss_id "TSS17"; -chr1 Cufflinks exon 3192732 3192811 . . . transcript_id "TCONS_00000011"; gene_id "XLOC_000014"; exon_number "1"; -chr1 Cufflinks transcript 3192941 3193042 . . . transcript_id "TCONS_00000012"; gene_id "XLOC_000015"; oId "CUFF.45.1"; class_code "u"; tss_id "TSS18"; -chr1 Cufflinks exon 3192941 3193042 . . . transcript_id "TCONS_00000012"; gene_id "XLOC_000015"; exon_number "1"; -chr1 Cufflinks transcript 3194186 3194226 . . . transcript_id "TCONS_00000013"; gene_id "XLOC_000016"; oId "CUFF.47.1"; class_code "u"; tss_id "TSS19"; -chr1 Cufflinks exon 3194186 3194226 . . . transcript_id "TCONS_00000013"; gene_id "XLOC_000016"; exon_number "1"; -chr1 Cufflinks transcript 3194303 3194329 . . . transcript_id "TCONS_00000014"; gene_id "XLOC_000017"; oId "CUFF.49.1"; class_code "u"; tss_id "TSS20"; -chr1 Cufflinks exon 3194303 3194329 . . . transcript_id "TCONS_00000014"; gene_id "XLOC_000017"; exon_number "1"; -chr1 Cufflinks transcript 3194707 3194733 . . . transcript_id "TCONS_00000059"; gene_id "XLOC_000018"; oId "CUFF.17.1"; class_code "u"; tss_id "TSS21"; -chr1 Cufflinks exon 3194707 3194733 . . . transcript_id "TCONS_00000059"; gene_id "XLOC_000018"; exon_number "1"; -chr1 Cufflinks transcript 3195084 3195110 . . . transcript_id "TCONS_00000015"; gene_id "XLOC_000019"; oId "CUFF.51.1"; class_code "u"; tss_id "TSS22"; -chr1 Cufflinks exon 3195084 3195110 . . . transcript_id "TCONS_00000015"; gene_id "XLOC_000019"; exon_number "1"; -chr1 Cufflinks transcript 3195451 3195477 . . . transcript_id "TCONS_00000016"; gene_id "XLOC_000020"; oId "CUFF.53.1"; class_code "u"; tss_id "TSS23"; -chr1 Cufflinks exon 3195451 3195477 . . . transcript_id "TCONS_00000016"; gene_id "XLOC_000020"; exon_number "1"; -chr1 Cufflinks transcript 3197090 3197116 . . . transcript_id "TCONS_00000017"; gene_id "XLOC_000021"; oId "CUFF.55.1"; class_code "u"; tss_id "TSS24"; -chr1 Cufflinks exon 3197090 3197116 . . . transcript_id "TCONS_00000017"; gene_id "XLOC_000021"; exon_number "1"; -chr1 Cufflinks transcript 3197247 3197273 . . . transcript_id "TCONS_00000018"; gene_id "XLOC_000022"; oId "CUFF.57.1"; class_code "u"; tss_id "TSS25"; -chr1 Cufflinks exon 3197247 3197273 . . . transcript_id "TCONS_00000018"; gene_id "XLOC_000022"; exon_number "1"; -chr1 Cufflinks transcript 3197347 3197373 . . . transcript_id "TCONS_00000019"; gene_id "XLOC_000023"; oId "CUFF.59.1"; class_code "u"; tss_id "TSS26"; -chr1 Cufflinks exon 3197347 3197373 . . . transcript_id "TCONS_00000019"; gene_id "XLOC_000023"; exon_number "1"; -chr1 Cufflinks transcript 3197426 3197452 . . . transcript_id "TCONS_00000060"; gene_id "XLOC_000024"; oId "CUFF.19.1"; class_code "u"; tss_id "TSS27"; -chr1 Cufflinks exon 3197426 3197452 . . . transcript_id "TCONS_00000060"; gene_id "XLOC_000024"; exon_number "1"; -chr1 Cufflinks transcript 3200023 3200191 . . . transcript_id "TCONS_00000020"; gene_id "XLOC_000025"; oId "CUFF.7.1"; class_code "u"; tss_id "TSS28"; -chr1 Cufflinks exon 3200023 3200191 . . . transcript_id "TCONS_00000020"; gene_id "XLOC_000025"; exon_number "1"; -chr1 Cufflinks transcript 3200057 3200144 . . . transcript_id "TCONS_00000061"; gene_id "XLOC_000025"; oId "CUFF.23.1"; contained_in "TCONS_00000020"; class_code "u"; tss_id "TSS28"; -chr1 Cufflinks exon 3200057 3200144 . . . transcript_id "TCONS_00000061"; gene_id "XLOC_000025"; exon_number "1"; -chr1 Cufflinks transcript 3200326 3200352 . . . transcript_id "TCONS_00000021"; gene_id "XLOC_000026"; oId "CUFF.5.1"; class_code "u"; tss_id "TSS29"; -chr1 Cufflinks exon 3200326 3200352 . . . transcript_id "TCONS_00000021"; gene_id "XLOC_000026"; exon_number "1"; -chr1 Cufflinks transcript 3200431 3200457 . . . transcript_id "TCONS_00000062"; gene_id "XLOC_000027"; oId "CUFF.21.1"; class_code "u"; tss_id "TSS30"; -chr1 Cufflinks exon 3200431 3200457 . . . transcript_id "TCONS_00000062"; gene_id "XLOC_000027"; exon_number "1"; -chr1 Cufflinks transcript 3201008 3201039 . . . transcript_id "TCONS_00000063"; gene_id "XLOC_000028"; oId "CUFF.26.1"; class_code "u"; tss_id "TSS31"; -chr1 Cufflinks exon 3201008 3201039 . . . transcript_id "TCONS_00000063"; gene_id "XLOC_000028"; exon_number "1"; -chr1 Cufflinks transcript 3201078 3201481 . . . transcript_id "TCONS_00000022"; gene_id "XLOC_000029"; oId "CUFF.9.1"; class_code "u"; tss_id "TSS32"; -chr1 Cufflinks exon 3201078 3201481 . . . transcript_id "TCONS_00000022"; gene_id "XLOC_000029"; exon_number "1"; -chr1 Cufflinks transcript 3201161 3201187 . . . transcript_id "TCONS_00000064"; gene_id "XLOC_000029"; oId "CUFF.25.1"; contained_in "TCONS_00000022"; class_code "u"; tss_id "TSS32"; -chr1 Cufflinks exon 3201161 3201187 . . . transcript_id "TCONS_00000064"; gene_id "XLOC_000029"; exon_number "1"; -chr1 Cufflinks transcript 3201597 3201666 . . . transcript_id "TCONS_00000065"; gene_id "XLOC_000030"; oId "CUFF.29.1"; class_code "u"; tss_id "TSS33"; -chr1 Cufflinks exon 3201597 3201666 . . . transcript_id "TCONS_00000065"; gene_id "XLOC_000030"; exon_number "1"; -chr1 Cufflinks transcript 3201673 3201699 . . . transcript_id "TCONS_00000023"; gene_id "XLOC_000031"; oId "CUFF.11.1"; class_code "u"; tss_id "TSS34"; -chr1 Cufflinks exon 3201673 3201699 . . . transcript_id "TCONS_00000023"; gene_id "XLOC_000031"; exon_number "1"; -chr1 Cufflinks transcript 3201726 3201809 . . . transcript_id "TCONS_00000066"; gene_id "XLOC_000032"; oId "CUFF.31.1"; class_code "u"; tss_id "TSS35"; -chr1 Cufflinks exon 3201726 3201809 . . . transcript_id "TCONS_00000066"; gene_id "XLOC_000032"; exon_number "1"; -chr1 Cufflinks transcript 3211522 3211561 . . . transcript_id "TCONS_00000067"; gene_id "XLOC_000033"; gene_name "Xkr4"; oId "CUFF.33.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS36"; -chr1 Cufflinks exon 3211522 3211561 . . . transcript_id "TCONS_00000067"; gene_id "XLOC_000033"; exon_number "1"; -chr1 Cufflinks transcript 3212214 3212292 . . . transcript_id "TCONS_00000024"; gene_id "XLOC_000034"; gene_name "Xkr4"; oId "CUFF.15.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS37"; -chr1 Cufflinks exon 3212214 3212292 . . . transcript_id "TCONS_00000024"; gene_id "XLOC_000034"; exon_number "1"; -chr1 Cufflinks transcript 3212368 3212439 . . . transcript_id "TCONS_00000025"; gene_id "XLOC_000035"; gene_name "Xkr4"; oId "CUFF.19.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS38"; -chr1 Cufflinks exon 3212368 3212439 . . . transcript_id "TCONS_00000025"; gene_id "XLOC_000035"; exon_number "1"; -chr1 Cufflinks transcript 3212718 3212801 . . . transcript_id "TCONS_00000068"; gene_id "XLOC_000036"; gene_name "Xkr4"; oId "CUFF.35.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS39"; -chr1 Cufflinks exon 3212718 3212801 . . . transcript_id "TCONS_00000068"; gene_id "XLOC_000036"; exon_number "1"; -chr1 Cufflinks transcript 3213096 3213192 . . . transcript_id "TCONS_00000026"; gene_id "XLOC_000037"; gene_name "Xkr4"; oId "CUFF.17.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS40"; -chr1 Cufflinks exon 3213096 3213192 . . . transcript_id "TCONS_00000026"; gene_id "XLOC_000037"; exon_number "1"; -chr1 Cufflinks transcript 3213119 3213242 . . . transcript_id "TCONS_00000069"; gene_id "XLOC_000037"; gene_name "Xkr4"; oId "CUFF.37.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS40"; -chr1 Cufflinks exon 3213119 3213242 . . . transcript_id "TCONS_00000069"; gene_id "XLOC_000037"; exon_number "1"; -chr1 Cufflinks transcript 3240607 3240633 . . . transcript_id "TCONS_00000070"; gene_id "XLOC_000038"; gene_name "Xkr4"; oId "CUFF.39.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS41"; -chr1 Cufflinks exon 3240607 3240633 . . . transcript_id "TCONS_00000070"; gene_id "XLOC_000038"; exon_number "1"; -chr1 Cufflinks transcript 3242480 3242512 . . . transcript_id "TCONS_00000071"; gene_id "XLOC_000039"; gene_name "Xkr4"; oId "CUFF.41.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS42"; -chr1 Cufflinks exon 3242480 3242512 . . . transcript_id "TCONS_00000071"; gene_id "XLOC_000039"; exon_number "1"; -chr1 Cufflinks transcript 3242634 3242923 . . . transcript_id "TCONS_00000027"; gene_id "XLOC_000040"; gene_name "Xkr4"; oId "CUFF.25.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS43"; -chr1 Cufflinks exon 3242634 3242923 . . . transcript_id "TCONS_00000027"; gene_id "XLOC_000040"; exon_number "1"; -chr1 Cufflinks transcript 3242925 3243005 . . . transcript_id "TCONS_00000072"; gene_id "XLOC_000041"; gene_name "Xkr4"; oId "CUFF.43.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS44"; -chr1 Cufflinks exon 3242925 3243005 . . . transcript_id "TCONS_00000072"; gene_id "XLOC_000041"; exon_number "1"; -chr1 Cufflinks transcript 3243019 3243079 . . . transcript_id "TCONS_00000028"; gene_id "XLOC_000042"; gene_name "Xkr4"; oId "CUFF.21.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS45"; -chr1 Cufflinks exon 3243019 3243079 . . . transcript_id "TCONS_00000028"; gene_id "XLOC_000042"; exon_number "1"; -chr1 Cufflinks transcript 3243109 3243154 . . . transcript_id "TCONS_00000073"; gene_id "XLOC_000043"; gene_name "Xkr4"; oId "CUFF.45.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS46"; -chr1 Cufflinks exon 3243109 3243154 . . . transcript_id "TCONS_00000073"; gene_id "XLOC_000043"; exon_number "1"; -chr1 Cufflinks transcript 3243348 3243401 . . . transcript_id "TCONS_00000029"; gene_id "XLOC_000044"; gene_name "Xkr4"; oId "CUFF.23.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS47"; -chr1 Cufflinks exon 3243348 3243401 . . . transcript_id "TCONS_00000029"; gene_id "XLOC_000044"; exon_number "1"; -chr1 Cufflinks transcript 3254080 3254106 . . . transcript_id "TCONS_00000074"; gene_id "XLOC_000045"; gene_name "Xkr4"; oId "CUFF.47.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS48"; -chr1 Cufflinks exon 3254080 3254106 . . . transcript_id "TCONS_00000074"; gene_id "XLOC_000045"; exon_number "1"; -chr1 Cufflinks transcript 3256975 3257011 . . . transcript_id "TCONS_00000030"; gene_id "XLOC_000046"; gene_name "Xkr4"; oId "CUFF.27.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS49"; -chr1 Cufflinks exon 3256975 3257011 . . . transcript_id "TCONS_00000030"; gene_id "XLOC_000046"; exon_number "1"; -chr1 Cufflinks transcript 3277156 3277182 . . . transcript_id "TCONS_00000075"; gene_id "XLOC_000047"; gene_name "Xkr4"; oId "CUFF.49.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS50"; -chr1 Cufflinks exon 3277156 3277182 . . . transcript_id "TCONS_00000075"; gene_id "XLOC_000047"; exon_number "1"; -chr1 Cufflinks transcript 3277191 3277218 . . . transcript_id "TCONS_00000031"; gene_id "XLOC_000048"; gene_name "Xkr4"; oId "CUFF.61.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS51"; -chr1 Cufflinks exon 3277191 3277218 . . . transcript_id "TCONS_00000031"; gene_id "XLOC_000048"; exon_number "1"; -chr1 Cufflinks transcript 3277914 3278390 . . . transcript_id "TCONS_00000076"; gene_id "XLOC_000049"; gene_name "Xkr4"; oId "CUFF.51.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS52"; -chr1 Cufflinks exon 3277914 3278390 . . . transcript_id "TCONS_00000076"; gene_id "XLOC_000049"; exon_number "1"; -chr1 Cufflinks transcript 3278237 3278263 . . . transcript_id "TCONS_00000032"; gene_id "XLOC_000049"; gene_name "Xkr4"; oId "CUFF.63.1"; contained_in "TCONS_00000076"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS53"; -chr1 Cufflinks exon 3278237 3278263 . . . transcript_id "TCONS_00000032"; gene_id "XLOC_000049"; exon_number "1"; -chr1 Cufflinks transcript 3280118 3280144 . . . transcript_id "TCONS_00000077"; gene_id "XLOC_000050"; gene_name "Xkr4"; oId "CUFF.53.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS54"; -chr1 Cufflinks exon 3280118 3280144 . . . transcript_id "TCONS_00000077"; gene_id "XLOC_000050"; exon_number "1"; -chr1 Cufflinks transcript 3280499 3280525 . . . transcript_id "TCONS_00000078"; gene_id "XLOC_000051"; gene_name "Xkr4"; oId "CUFF.55.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS55"; -chr1 Cufflinks exon 3280499 3280525 . . . transcript_id "TCONS_00000078"; gene_id "XLOC_000051"; exon_number "1"; -chr1 Cufflinks transcript 3280687 3280741 . . . transcript_id "TCONS_00000033"; gene_id "XLOC_000052"; gene_name "Xkr4"; oId "CUFF.65.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS56"; -chr1 Cufflinks exon 3280687 3280741 . . . transcript_id "TCONS_00000033"; gene_id "XLOC_000052"; exon_number "1"; -chr1 Cufflinks transcript 3282505 3282531 . . . transcript_id "TCONS_00000079"; gene_id "XLOC_000053"; gene_name "Xkr4"; oId "CUFF.57.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS57"; -chr1 Cufflinks exon 3282505 3282531 . . . transcript_id "TCONS_00000079"; gene_id "XLOC_000053"; exon_number "1"; -chr1 Cufflinks transcript 3282651 3282677 . . . transcript_id "TCONS_00000080"; gene_id "XLOC_000054"; gene_name "Xkr4"; oId "CUFF.59.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS58"; -chr1 Cufflinks exon 3282651 3282677 . . . transcript_id "TCONS_00000080"; gene_id "XLOC_000054"; exon_number "1"; -chr1 Cufflinks transcript 3282761 3282832 . . . transcript_id "TCONS_00000081"; gene_id "XLOC_000055"; gene_name "Xkr4"; oId "CUFF.61.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS59"; -chr1 Cufflinks exon 3282761 3282832 . . . transcript_id "TCONS_00000081"; gene_id "XLOC_000055"; exon_number "1"; -chr1 Cufflinks transcript 3284967 3284993 . . . transcript_id "TCONS_00000082"; gene_id "XLOC_000056"; gene_name "Xkr4"; oId "CUFF.63.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS60"; -chr1 Cufflinks exon 3284967 3284993 . . . transcript_id "TCONS_00000082"; gene_id "XLOC_000056"; exon_number "1"; -chr1 Cufflinks transcript 3290489 3290553 . . . transcript_id "TCONS_00000034"; gene_id "XLOC_000057"; gene_name "Xkr4"; oId "CUFF.67.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS61"; -chr1 Cufflinks exon 3290489 3290553 . . . transcript_id "TCONS_00000034"; gene_id "XLOC_000057"; exon_number "1"; -chr1 Cufflinks transcript 3290799 3290859 . . . transcript_id "TCONS_00000083"; gene_id "XLOC_000058"; gene_name "Xkr4"; oId "CUFF.65.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS62"; -chr1 Cufflinks exon 3290799 3290859 . . . transcript_id "TCONS_00000083"; gene_id "XLOC_000058"; exon_number "1"; -chr1 Cufflinks transcript 3290920 3291273 . . . transcript_id "TCONS_00000084"; gene_id "XLOC_000059"; gene_name "Xkr4"; oId "CUFF.69.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS63"; -chr1 Cufflinks exon 3290920 3291273 . . . transcript_id "TCONS_00000084"; gene_id "XLOC_000059"; exon_number "1"; -chr1 Cufflinks transcript 3290940 3291023 . . . transcript_id "TCONS_00000035"; gene_id "XLOC_000059"; gene_name "Xkr4"; oId "CUFF.69.1"; contained_in "TCONS_00000084"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS63"; -chr1 Cufflinks exon 3290940 3291023 . . . transcript_id "TCONS_00000035"; gene_id "XLOC_000059"; exon_number "1"; -chr1 Cufflinks transcript 3291089 3291186 . . . transcript_id "TCONS_00000036"; gene_id "XLOC_000059"; gene_name "Xkr4"; oId "CUFF.71.1"; contained_in "TCONS_00000084"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS64"; -chr1 Cufflinks exon 3291089 3291186 . . . transcript_id "TCONS_00000036"; gene_id "XLOC_000059"; exon_number "1"; -chr1 Cufflinks transcript 3299444 3299640 . . . transcript_id "TCONS_00000085"; gene_id "XLOC_000060"; gene_name "Xkr4"; oId "CUFF.67.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS65"; -chr1 Cufflinks exon 3299444 3299640 . . . transcript_id "TCONS_00000085"; gene_id "XLOC_000060"; exon_number "1"; -chr1 Cufflinks transcript 3299610 3299664 . . . transcript_id "TCONS_00000037"; gene_id "XLOC_000060"; gene_name "Xkr4"; oId "CUFF.73.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS66"; -chr1 Cufflinks exon 3299610 3299664 . . . transcript_id "TCONS_00000037"; gene_id "XLOC_000060"; exon_number "1"; -chr1 Cufflinks transcript 3299692 3299733 . . . transcript_id "TCONS_00000086"; gene_id "XLOC_000061"; gene_name "Xkr4"; oId "CUFF.71.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS67"; -chr1 Cufflinks exon 3299692 3299733 . . . transcript_id "TCONS_00000086"; gene_id "XLOC_000061"; exon_number "1"; -chr1 Cufflinks transcript 3300052 3300078 . . . transcript_id "TCONS_00000038"; gene_id "XLOC_000062"; gene_name "Xkr4"; oId "CUFF.75.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS68"; -chr1 Cufflinks exon 3300052 3300078 . . . transcript_id "TCONS_00000038"; gene_id "XLOC_000062"; exon_number "1"; -chr1 Cufflinks transcript 3307749 3307775 . . . transcript_id "TCONS_00000087"; gene_id "XLOC_000063"; gene_name "Xkr4"; oId "CUFF.73.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS69"; -chr1 Cufflinks exon 3307749 3307775 . . . transcript_id "TCONS_00000087"; gene_id "XLOC_000063"; exon_number "1"; -chr1 Cufflinks transcript 3318621 3318647 . . . transcript_id "TCONS_00000088"; gene_id "XLOC_000064"; gene_name "Xkr4"; oId "CUFF.75.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS70"; -chr1 Cufflinks exon 3318621 3318647 . . . transcript_id "TCONS_00000088"; gene_id "XLOC_000064"; exon_number "1"; -chr1 Cufflinks transcript 3319000 3319051 . . . transcript_id "TCONS_00000039"; gene_id "XLOC_000065"; gene_name "Xkr4"; oId "CUFF.77.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS71"; -chr1 Cufflinks exon 3319000 3319051 . . . transcript_id "TCONS_00000039"; gene_id "XLOC_000065"; exon_number "1"; -chr1 Cufflinks transcript 3330528 3330554 . . . transcript_id "TCONS_00000089"; gene_id "XLOC_000066"; gene_name "Xkr4"; oId "CUFF.77.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS72"; -chr1 Cufflinks exon 3330528 3330554 . . . transcript_id "TCONS_00000089"; gene_id "XLOC_000066"; exon_number "1"; -chr1 Cufflinks transcript 3351241 3351311 . . . transcript_id "TCONS_00000090"; gene_id "XLOC_000067"; gene_name "Xkr4"; oId "CUFF.79.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS73"; -chr1 Cufflinks exon 3351241 3351311 . . . transcript_id "TCONS_00000090"; gene_id "XLOC_000067"; exon_number "1"; -chr1 Cufflinks transcript 3355888 3355914 . . . transcript_id "TCONS_00000040"; gene_id "XLOC_000068"; gene_name "Xkr4"; oId "CUFF.79.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS74"; -chr1 Cufflinks exon 3355888 3355914 . . . transcript_id "TCONS_00000040"; gene_id "XLOC_000068"; exon_number "1"; -chr1 Cufflinks transcript 3355908 3356119 . . . transcript_id "TCONS_00000091"; gene_id "XLOC_000068"; gene_name "Xkr4"; oId "CUFF.81.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS74"; -chr1 Cufflinks exon 3355908 3356119 . . . transcript_id "TCONS_00000091"; gene_id "XLOC_000068"; exon_number "1"; -chr1 Cufflinks transcript 3356181 3356225 . . . transcript_id "TCONS_00000092"; gene_id "XLOC_000069"; gene_name "Xkr4"; oId "CUFF.83.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS75"; -chr1 Cufflinks exon 3356181 3356225 . . . transcript_id "TCONS_00000092"; gene_id "XLOC_000069"; exon_number "1"; -chr1 Cufflinks transcript 3363077 3363176 . . . transcript_id "TCONS_00000093"; gene_id "XLOC_000070"; gene_name "Xkr4"; oId "CUFF.85.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS76"; -chr1 Cufflinks exon 3363077 3363176 . . . transcript_id "TCONS_00000093"; gene_id "XLOC_000070"; exon_number "1"; -chr1 Cufflinks transcript 3363215 3363278 . . . transcript_id "TCONS_00000041"; gene_id "XLOC_000071"; gene_name "Xkr4"; oId "CUFF.81.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS77"; -chr1 Cufflinks exon 3363215 3363278 . . . transcript_id "TCONS_00000041"; gene_id "XLOC_000071"; exon_number "1"; -chr1 Cufflinks transcript 3363388 3363446 . . . transcript_id "TCONS_00000094"; gene_id "XLOC_000072"; gene_name "Xkr4"; oId "CUFF.87.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS78"; -chr1 Cufflinks exon 3363388 3363446 . . . transcript_id "TCONS_00000094"; gene_id "XLOC_000072"; exon_number "1"; -chr1 Cufflinks transcript 3363754 3363849 . . . transcript_id "TCONS_00000042"; gene_id "XLOC_000073"; gene_name "Xkr4"; oId "CUFF.83.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS79"; -chr1 Cufflinks exon 3363754 3363849 . . . transcript_id "TCONS_00000042"; gene_id "XLOC_000073"; exon_number "1"; -chr1 Cufflinks transcript 3364872 3364919 . . . transcript_id "TCONS_00000095"; gene_id "XLOC_000074"; gene_name "Xkr4"; oId "CUFF.89.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS80"; -chr1 Cufflinks exon 3364872 3364919 . . . transcript_id "TCONS_00000095"; gene_id "XLOC_000074"; exon_number "1"; -chr1 Cufflinks transcript 3367136 3367162 . . . transcript_id "TCONS_00000043"; gene_id "XLOC_000075"; gene_name "Xkr4"; oId "CUFF.85.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS81"; -chr1 Cufflinks exon 3367136 3367162 . . . transcript_id "TCONS_00000043"; gene_id "XLOC_000075"; exon_number "1"; -chr1 Cufflinks transcript 3367211 3367237 . . . transcript_id "TCONS_00000096"; gene_id "XLOC_000076"; gene_name "Xkr4"; oId "CUFF.91.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS82"; -chr1 Cufflinks exon 3367211 3367237 . . . transcript_id "TCONS_00000096"; gene_id "XLOC_000076"; exon_number "1"; -chr1 Cufflinks transcript 3367334 3367382 . . . transcript_id "TCONS_00000044"; gene_id "XLOC_000077"; gene_name "Xkr4"; oId "CUFF.87.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS83"; -chr1 Cufflinks exon 3367334 3367382 . . . transcript_id "TCONS_00000044"; gene_id "XLOC_000077"; exon_number "1"; -chr1 Cufflinks transcript 3369581 3369607 . . . transcript_id "TCONS_00000097"; gene_id "XLOC_000078"; gene_name "Xkr4"; oId "CUFF.93.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS84"; -chr1 Cufflinks exon 3369581 3369607 . . . transcript_id "TCONS_00000097"; gene_id "XLOC_000078"; exon_number "1"; -chr1 Cufflinks transcript 3375002 3375028 . . . transcript_id "TCONS_00000098"; gene_id "XLOC_000079"; gene_name "Xkr4"; oId "CUFF.95.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS85"; -chr1 Cufflinks exon 3375002 3375028 . . . transcript_id "TCONS_00000098"; gene_id "XLOC_000079"; exon_number "1"; -chr1 Cufflinks transcript 3377212 3377262 . . . transcript_id "TCONS_00000045"; gene_id "XLOC_000080"; gene_name "Xkr4"; oId "CUFF.89.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS86"; -chr1 Cufflinks exon 3377212 3377262 . . . transcript_id "TCONS_00000045"; gene_id "XLOC_000080"; exon_number "1"; -chr1 Cufflinks transcript 3379889 3379915 . . . transcript_id "TCONS_00000099"; gene_id "XLOC_000081"; gene_name "Xkr4"; oId "CUFF.97.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS87"; -chr1 Cufflinks exon 3379889 3379915 . . . transcript_id "TCONS_00000099"; gene_id "XLOC_000081"; exon_number "1"; -chr1 Cufflinks transcript 3386740 3386836 . . . transcript_id "TCONS_00000100"; gene_id "XLOC_000082"; gene_name "Xkr4"; oId "CUFF.99.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS88"; -chr1 Cufflinks exon 3386740 3386836 . . . transcript_id "TCONS_00000100"; gene_id "XLOC_000082"; exon_number "1"; -chr1 Cufflinks transcript 3391326 3391352 . . . transcript_id "TCONS_00000046"; gene_id "XLOC_000083"; gene_name "Xkr4"; oId "CUFF.91.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS89"; -chr1 Cufflinks exon 3391326 3391352 . . . transcript_id "TCONS_00000046"; gene_id "XLOC_000083"; exon_number "1"; -chr1 Cufflinks transcript 3435842 3435880 . . . transcript_id "TCONS_00000047"; gene_id "XLOC_000084"; gene_name "Xkr4"; oId "CUFF.93.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS90"; -chr1 Cufflinks exon 3435842 3435880 . . . transcript_id "TCONS_00000047"; gene_id "XLOC_000084"; exon_number "1"; -chr1 Cufflinks transcript 3447762 3447788 . . . transcript_id "TCONS_00000048"; gene_id "XLOC_000085"; gene_name "Xkr4"; oId "CUFF.95.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS91"; -chr1 Cufflinks exon 3447762 3447788 . . . transcript_id "TCONS_00000048"; gene_id "XLOC_000085"; exon_number "1"; -chr1 Cufflinks transcript 3450907 3450965 . . . transcript_id "TCONS_00000049"; gene_id "XLOC_000086"; gene_name "Xkr4"; oId "CUFF.97.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS92"; -chr1 Cufflinks exon 3450907 3450965 . . . transcript_id "TCONS_00000049"; gene_id "XLOC_000086"; exon_number "1"; -chr1 Cufflinks transcript 3451052 3451109 . . . transcript_id "TCONS_00000050"; gene_id "XLOC_000087"; gene_name "Xkr4"; oId "CUFF.99.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS93"; -chr1 Cufflinks exon 3451052 3451109 . . . transcript_id "TCONS_00000050"; gene_id "XLOC_000087"; exon_number "1"; +chr1 Cufflinks transcript 12 20 . + . transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; oId "CUFF.3.1"; tss_id "TSS1"; +chr1 Cufflinks exon 12 20 . + . transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; exon_number "1"; +chr1 Cufflinks transcript 32 40 . + . transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; oId "CUFF.7.1"; tss_id "TSS2"; +chr1 Cufflinks exon 32 40 . + . transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; exon_number "1"; +chr1 Cufflinks transcript 42 47 . + . transcript_id "TCONS_00000007"; gene_id "XLOC_000003"; oId "CUFF.7.1"; contained_in "TCONS_00000002"; tss_id "TSS3"; +chr1 Cufflinks exon 42 47 . + . transcript_id "TCONS_00000007"; gene_id "XLOC_000003"; exon_number "1"; +chr1 Cufflinks transcript 42 50 . + . transcript_id "TCONS_00000002"; gene_id "XLOC_000003"; oId "CUFF.9.1"; tss_id "TSS3"; +chr1 Cufflinks exon 42 50 . + . transcript_id "TCONS_00000002"; gene_id "XLOC_000003"; exon_number "1"; +chr1 Cufflinks transcript 52 60 . + . transcript_id "TCONS_00000003"; gene_id "XLOC_000004"; oId "CUFF.10.1"; tss_id "TSS4"; +chr1 Cufflinks exon 52 60 . + . transcript_id "TCONS_00000003"; gene_id "XLOC_000004"; exon_number "1"; +chr1 Cufflinks transcript 2 10 . - . transcript_id "TCONS_00000004"; gene_id "XLOC_000005"; oId "CUFF.1.1"; tss_id "TSS5"; +chr1 Cufflinks exon 2 10 . - . transcript_id "TCONS_00000004"; gene_id "XLOC_000005"; exon_number "1"; +chr1 Cufflinks transcript 15 20 . - . transcript_id "TCONS_00000005"; gene_id "XLOC_000006"; oId "CUFF.3.1"; tss_id "TSS6"; +chr1 Cufflinks exon 15 20 . - . transcript_id "TCONS_00000005"; gene_id "XLOC_000006"; exon_number "1"; +chr1 Cufflinks transcript 22 30 . - . transcript_id "TCONS_00000008"; gene_id "XLOC_000007"; oId "CUFF.5.1"; tss_id "TSS7"; +chr1 Cufflinks exon 22 30 . - . transcript_id "TCONS_00000008"; gene_id "XLOC_000007"; exon_number "1";
--- a/test-data/gffcompare_out1.loci Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out1.loci Mon May 27 13:54:15 2019 -0400 @@ -1,87 +1,7 @@ -XLOC_000001 chr1[-]3204563-3661579 Xkr4|Xkr4 CUFF.13.1 - -XLOC_000002 chr1[.]3111450-3111490 - CUFF.1.1 - -XLOC_000003 chr1[.]3111546-3111576 - CUFF.3.1 - -XLOC_000004 chr1[.]3174766-3174792 - - CUFF.1.1 -XLOC_000005 chr1[.]3187402-3187428 - - CUFF.3.1 -XLOC_000006 chr1[.]3188522-3188548 - - CUFF.5.1 -XLOC_000007 chr1[.]3189811-3190789 - CUFF.29.1,CUFF.31.1,CUFF.33.1 CUFF.11.1 -XLOC_000008 chr1[.]3190859-3191434 - - CUFF.7.1 -XLOC_000009 chr1[.]3191513-3192077 - CUFF.35.1,CUFF.37.1 CUFF.9.1 -XLOC_000010 chr1[.]3192251-3192336 - - CUFF.13.1 -XLOC_000011 chr1[.]3192442-3192494 - CUFF.39.1 - -XLOC_000012 chr1[.]3192551-3192629 - CUFF.41.1 - -XLOC_000013 chr1[.]3192650-3192676 - - CUFF.15.1 -XLOC_000014 chr1[.]3192732-3192811 - CUFF.43.1 - -XLOC_000015 chr1[.]3192941-3193042 - CUFF.45.1 - -XLOC_000016 chr1[.]3194186-3194226 - CUFF.47.1 - -XLOC_000017 chr1[.]3194303-3194329 - CUFF.49.1 - -XLOC_000018 chr1[.]3194707-3194733 - - CUFF.17.1 -XLOC_000019 chr1[.]3195084-3195110 - CUFF.51.1 - -XLOC_000020 chr1[.]3195451-3195477 - CUFF.53.1 - -XLOC_000021 chr1[.]3197090-3197116 - CUFF.55.1 - -XLOC_000022 chr1[.]3197247-3197273 - CUFF.57.1 - -XLOC_000023 chr1[.]3197347-3197373 - CUFF.59.1 - -XLOC_000024 chr1[.]3197426-3197452 - - CUFF.19.1 -XLOC_000025 chr1[.]3200023-3200191 - CUFF.7.1 CUFF.23.1 -XLOC_000026 chr1[.]3200326-3200352 - CUFF.5.1 - -XLOC_000027 chr1[.]3200431-3200457 - - CUFF.21.1 -XLOC_000028 chr1[.]3201008-3201039 - - CUFF.26.1 -XLOC_000029 chr1[.]3201078-3201481 - CUFF.9.1 CUFF.25.1 -XLOC_000030 chr1[.]3201597-3201666 - - CUFF.29.1 -XLOC_000031 chr1[.]3201673-3201699 - CUFF.11.1 - -XLOC_000032 chr1[.]3201726-3201809 - - CUFF.31.1 -XLOC_000033 chr1[.]3211522-3211561 - - CUFF.33.1 -XLOC_000034 chr1[.]3212214-3212292 - CUFF.15.1 - -XLOC_000035 chr1[.]3212368-3212439 - CUFF.19.1 - -XLOC_000036 chr1[.]3212718-3212801 - - CUFF.35.1 -XLOC_000037 chr1[.]3213096-3213242 - CUFF.17.1 CUFF.37.1 -XLOC_000038 chr1[.]3240607-3240633 - - CUFF.39.1 -XLOC_000039 chr1[.]3242480-3242512 - - CUFF.41.1 -XLOC_000040 chr1[.]3242634-3242923 - CUFF.25.1 - -XLOC_000041 chr1[.]3242925-3243005 - - CUFF.43.1 -XLOC_000042 chr1[.]3243019-3243079 - CUFF.21.1 - -XLOC_000043 chr1[.]3243109-3243154 - - CUFF.45.1 -XLOC_000044 chr1[.]3243348-3243401 - CUFF.23.1 - -XLOC_000045 chr1[.]3254080-3254106 - - CUFF.47.1 -XLOC_000046 chr1[.]3256975-3257011 - CUFF.27.1 - -XLOC_000047 chr1[.]3277156-3277182 - - CUFF.49.1 -XLOC_000048 chr1[.]3277191-3277218 - CUFF.61.1 - -XLOC_000049 chr1[.]3277914-3278390 - CUFF.63.1 CUFF.51.1 -XLOC_000050 chr1[.]3280118-3280144 - - CUFF.53.1 -XLOC_000051 chr1[.]3280499-3280525 - - CUFF.55.1 -XLOC_000052 chr1[.]3280687-3280741 - CUFF.65.1 - -XLOC_000053 chr1[.]3282505-3282531 - - CUFF.57.1 -XLOC_000054 chr1[.]3282651-3282677 - - CUFF.59.1 -XLOC_000055 chr1[.]3282761-3282832 - - CUFF.61.1 -XLOC_000056 chr1[.]3284967-3284993 - - CUFF.63.1 -XLOC_000057 chr1[.]3290489-3290553 - CUFF.67.1 - -XLOC_000058 chr1[.]3290799-3290859 - - CUFF.65.1 -XLOC_000059 chr1[.]3290920-3291273 - CUFF.69.1,CUFF.71.1 CUFF.69.1 -XLOC_000060 chr1[.]3299444-3299664 - CUFF.73.1 CUFF.67.1 -XLOC_000061 chr1[.]3299692-3299733 - - CUFF.71.1 -XLOC_000062 chr1[.]3300052-3300078 - CUFF.75.1 - -XLOC_000063 chr1[.]3307749-3307775 - - CUFF.73.1 -XLOC_000064 chr1[.]3318621-3318647 - - CUFF.75.1 -XLOC_000065 chr1[.]3319000-3319051 - CUFF.77.1 - -XLOC_000066 chr1[.]3330528-3330554 - - CUFF.77.1 -XLOC_000067 chr1[.]3351241-3351311 - - CUFF.79.1 -XLOC_000068 chr1[.]3355888-3356119 - CUFF.79.1 CUFF.81.1 -XLOC_000069 chr1[.]3356181-3356225 - - CUFF.83.1 -XLOC_000070 chr1[.]3363077-3363176 - - CUFF.85.1 -XLOC_000071 chr1[.]3363215-3363278 - CUFF.81.1 - -XLOC_000072 chr1[.]3363388-3363446 - - CUFF.87.1 -XLOC_000073 chr1[.]3363754-3363849 - CUFF.83.1 - -XLOC_000074 chr1[.]3364872-3364919 - - CUFF.89.1 -XLOC_000075 chr1[.]3367136-3367162 - CUFF.85.1 - -XLOC_000076 chr1[.]3367211-3367237 - - CUFF.91.1 -XLOC_000077 chr1[.]3367334-3367382 - CUFF.87.1 - -XLOC_000078 chr1[.]3369581-3369607 - - CUFF.93.1 -XLOC_000079 chr1[.]3375002-3375028 - - CUFF.95.1 -XLOC_000080 chr1[.]3377212-3377262 - CUFF.89.1 - -XLOC_000081 chr1[.]3379889-3379915 - - CUFF.97.1 -XLOC_000082 chr1[.]3386740-3386836 - - CUFF.99.1 -XLOC_000083 chr1[.]3391326-3391352 - CUFF.91.1 - -XLOC_000084 chr1[.]3435842-3435880 - CUFF.93.1 - -XLOC_000085 chr1[.]3447762-3447788 - CUFF.95.1 - -XLOC_000086 chr1[.]3450907-3450965 - CUFF.97.1 - -XLOC_000087 chr1[.]3451052-3451109 - CUFF.99.1 - +XLOC_000001 chr1[+]12-20 - - CUFF.3.1 +XLOC_000002 chr1[+]32-40 - CUFF.7.1 - +XLOC_000003 chr1[+]42-50 - CUFF.9.1 CUFF.7.1 +XLOC_000004 chr1[+]52-60 - CUFF.10.1 - +XLOC_000005 chr1[-]2-10 - CUFF.1.1 CUFF.1.1 +XLOC_000006 chr1[-]15-20 - CUFF.3.1 - +XLOC_000007 chr1[-]22-30 - - CUFF.5.1
--- a/test-data/gffcompare_out1.stats Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out1.stats Mon May 27 13:54:15 2019 -0400 @@ -1,35 +1,15 @@ -# gffcompare v0.10.6 | Command line was: -#gffcompare -r /tmp/tmp7AvPf0/files/000/dataset_3.dat -R -e 100 -d 100 -p TCONS gffcompare_in1_gtf gffcompare_in2_gtf +# gffcompare v0.11.2 | Command line was: +#gffcompare -e 100 -d 100 -p TCONS gffcompare_in1_gtf gffcompare_in2_gtf # #= Summary for dataset: gffcompare_in1_gtf -# Query mRNAs : 50 in 50 loci (0 multi-exon transcripts) +# Query mRNAs : 5 in 5 loci (0 multi-exon transcripts) # (0 multi-transcript loci, ~1.0 transcripts per locus) -# Reference mRNAs : 1 in 1 loci (1 multi-exon) -# Super-loci w/ reference transcripts: 1 -#-----------------| Sensitivity | Precision | - Base level: 2.2 | 2.3 | - Exon level: 0.0 | 0.0 | - Intron level: 0.0 | -nan | -Intron chain level: 0.0 | -nan | - Transcript level: 0.0 | 0.0 | - Locus level: 0.0 | 0.0 | - - Matching intron chains: 0 - Matching transcripts: 0 - Matching loci: 0 - - Missed exons: 2/3 ( 66.7%) - Novel exons: 49/50 ( 98.0%) - Missed introns: 2/2 (100.0%) - Missed loci: 0/1 ( 0.0%) - Novel loci: 49/50 ( 98.0%) #= Summary for dataset: gffcompare_in2_gtf -# Query mRNAs : 50 in 50 loci (0 multi-exon transcripts) +# Query mRNAs : 4 in 4 loci (0 multi-exon transcripts) # (0 multi-transcript loci, ~1.0 transcripts per locus) -# Reference mRNAs : 0 in 0 loci (0 multi-exon) - Total union super-loci across all input datasets: 87 + Total union super-loci across all input datasets: 7 (0 multi-transcript, ~1.1 transcripts per locus) -100 out of 100 consensus transcripts written in gffcmp.combined.gtf (0 discarded as redundant) +8 out of 8 consensus transcripts written in gffcmp.combined.gtf (0 discarded as redundant)
--- a/test-data/gffcompare_out1.tracking Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out1.tracking Mon May 27 13:54:15 2019 -0400 @@ -1,100 +1,8 @@ -TCONS_00000001 XLOC_000001 Xkr4|Xkr4 c q1:CUFF.13|CUFF.13.1|1|10.695258|0.000000|0.683544|79 - -TCONS_00000002 XLOC_000002 - u q1:CUFF.1|CUFF.1.1|1|20.607936|0.000000|1.317073|41 - -TCONS_00000003 XLOC_000003 - u q1:CUFF.3|CUFF.3.1|1|27.255658|0.000000|1.741935|31 - -TCONS_00000004 XLOC_000007 - u q1:CUFF.29|CUFF.29.1|1|107.103219|0.000000|6.845070|142 - -TCONS_00000005 XLOC_000007 - u q1:CUFF.31|CUFF.31.1|1|122.650461|0.000000|7.838710|31 - -TCONS_00000006 XLOC_000007 - u q1:CUFF.33|CUFF.33.1|1|109.527366|0.000000|7.000000|27 - -TCONS_00000007 XLOC_000009 - u q1:CUFF.35|CUFF.35.1|1|96.747183|0.000000|6.183206|131 - -TCONS_00000008 XLOC_000009 - u q1:CUFF.37|CUFF.37.1|1|104.085013|0.000000|6.652174|69 - -TCONS_00000009 XLOC_000011 - u q1:CUFF.39|CUFF.39.1|1|23.912983|0.000000|1.528302|53 - -TCONS_00000010 XLOC_000012 - u q1:CUFF.41|CUFF.41.1|1|10.695258|0.000000|0.683544|79 - -TCONS_00000011 XLOC_000014 - u q1:CUFF.43|CUFF.43.1|1|10.561567|0.000000|0.675000|80 - -TCONS_00000012 XLOC_000015 - u q1:CUFF.45|CUFF.45.1|1|20.708956|0.000000|1.323529|102 - -TCONS_00000013 XLOC_000016 - u q1:CUFF.47|CUFF.47.1|1|20.607936|0.000000|1.317073|41 - -TCONS_00000014 XLOC_000017 - u q1:CUFF.49|CUFF.49.1|1|15.646767|0.000000|1.000000|27 - -TCONS_00000015 XLOC_000019 - u q1:CUFF.51|CUFF.51.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000016 XLOC_000020 - u q1:CUFF.53|CUFF.53.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000017 XLOC_000021 - u q1:CUFF.55|CUFF.55.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000018 XLOC_000022 - u q1:CUFF.57|CUFF.57.1|1|15.646767|0.000000|1.000000|27 - -TCONS_00000019 XLOC_000023 - u q1:CUFF.59|CUFF.59.1|1|15.646767|0.000000|1.000000|27 - -TCONS_00000020 XLOC_000025 - u q1:CUFF.7|CUFF.7.1|1|9.999117|0.000000|0.639053|169 - -TCONS_00000021 XLOC_000026 - u q1:CUFF.5|CUFF.5.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000022 XLOC_000029 - u q1:CUFF.9|CUFF.9.1|1|17.776896|0.000000|1.136139|404 - -TCONS_00000023 XLOC_000031 - u q1:CUFF.11|CUFF.11.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000024 XLOC_000034 Xkr4|Xkr4 i q1:CUFF.15|CUFF.15.1|1|10.695258|0.000000|0.683544|79 - -TCONS_00000025 XLOC_000035 Xkr4|Xkr4 i q1:CUFF.19|CUFF.19.1|1|29.337687|0.000000|1.875000|72 - -TCONS_00000026 XLOC_000037 Xkr4|Xkr4 i q1:CUFF.17|CUFF.17.1|1|8.710571|0.000000|0.556701|97 - -TCONS_00000027 XLOC_000040 Xkr4|Xkr4 i q1:CUFF.25|CUFF.25.1|1|14.567679|0.000000|0.931034|290 - -TCONS_00000028 XLOC_000042 Xkr4|Xkr4 i q1:CUFF.21|CUFF.21.1|1|13.851236|0.000000|0.885246|61 - -TCONS_00000029 XLOC_000044 Xkr4|Xkr4 i q1:CUFF.23|CUFF.23.1|1|23.470150|0.000000|1.500000|54 - -TCONS_00000030 XLOC_000046 Xkr4|Xkr4 i q1:CUFF.27|CUFF.27.1|1|34.253732|0.000000|2.189189|37 - -TCONS_00000031 XLOC_000048 Xkr4|Xkr4 i q1:CUFF.61|CUFF.61.1|1|45.263860|0.000000|2.892857|28 - -TCONS_00000032 XLOC_000049 Xkr4|Xkr4 i q1:CUFF.63|CUFF.63.1|1|15.646767|0.000000|1.000000|27 - -TCONS_00000033 XLOC_000052 Xkr4|Xkr4 i q1:CUFF.65|CUFF.65.1|1|15.362280|0.000000|0.981818|55 - -TCONS_00000034 XLOC_000057 Xkr4|Xkr4 i q1:CUFF.67|CUFF.67.1|1|12.998852|0.000000|0.830769|65 - -TCONS_00000035 XLOC_000059 Xkr4|Xkr4 i q1:CUFF.69|CUFF.69.1|1|10.058636|0.000000|0.642857|84 - -TCONS_00000036 XLOC_000059 Xkr4|Xkr4 i q1:CUFF.71|CUFF.71.1|1|8.621688|0.000000|0.551020|98 - -TCONS_00000037 XLOC_000060 Xkr4|Xkr4 i q1:CUFF.73|CUFF.73.1|1|15.362280|0.000000|0.981818|55 - -TCONS_00000038 XLOC_000062 Xkr4|Xkr4 i q1:CUFF.75|CUFF.75.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000039 XLOC_000065 Xkr4|Xkr4 i q1:CUFF.77|CUFF.77.1|1|16.248565|0.000000|1.038462|52 - -TCONS_00000040 XLOC_000068 Xkr4|Xkr4 i q1:CUFF.79|CUFF.79.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000041 XLOC_000071 Xkr4|Xkr4 i q1:CUFF.81|CUFF.81.1|1|13.201959|0.000000|0.843750|64 - -TCONS_00000042 XLOC_000073 Xkr4|Xkr4 i q1:CUFF.83|CUFF.83.1|1|13.201959|0.000000|0.843750|96 - -TCONS_00000043 XLOC_000075 Xkr4|Xkr4 i q1:CUFF.85|CUFF.85.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000044 XLOC_000077 Xkr4|Xkr4 i q1:CUFF.87|CUFF.87.1|1|17.243375|0.000000|1.102041|49 - -TCONS_00000045 XLOC_000080 Xkr4|Xkr4 i q1:CUFF.89|CUFF.89.1|1|16.567165|0.000000|1.058824|51 - -TCONS_00000046 XLOC_000083 Xkr4|Xkr4 i q1:CUFF.91|CUFF.91.1|1|31.293533|0.000000|2.000000|27 - -TCONS_00000047 XLOC_000084 Xkr4|Xkr4 i q1:CUFF.93|CUFF.93.1|1|21.664754|0.000000|1.384615|39 - -TCONS_00000048 XLOC_000085 Xkr4|Xkr4 i q1:CUFF.95|CUFF.95.1|1|46.940300|0.000000|3.000000|27 - -TCONS_00000049 XLOC_000086 Xkr4|Xkr4 i q1:CUFF.97|CUFF.97.1|1|21.481154|0.000000|1.372881|59 - -TCONS_00000050 XLOC_000087 Xkr4|Xkr4 i q1:CUFF.99|CUFF.99.1|1|14.567679|0.000000|0.931034|58 - -TCONS_00000051 XLOC_000004 - u - q2:CUFF.1|CUFF.1.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000052 XLOC_000005 - u - q2:CUFF.3|CUFF.3.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000053 XLOC_000006 - u - q2:CUFF.5|CUFF.5.1|1|21.226627|0.000000|1.205672|27 -TCONS_00000054 XLOC_000007 - u - q2:CUFF.11|CUFF.11.1|1|32.531777|0.000000|1.847804|979 -TCONS_00000055 XLOC_000008 - u - q2:CUFF.7|CUFF.7.1|1|29.709524|0.000000|1.687500|576 -TCONS_00000056 XLOC_000009 - u - q2:CUFF.9|CUFF.9.1|1|34.072933|0.000000|1.935341|565 -TCONS_00000057 XLOC_000010 - u - q2:CUFF.13|CUFF.13.1|1|16.582060|0.000000|0.941860|86 -TCONS_00000058 XLOC_000013 - u - q2:CUFF.15|CUFF.15.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000059 XLOC_000018 - u - q2:CUFF.17|CUFF.17.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000060 XLOC_000024 - u - q2:CUFF.19|CUFF.19.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000061 XLOC_000025 - u - q2:CUFF.23|CUFF.23.1|1|16.205195|0.000000|0.920455|88 -TCONS_00000062 XLOC_000027 - u - q2:CUFF.21|CUFF.21.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000063 XLOC_000028 - u - q2:CUFF.26|CUFF.26.1|1|29.709524|0.000000|1.687500|32 -TCONS_00000064 XLOC_000029 - u - q2:CUFF.25|CUFF.25.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000065 XLOC_000030 - u - q2:CUFF.29|CUFF.29.1|1|13.581496|0.000000|0.771429|70 -TCONS_00000066 XLOC_000032 - u - q2:CUFF.31|CUFF.31.1|1|22.635827|0.000000|1.285714|84 -TCONS_00000067 XLOC_000033 Xkr4|Xkr4 i - q2:CUFF.33|CUFF.33.1|1|23.767619|0.000000|1.350000|40 -TCONS_00000068 XLOC_000036 Xkr4|Xkr4 i - q2:CUFF.35|CUFF.35.1|1|11.317914|0.000000|0.642857|84 -TCONS_00000069 XLOC_000037 Xkr4|Xkr4 i - q2:CUFF.37|CUFF.37.1|1|11.500461|0.000000|0.653226|124 -TCONS_00000070 XLOC_000038 Xkr4|Xkr4 i - q2:CUFF.39|CUFF.39.1|1|52.816931|0.000000|3.000000|27 -TCONS_00000071 XLOC_000039 Xkr4|Xkr4 i - q2:CUFF.41|CUFF.41.1|1|43.213852|0.000000|2.454545|33 -TCONS_00000072 XLOC_000041 Xkr4|Xkr4 i - q2:CUFF.43|CUFF.43.1|1|23.474191|0.000000|1.333333|81 -TCONS_00000073 XLOC_000043 Xkr4|Xkr4 i - q2:CUFF.45|CUFF.45.1|1|20.667495|0.000000|1.173913|46 -TCONS_00000074 XLOC_000045 Xkr4|Xkr4 i - q2:CUFF.47|CUFF.47.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000075 XLOC_000047 Xkr4|Xkr4 i - q2:CUFF.49|CUFF.49.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000076 XLOC_000049 Xkr4|Xkr4 i - q2:CUFF.51|CUFF.51.1|1|14.948188|0.000000|0.849057|477 -TCONS_00000077 XLOC_000050 Xkr4|Xkr4 i - q2:CUFF.53|CUFF.53.1|1|52.816931|0.000000|3.000000|27 -TCONS_00000078 XLOC_000051 Xkr4|Xkr4 i - q2:CUFF.55|CUFF.55.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000079 XLOC_000053 Xkr4|Xkr4 i - q2:CUFF.57|CUFF.57.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000080 XLOC_000054 Xkr4|Xkr4 i - q2:CUFF.59|CUFF.59.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000081 XLOC_000055 Xkr4|Xkr4 i - q2:CUFF.61|CUFF.61.1|1|13.204233|0.000000|0.750000|72 -TCONS_00000082 XLOC_000056 Xkr4|Xkr4 i - q2:CUFF.63|CUFF.63.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000083 XLOC_000058 Xkr4|Xkr4 i - q2:CUFF.65|CUFF.65.1|1|31.170648|0.000000|1.770492|61 -TCONS_00000084 XLOC_000059 Xkr4|Xkr4 i - q2:CUFF.69|CUFF.69.1|1|18.799247|0.000000|1.067797|354 -TCONS_00000085 XLOC_000060 Xkr4|Xkr4 i - q2:CUFF.67|CUFF.67.1|1|15.681351|0.000000|0.890700|197 -TCONS_00000086 XLOC_000061 Xkr4|Xkr4 i - q2:CUFF.71|CUFF.71.1|1|22.635827|0.000000|1.285714|42 -TCONS_00000087 XLOC_000063 Xkr4|Xkr4 i - q2:CUFF.73|CUFF.73.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000088 XLOC_000064 Xkr4|Xkr4 i - q2:CUFF.75|CUFF.75.1|1|52.816931|0.000000|3.000000|27 -TCONS_00000089 XLOC_000066 Xkr4|Xkr4 i - q2:CUFF.77|CUFF.77.1|1|17.605644|0.000000|1.000000|27 -TCONS_00000090 XLOC_000067 Xkr4|Xkr4 i - q2:CUFF.79|CUFF.79.1|1|13.390208|0.000000|0.760563|71 -TCONS_00000091 XLOC_000068 Xkr4|Xkr4 i - q2:CUFF.81|CUFF.81.1|1|11.211141|0.000000|0.636792|212 -TCONS_00000092 XLOC_000069 Xkr4|Xkr4 i - q2:CUFF.83|CUFF.83.1|1|21.126772|0.000000|1.200000|45 -TCONS_00000093 XLOC_000070 Xkr4|Xkr4 i - q2:CUFF.85|CUFF.85.1|1|19.014095|0.000000|1.080000|100 -TCONS_00000094 XLOC_000072 Xkr4|Xkr4 i - q2:CUFF.87|CUFF.87.1|1|24.170460|0.000000|1.372881|59 -TCONS_00000095 XLOC_000074 Xkr4|Xkr4 i - q2:CUFF.89|CUFF.89.1|1|29.709524|0.000000|1.687500|48 -TCONS_00000096 XLOC_000076 Xkr4|Xkr4 i - q2:CUFF.91|CUFF.91.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000097 XLOC_000078 Xkr4|Xkr4 i - q2:CUFF.93|CUFF.93.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000098 XLOC_000079 Xkr4|Xkr4 i - q2:CUFF.95|CUFF.95.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000099 XLOC_000081 Xkr4|Xkr4 i - q2:CUFF.97|CUFF.97.1|1|35.211287|0.000000|2.000000|27 -TCONS_00000100 XLOC_000082 Xkr4|Xkr4 i - q2:CUFF.99|CUFF.99.1|1|19.602160|0.000000|1.113402|97 +TCONS_00000001 XLOC_000002 - u q1:CUFF.7|CUFF.7.1|1|9.999117|0.000000|0.639053|9 - +TCONS_00000002 XLOC_000003 - u q1:CUFF.9|CUFF.9.1|1|17.776896|0.000000|1.136139|9 - +TCONS_00000003 XLOC_000004 - u q1:CUFF.10|CUFF.10.1|1|17.776896|0.000000|1.136139|9 - +TCONS_00000004 XLOC_000005 - u q1:CUFF.1|CUFF.1.1|1|20.607936|0.000000|1.317073|9 q2:CUFF.1|CUFF.1.1|1|35.211287|0.000000|2.000000|9 +TCONS_00000005 XLOC_000006 - u q1:CUFF.3|CUFF.3.1|1|27.255658|0.000000|1.741935|6 - +TCONS_00000006 XLOC_000001 - u - q2:CUFF.3|CUFF.3.1|1|35.211287|0.000000|2.000000|9 +TCONS_00000007 XLOC_000003 - u - q2:CUFF.7|CUFF.7.1|1|29.709524|0.000000|1.687500|6 +TCONS_00000008 XLOC_000007 - u - q2:CUFF.5|CUFF.5.1|1|21.226627|0.000000|1.205672|9
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out2-1.refmap Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,2 @@ +ref_gene_id ref_id class_code qry_id_list +Lypla1 Lypla1 c CUFF.7|CUFF.7.1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out2-1.tmap Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,6 @@ +ref_gene_id ref_id class_code qry_gene_id qry_id num_exons FPKM TPM cov len major_iso_id ref_match_len +- - u CUFF.1 CUFF.1.1 1 20.607936 0.000000 1.317073 9 CUFF.1.1 - +- - u CUFF.3 CUFF.3.1 1 27.255658 0.000000 1.741935 6 CUFF.3.1 - +Lypla1 Lypla1 c CUFF.7 CUFF.7.1 1 9.999117 0.000000 0.639053 9 CUFF.7.1 19 +Lypla1 Lypla1 c CUFF.9 CUFF.9.1 1 17.776896 0.000000 1.136139 9 CUFF.9.1 19 +Lypla1 Lypla1 p CUFF.10 CUFF.10.1 1 17.776896 0.000000 1.136139 9 CUFF.10.1 19
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out2-2.refmap Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,2 @@ +ref_gene_id ref_id class_code qry_id_list +Lypla1 Lypla1 c CUFF.7|CUFF.7.1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out2-2.tmap Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,5 @@ +ref_gene_id ref_id class_code qry_gene_id qry_id num_exons FPKM TPM cov len major_iso_id ref_match_len +- - u CUFF.1 CUFF.1.1 1 35.211287 0.000000 2.000000 9 CUFF.1.1 - +- - u CUFF.3 CUFF.3.1 1 35.211287 0.000000 2.000000 9 CUFF.3.1 - +- - u CUFF.5 CUFF.5.1 1 21.226627 0.000000 1.205672 9 CUFF.5.1 - +Lypla1 Lypla1 c CUFF.7 CUFF.7.1 1 29.709524 0.000000 1.687500 6 CUFF.7.1 19
--- a/test-data/gffcompare_out2.gtf Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out2.gtf Mon May 27 13:54:15 2019 -0400 @@ -1,206 +1,16 @@ -chr1 StringTie transcript 160930303 160940234 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS1"; -chr1 StringTie exon 160930303 160930344 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "1"; -chr1 StringTie exon 160938112 160938232 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "2"; -chr1 StringTie exon 160939995 160940234 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "3"; -chr1 StringTie transcript 160940817 160967997 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS2"; -chr1 StringTie exon 160940817 160940994 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "1"; -chr1 StringTie exon 160942528 160942728 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "2"; -chr1 StringTie exon 160946534 160946666 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "3"; -chr1 StringTie exon 160948307 160948425 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "4"; -chr1 StringTie exon 160950222 160950334 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "5"; -chr1 StringTie exon 160950841 160951122 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "6"; -chr1 StringTie exon 160951615 160951829 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "7"; -chr1 StringTie exon 160954784 160955151 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "8"; -chr1 StringTie exon 160955815 160955979 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "9"; -chr1 StringTie exon 160959401 160959553 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "10"; -chr1 StringTie exon 160962271 160962484 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "11"; -chr1 StringTie exon 160963479 160963569 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "12"; -chr1 StringTie exon 160963708 160963840 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "13"; -chr1 StringTie exon 160964950 160965120 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "14"; -chr1 StringTie exon 160965673 160965788 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "15"; -chr1 StringTie exon 160967647 160967997 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "16"; -chr1 StringTie transcript 160968644 160972020 . + . transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS3"; -chr1 StringTie exon 160968644 160972020 . + . transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; exon_number "1"; -chr1 StringTie transcript 160972938 160974977 . + . transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS4"; -chr1 StringTie exon 160972938 160974977 . + . transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; exon_number "1"; -chr1 StringTie transcript 161003085 161003516 . + . transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; xloc "XLOC_000002"; class_code "u"; tss_id "TSS5"; -chr1 StringTie exon 161003085 161003516 . + . transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; exon_number "1"; -chr1 StringTie transcript 161006151 161006466 . + . transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; xloc "XLOC_000003"; class_code "u"; tss_id "TSS6"; -chr1 StringTie exon 161006151 161006466 . + . transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; exon_number "1"; -chr1 StringTie transcript 161008375 161008625 . + . transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; xloc "XLOC_000004"; class_code "u"; tss_id "TSS7"; -chr1 StringTie exon 161008375 161008625 . + . transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; exon_number "1"; -chr1 StringTie transcript 161009768 161010195 . + . transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; xloc "XLOC_000005"; class_code "u"; tss_id "TSS8"; -chr1 StringTie exon 161009768 161010195 . + . transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; exon_number "1"; -chr1 StringTie transcript 161019713 161019962 . + . transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; gene_name "uc007der.1"; xloc "XLOC_000006"; cmp_ref "uc007der.1"; class_code "x"; tss_id "TSS9"; -chr1 StringTie exon 161019713 161019962 . + . transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; exon_number "1"; -chr1 StringTie transcript 161034351 161038539 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS10"; -chr1 StringTie exon 161034351 161034719 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "1"; -chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "2"; -chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "3"; -chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "4"; -chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "5"; -chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "6"; -chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "7"; -chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "8"; -chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "9"; -chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "10"; -chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "11"; -chr1 StringTie transcript 161034584 161038539 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11"; -chr1 StringTie exon 161034584 161034719 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "1"; -chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "2"; -chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "3"; -chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "4"; -chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "5"; -chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "6"; -chr1 StringTie exon 161037124 161037164 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "7"; -chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "8"; -chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "9"; -chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "10"; -chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "11"; -chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "12"; -chr1 StringTie transcript 161034642 161038338 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11"; -chr1 StringTie exon 161034642 161035194 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "1"; -chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "2"; -chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "3"; -chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "4"; -chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "5"; -chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "6"; -chr1 StringTie exon 161037124 161037164 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "7"; -chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "8"; -chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "9"; -chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "10"; -chr1 StringTie exon 161038225 161038338 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "11"; -chr1 StringTie transcript 161035095 161038539 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS12"; -chr1 StringTie exon 161035095 161035194 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "1"; -chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "2"; -chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "3"; -chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "4"; -chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "5"; -chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "6"; -chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "7"; -chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "8"; -chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "9"; -chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "10"; -chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "11"; -chr1 StringTie transcript 161035164 161038539 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "="; tss_id "TSS12"; -chr1 StringTie exon 161035164 161035194 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "1"; -chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "2"; -chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "3"; -chr1 StringTie exon 161036208 161036579 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "4"; -chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "5"; -chr1 StringTie exon 161037124 161037164 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "6"; -chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "7"; -chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "8"; -chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "9"; -chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "10"; -chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "11"; -chr1 StringTie transcript 161041562 161070639 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS13"; -chr1 StringTie exon 161041562 161041930 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "1"; -chr1 StringTie exon 161043613 161043688 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "2"; -chr1 StringTie exon 161044959 161045069 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "3"; -chr1 StringTie exon 161045258 161045476 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "4"; -chr1 StringTie exon 161046777 161046929 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "5"; -chr1 StringTie exon 161049938 161050000 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "6"; -chr1 StringTie exon 161051331 161051438 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "7"; -chr1 StringTie exon 161056461 161056530 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "8"; -chr1 StringTie exon 161057447 161057553 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "9"; -chr1 StringTie exon 161060045 161060091 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "10"; -chr1 StringTie exon 161060736 161060859 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "11"; -chr1 StringTie exon 161062782 161062877 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "12"; -chr1 StringTie exon 161063247 161063348 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "13"; -chr1 StringTie exon 161065225 161065291 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "14"; -chr1 StringTie exon 161069080 161069179 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "15"; -chr1 StringTie exon 161069993 161070639 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "16"; -chr1 StringTie transcript 161045151 161056533 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS14"; -chr1 StringTie exon 161045151 161045476 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "1"; -chr1 StringTie exon 161046777 161046929 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "2"; -chr1 StringTie exon 161049938 161050000 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "3"; -chr1 StringTie exon 161051331 161051438 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "4"; -chr1 StringTie exon 161053941 161054120 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "5"; -chr1 StringTie exon 161056461 161056533 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "6"; -chr1 StringTie transcript 161070945 161078458 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; gene_name "uc007dfd.3"; xloc "XLOC_000009"; cmp_ref "uc007dfd.3"; class_code "c"; tss_id "TSS15"; -chr1 StringTie exon 161070945 161071356 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "1"; -chr1 StringTie exon 161074757 161074930 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "2"; -chr1 StringTie exon 161078329 161078458 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "3"; -chr1 StringTie transcript 161082956 161083421 . + . transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS16"; -chr1 StringTie exon 161082956 161083421 . + . transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; exon_number "1"; -chr1 StringTie transcript 161084121 161084344 . + . transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS17"; -chr1 StringTie exon 161084121 161084344 . + . transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; exon_number "1"; -chr1 StringTie transcript 161085014 161086329 . + . transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; gene_name "uc056yep.1"; xloc "XLOC_000009"; cmp_ref "uc056yep.1"; class_code "c"; tss_id "TSS18"; -chr1 StringTie exon 161085014 161086329 . + . transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; exon_number "1"; -chr1 StringTie transcript 161088497 161088913 . + . transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; gene_name "uc007dff.1"; xloc "XLOC_000010"; cmp_ref "uc007dff.1"; class_code "x"; tss_id "TSS19"; -chr1 StringTie exon 161088497 161088913 . + . transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; exon_number "1"; -chr1 StringTie transcript 161089415 161131512 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; gene_name "uc007dff.1"; xloc "XLOC_000011"; cmp_ref "uc007dff.1"; class_code "s"; tss_id "TSS20"; -chr1 StringTie exon 161089415 161090511 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "1"; -chr1 StringTie exon 161093681 161093787 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "2"; -chr1 StringTie exon 161095529 161095737 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "3"; -chr1 StringTie exon 161098263 161098396 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "4"; -chr1 StringTie exon 161099142 161099285 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "5"; -chr1 StringTie exon 161101451 161101634 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "6"; -chr1 StringTie exon 161102979 161103094 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "7"; -chr1 StringTie exon 161105401 161105495 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "8"; -chr1 StringTie exon 161106707 161106865 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "9"; -chr1 StringTie exon 161109222 161109795 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "10"; -chr1 StringTie exon 161130389 161130452 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "11"; -chr1 StringTie exon 161131363 161131512 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "12"; -chr1 StringTie transcript 161123665 161123877 . + . transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; gene_name "uc007dff.1"; xloc "XLOC_000012"; cmp_ref "uc007dff.1"; class_code "i"; tss_id "TSS21"; -chr1 StringTie exon 161123665 161123877 . + . transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; exon_number "1"; -chr1 StringTie transcript 29485012 29485458 . - . transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; xloc "XLOC_000013"; class_code "u"; tss_id "TSS22"; -chr1 StringTie exon 29485012 29485458 . - . transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; exon_number "1"; -chr1 StringTie transcript 86909344 86909692 . - . transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; xloc "XLOC_000014"; class_code "u"; tss_id "TSS23"; -chr1 StringTie exon 86909344 86909692 . - . transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; exon_number "1"; -chr1 StringTie transcript 161003658 161004769 . - . transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; xloc "XLOC_000015"; class_code "u"; tss_id "TSS24"; -chr1 StringTie exon 161003658 161004769 . - . transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; exon_number "1"; -chr1 StringTie transcript 161005030 161005802 . - . transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; xloc "XLOC_000016"; class_code "u"; tss_id "TSS25"; -chr1 StringTie exon 161005030 161005802 . - . transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; exon_number "1"; -chr1 StringTie transcript 161007444 161007700 . - . transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; xloc "XLOC_000017"; class_code "u"; tss_id "TSS26"; -chr1 StringTie exon 161007444 161007700 . - . transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; exon_number "1"; -chr1 StringTie transcript 161032044 161032396 . - . transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; gene_name "uc007des.1"; xloc "XLOC_000018"; cmp_ref "uc007des.1"; class_code "c"; tss_id "TSS27"; -chr1 StringTie exon 161032044 161032396 . - . transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; exon_number "1"; -chr1 StringTie transcript 161041525 161050001 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS28"; -chr1 StringTie exon 161041525 161041930 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "1"; -chr1 StringTie exon 161043613 161043688 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "2"; -chr1 StringTie exon 161044959 161045069 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "3"; -chr1 StringTie exon 161045258 161045476 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "4"; -chr1 StringTie exon 161046777 161046929 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "5"; -chr1 StringTie exon 161049938 161050001 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "6"; -chr1 StringTie transcript 161051330 161070504 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS29"; -chr1 StringTie exon 161051330 161051438 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "1"; -chr1 StringTie exon 161053941 161054120 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "2"; -chr1 StringTie exon 161056461 161056530 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "3"; -chr1 StringTie exon 161057447 161057553 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "4"; -chr1 StringTie exon 161060045 161060091 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "5"; -chr1 StringTie exon 161060736 161060859 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "6"; -chr1 StringTie exon 161062782 161062877 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "7"; -chr1 StringTie exon 161063247 161063348 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "8"; -chr1 StringTie exon 161065225 161065291 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "9"; -chr1 StringTie exon 161069080 161069179 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "10"; -chr1 StringTie exon 161069993 161070504 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "11"; -chr1 StringTie transcript 161051331 161070649 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "j"; tss_id "TSS30"; -chr1 StringTie exon 161051331 161051438 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "1"; -chr1 StringTie exon 161056461 161056530 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "2"; -chr1 StringTie exon 161057447 161057553 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "3"; -chr1 StringTie exon 161060045 161060091 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "4"; -chr1 StringTie exon 161060736 161060859 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "5"; -chr1 StringTie exon 161062782 161062877 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "6"; -chr1 StringTie exon 161063247 161063348 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "7"; -chr1 StringTie exon 161065225 161065291 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "8"; -chr1 StringTie exon 161069080 161069179 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "9"; -chr1 StringTie exon 161069993 161070649 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "10"; -chr1 StringTie transcript 161088915 161090275 . - . transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "c"; tss_id "TSS31"; -chr1 StringTie exon 161088915 161090275 . - . transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; exon_number "1"; -chr1 StringTie transcript 161090412 161131492 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "="; tss_id "TSS32"; -chr1 StringTie exon 161090412 161090511 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "1"; -chr1 StringTie exon 161093681 161093787 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "2"; -chr1 StringTie exon 161095529 161095737 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "3"; -chr1 StringTie exon 161098263 161098396 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "4"; -chr1 StringTie exon 161099142 161099285 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "5"; -chr1 StringTie exon 161101451 161101634 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "6"; -chr1 StringTie exon 161102979 161103094 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "7"; -chr1 StringTie exon 161105401 161105495 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "8"; -chr1 StringTie exon 161106707 161106865 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "9"; -chr1 StringTie exon 161109222 161109795 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "10"; -chr1 StringTie exon 161130389 161130452 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "11"; -chr1 StringTie exon 161131363 161131492 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "12"; -chr1 StringTie transcript 192074156 192074378 . - . transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; xloc "XLOC_000021"; class_code "u"; tss_id "TSS33"; -chr1 StringTie exon 192074156 192074378 . - . transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; exon_number "1"; +chr1 Cufflinks transcript 12 20 . + . transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS1"; +chr1 Cufflinks exon 12 20 . + . transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; exon_number "1"; +chr1 Cufflinks transcript 32 40 . + . transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; gene_name "Lypla1"; oId "CUFF.7.1"; cmp_ref "Lypla1"; class_code "c"; tss_id "TSS2"; +chr1 Cufflinks exon 32 40 . + . transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; exon_number "1"; +chr1 Cufflinks transcript 42 47 . + . transcript_id "TCONS_00000007"; gene_id "XLOC_000002"; gene_name "Lypla1"; oId "CUFF.7.1"; contained_in "TCONS_00000002"; cmp_ref "Lypla1"; class_code "c"; tss_id "TSS3"; +chr1 Cufflinks exon 42 47 . + . transcript_id "TCONS_00000007"; gene_id "XLOC_000002"; exon_number "1"; +chr1 Cufflinks transcript 42 50 . + . transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; gene_name "Lypla1"; oId "CUFF.9.1"; cmp_ref "Lypla1"; class_code "c"; tss_id "TSS3"; +chr1 Cufflinks exon 42 50 . + . transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; exon_number "1"; +chr1 Cufflinks transcript 52 60 . + . transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; gene_name "Lypla1"; oId "CUFF.10.1"; cmp_ref "Lypla1"; class_code "p"; tss_id "TSS4"; +chr1 Cufflinks exon 52 60 . + . transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; exon_number "1"; +chr1 Cufflinks transcript 2 10 . - . transcript_id "TCONS_00000004"; gene_id "XLOC_000004"; oId "CUFF.1.1"; class_code "u"; tss_id "TSS5"; +chr1 Cufflinks exon 2 10 . - . transcript_id "TCONS_00000004"; gene_id "XLOC_000004"; exon_number "1"; +chr1 Cufflinks transcript 15 20 . - . transcript_id "TCONS_00000005"; gene_id "XLOC_000005"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS6"; +chr1 Cufflinks exon 15 20 . - . transcript_id "TCONS_00000005"; gene_id "XLOC_000005"; exon_number "1"; +chr1 Cufflinks transcript 22 30 . - . transcript_id "TCONS_00000008"; gene_id "XLOC_000006"; oId "CUFF.5.1"; class_code "u"; tss_id "TSS7"; +chr1 Cufflinks exon 22 30 . - . transcript_id "TCONS_00000008"; gene_id "XLOC_000006"; exon_number "1";
--- a/test-data/gffcompare_out2.loci Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out2.loci Mon May 27 13:54:15 2019 -0400 @@ -1,21 +1,6 @@ -XLOC_000001 chr1[+]160930303-160974977 uc007del.2|uc007del.2 MSTRG.4.1,MSTRG.5.1,MSTRG.6.1,MSTRG.3.1 -XLOC_000002 chr1[+]161003085-161003516 - MSTRG.7.1 -XLOC_000003 chr1[+]161006151-161006466 - MSTRG.10.1 -XLOC_000004 chr1[+]161008375-161008625 - MSTRG.12.1 -XLOC_000005 chr1[+]161009768-161010195 - MSTRG.13.1 -XLOC_000006 chr1[+]161019713-161019962 - MSTRG.14.1 -XLOC_000007 chr1[+]161034351-161038539 uc007det.1|uc007det.1,uc007deu.1|uc007deu.1,uc007dev.1|uc007dev.1,uc007dew.1|uc007dew.1,uc011wun.1|uc011wun.1,uc007dex.1|uc007dex.1 MSTRG.16.1,MSTRG.16.2,MSTRG.16.3,MSTRG.16.4,MSTRG.16.5 -XLOC_000008 chr1[+]161041562-161070639 - MSTRG.18.1,MSTRG.18.2 -XLOC_000009 chr1[+]161070945-161086329 uc007dfe.4|uc007dfe.4,uc007dfc.3|uc007dfc.3,uc007dfd.3|uc007dfd.3,uc056yep.1|uc056yep.1 MSTRG.20.1,MSTRG.21.1,MSTRG.22.1,MSTRG.23.1 -XLOC_000010 chr1[+]161088497-161088913 - MSTRG.24.1 -XLOC_000011 chr1[+]161089415-161131512 - MSTRG.26.1 -XLOC_000012 chr1[+]161123665-161123877 - MSTRG.28.1 -XLOC_000013 chr1[-]29485012-29485458 - MSTRG.1.1 -XLOC_000014 chr1[-]86909344-86909692 - MSTRG.2.1 -XLOC_000015 chr1[-]161003658-161004769 - MSTRG.8.1 -XLOC_000016 chr1[-]161005030-161005802 - MSTRG.9.1 -XLOC_000017 chr1[-]161007444-161007700 - MSTRG.11.1 -XLOC_000018 chr1[-]161019713-161034848 uc007der.1|uc007der.1,uc007des.1|uc007des.1 MSTRG.15.1 -XLOC_000019 chr1[-]161041525-161070649 uc007dey.2|uc007dey.2,uc007dez.2|uc007dez.2 MSTRG.17.1,MSTRG.19.1,MSTRG.19.2 -XLOC_000020 chr1[-]161088497-161131492 uc007dff.1|uc007dff.1,uc007dfg.1|uc007dfg.1,uc007dfh.1|uc007dfh.1,uc007dfi.1|uc007dfi.1 MSTRG.25.1,MSTRG.27.1 -XLOC_000021 chr1[-]192074156-192074378 - MSTRG.29.1 +XLOC_000001 chr1[+]12-20 - - CUFF.3.1 +XLOC_000002 chr1[+]32-50 Lypla1|Lypla1 CUFF.7.1,CUFF.9.1 CUFF.7.1 +XLOC_000003 chr1[+]52-60 - CUFF.10.1 - +XLOC_000004 chr1[-]2-10 - CUFF.1.1 CUFF.1.1 +XLOC_000005 chr1[-]15-20 - CUFF.3.1 - +XLOC_000006 chr1[-]22-30 - - CUFF.5.1
--- a/test-data/gffcompare_out2.stats Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out2.stats Mon May 27 13:54:15 2019 -0400 @@ -1,30 +1,47 @@ -# gffcompare v0.10.6 | Command line was: -#gffcompare -r /tmp/tmp7AvPf0/files/000/dataset_13.dat -R -T -e 100 -d 100 -p TCONS gffcompare_in4_gtf +# gffcompare v0.11.2 | Command line was: +#gffcompare -r ref_annotation -e 100 -d 100 -p TCONS gffcompare_in1_gtf gffcompare_in2_gtf # -#= Summary for dataset: gffcompare_in4_gtf -# Query mRNAs : 35 in 29 loci (15 multi-exon transcripts) -# (3 multi-transcript loci, ~1.2 transcripts per locus) -# Reference mRNAs : 20 in 7 loci (19 multi-exon) -# Super-loci w/ reference transcripts: 6 +#= Summary for dataset: gffcompare_in1_gtf +# Query mRNAs : 5 in 5 loci (0 multi-exon transcripts) +# (0 multi-transcript loci, ~1.0 transcripts per locus) +# Reference mRNAs : 1 in 1 loci (0 multi-exon) +# Super-loci w/ reference transcripts: 1 #-----------------| Sensitivity | Precision | - Base level: 72.6 | 60.7 | - Exon level: 80.0 | 55.7 | - Intron level: 81.2 | 64.4 | -Intron chain level: 10.5 | 13.3 | - Transcript level: 10.0 | 5.7 | - Locus level: 28.6 | 6.9 | + Base level: 94.7 | 42.9 | + Exon level: 100.0 | 40.0 | + Transcript level: 0.0 | 0.0 | + Locus level: 0.0 | 0.0 | + + Matching intron chains: 0 + Matching transcripts: 0 + Matching loci: 0 + + Missed exons: 0/1 ( 0.0%) + Novel exons: 3/5 ( 60.0%) + Missed loci: 0/1 ( 0.0%) + Novel loci: 3/5 ( 60.0%) - Matching intron chains: 2 - Matching transcripts: 2 - Matching loci: 2 +#= Summary for dataset: gffcompare_in2_gtf +# Query mRNAs : 4 in 4 loci (0 multi-exon transcripts) +# (0 multi-transcript loci, ~1.0 transcripts per locus) +# Reference mRNAs : 1 in 1 loci (0 multi-exon) +# Super-loci w/ reference transcripts: 1 +#-----------------| Sensitivity | Precision | + Base level: 31.6 | 18.2 | + Exon level: 100.0 | 25.0 | + Transcript level: 0.0 | 0.0 | + Locus level: 0.0 | 0.0 | - Missed exons: 3/85 ( 3.5%) - Novel exons: 46/122 ( 37.7%) - Missed introns: 11/69 ( 15.9%) - Novel introns: 28/87 ( 32.2%) - Missed loci: 0/7 ( 0.0%) - Novel loci: 15/29 ( 51.7%) + Matching intron chains: 0 + Matching transcripts: 0 + Matching loci: 0 - Total union super-loci across all input datasets: 21 -35 out of 35 consensus transcripts written in gffcmp.annotated.gtf (0 discarded as redundant) + Missed exons: 0/1 ( 0.0%) + Novel exons: 3/4 ( 75.0%) + Missed loci: 0/1 ( 0.0%) + Novel loci: 3/4 ( 75.0%) + + Total union super-loci across all input datasets: 6 + (0 multi-transcript, ~1.3 transcripts per locus) +8 out of 8 consensus transcripts written in gffcmp.combined.gtf (0 discarded as redundant)
--- a/test-data/gffcompare_out2.tracking Tue Feb 05 15:51:44 2019 -0500 +++ b/test-data/gffcompare_out2.tracking Mon May 27 13:54:15 2019 -0400 @@ -1,35 +1,8 @@ -TCONS_00000001 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.3|MSTRG.3.1|3|0.000000|0.000000|0.000000|403 -TCONS_00000002 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.4|MSTRG.4.1|16|0.000000|0.000000|0.000000|3003 -TCONS_00000003 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.5|MSTRG.5.1|1|0.000000|0.000000|0.000000|3377 -TCONS_00000004 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.6|MSTRG.6.1|1|0.000000|0.000000|0.000000|2040 -TCONS_00000005 XLOC_000002 - u q1:MSTRG.7|MSTRG.7.1|1|0.000000|0.000000|0.000000|432 -TCONS_00000006 XLOC_000003 - u q1:MSTRG.10|MSTRG.10.1|1|0.000000|0.000000|0.000000|316 -TCONS_00000007 XLOC_000004 - u q1:MSTRG.12|MSTRG.12.1|1|0.000000|0.000000|0.000000|251 -TCONS_00000008 XLOC_000005 - u q1:MSTRG.13|MSTRG.13.1|1|0.000000|0.000000|0.000000|428 -TCONS_00000009 XLOC_000006 uc007der.1|uc007der.1 x q1:MSTRG.14|MSTRG.14.1|1|0.000000|0.000000|0.000000|250 -TCONS_00000010 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.1|11|0.000000|0.000000|0.000000|800 -TCONS_00000011 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.2|12|0.000000|0.000000|0.000000|608 -TCONS_00000012 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.3|11|0.000000|0.000000|0.000000|1008 -TCONS_00000013 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.4|11|0.000000|0.000000|0.000000|531 -TCONS_00000014 XLOC_000007 uc007dev.1|uc007dev.1 = q1:MSTRG.16|MSTRG.16.5|11|0.000000|0.000000|0.000000|807 -TCONS_00000015 XLOC_000008 uc007dey.2|uc007dey.2 s q1:MSTRG.18|MSTRG.18.1|16|0.000000|0.000000|0.000000|2459 -TCONS_00000016 XLOC_000008 uc007dey.2|uc007dey.2 s q1:MSTRG.18|MSTRG.18.2|6|0.000000|0.000000|0.000000|903 -TCONS_00000017 XLOC_000009 uc007dfd.3|uc007dfd.3 c q1:MSTRG.20|MSTRG.20.1|3|0.000000|0.000000|0.000000|716 -TCONS_00000018 XLOC_000009 uc007dfe.4|uc007dfe.4 c q1:MSTRG.21|MSTRG.21.1|1|0.000000|0.000000|0.000000|466 -TCONS_00000019 XLOC_000009 uc007dfe.4|uc007dfe.4 c q1:MSTRG.22|MSTRG.22.1|1|0.000000|0.000000|0.000000|224 -TCONS_00000020 XLOC_000009 uc056yep.1|uc056yep.1 c q1:MSTRG.23|MSTRG.23.1|1|0.000000|0.000000|0.000000|1316 -TCONS_00000021 XLOC_000010 uc007dff.1|uc007dff.1 x q1:MSTRG.24|MSTRG.24.1|1|0.000000|0.000000|0.000000|417 -TCONS_00000022 XLOC_000011 uc007dff.1|uc007dff.1 s q1:MSTRG.26|MSTRG.26.1|12|0.000000|0.000000|0.000000|3033 -TCONS_00000023 XLOC_000012 uc007dff.1|uc007dff.1 i q1:MSTRG.28|MSTRG.28.1|1|0.000000|0.000000|0.000000|213 -TCONS_00000024 XLOC_000013 - u q1:MSTRG.1|MSTRG.1.1|1|0.000000|0.000000|0.000000|447 -TCONS_00000025 XLOC_000014 - u q1:MSTRG.2|MSTRG.2.1|1|0.000000|0.000000|0.000000|349 -TCONS_00000026 XLOC_000015 - u q1:MSTRG.8|MSTRG.8.1|1|0.000000|0.000000|0.000000|1112 -TCONS_00000027 XLOC_000016 - u q1:MSTRG.9|MSTRG.9.1|1|0.000000|0.000000|0.000000|773 -TCONS_00000028 XLOC_000017 - u q1:MSTRG.11|MSTRG.11.1|1|0.000000|0.000000|0.000000|257 -TCONS_00000029 XLOC_000018 uc007des.1|uc007des.1 c q1:MSTRG.15|MSTRG.15.1|1|0.000000|0.000000|0.000000|353 -TCONS_00000030 XLOC_000019 uc007dey.2|uc007dey.2 c q1:MSTRG.17|MSTRG.17.1|6|0.000000|0.000000|0.000000|1029 -TCONS_00000031 XLOC_000019 uc007dey.2|uc007dey.2 c q1:MSTRG.19|MSTRG.19.1|11|0.000000|0.000000|0.000000|1514 -TCONS_00000032 XLOC_000019 uc007dey.2|uc007dey.2 j q1:MSTRG.19|MSTRG.19.2|10|0.000000|0.000000|0.000000|1478 -TCONS_00000033 XLOC_000020 uc007dff.1|uc007dff.1 c q1:MSTRG.25|MSTRG.25.1|1|0.000000|0.000000|0.000000|1361 -TCONS_00000034 XLOC_000020 uc007dff.1|uc007dff.1 = q1:MSTRG.27|MSTRG.27.1|12|0.000000|0.000000|0.000000|2016 -TCONS_00000035 XLOC_000021 - u q1:MSTRG.29|MSTRG.29.1|1|0.000000|0.000000|0.000000|223 +TCONS_00000001 XLOC_000002 Lypla1|Lypla1 c q1:CUFF.7|CUFF.7.1|1|9.999117|0.000000|0.639053|9 - +TCONS_00000002 XLOC_000002 Lypla1|Lypla1 c q1:CUFF.9|CUFF.9.1|1|17.776896|0.000000|1.136139|9 - +TCONS_00000003 XLOC_000003 Lypla1|Lypla1 p q1:CUFF.10|CUFF.10.1|1|17.776896|0.000000|1.136139|9 - +TCONS_00000004 XLOC_000004 - u q1:CUFF.1|CUFF.1.1|1|20.607936|0.000000|1.317073|9 q2:CUFF.1|CUFF.1.1|1|35.211287|0.000000|2.000000|9 +TCONS_00000005 XLOC_000005 - u q1:CUFF.3|CUFF.3.1|1|27.255658|0.000000|1.741935|6 - +TCONS_00000006 XLOC_000001 - u - q2:CUFF.3|CUFF.3.1|1|35.211287|0.000000|2.000000|9 +TCONS_00000007 XLOC_000002 Lypla1|Lypla1 c - q2:CUFF.7|CUFF.7.1|1|29.709524|0.000000|1.687500|6 +TCONS_00000008 XLOC_000006 - u - q2:CUFF.5|CUFF.5.1|1|21.226627|0.000000|1.205672|9
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out3.gtf Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,206 @@ +chr1 StringTie transcript 160930303 160940234 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS1"; +chr1 StringTie exon 160930303 160930344 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "1"; +chr1 StringTie exon 160938112 160938232 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "2"; +chr1 StringTie exon 160939995 160940234 . + . transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "3"; +chr1 StringTie transcript 160940817 160967997 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS2"; +chr1 StringTie exon 160940817 160940994 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "1"; +chr1 StringTie exon 160942528 160942728 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "2"; +chr1 StringTie exon 160946534 160946666 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "3"; +chr1 StringTie exon 160948307 160948425 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "4"; +chr1 StringTie exon 160950222 160950334 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "5"; +chr1 StringTie exon 160950841 160951122 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "6"; +chr1 StringTie exon 160951615 160951829 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "7"; +chr1 StringTie exon 160954784 160955151 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "8"; +chr1 StringTie exon 160955815 160955979 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "9"; +chr1 StringTie exon 160959401 160959553 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "10"; +chr1 StringTie exon 160962271 160962484 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "11"; +chr1 StringTie exon 160963479 160963569 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "12"; +chr1 StringTie exon 160963708 160963840 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "13"; +chr1 StringTie exon 160964950 160965120 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "14"; +chr1 StringTie exon 160965673 160965788 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "15"; +chr1 StringTie exon 160967647 160967997 . + . transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "16"; +chr1 StringTie transcript 160968644 160972020 . + . transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS3"; +chr1 StringTie exon 160968644 160972020 . + . transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; exon_number "1"; +chr1 StringTie transcript 160972938 160974977 . + . transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS4"; +chr1 StringTie exon 160972938 160974977 . + . transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; exon_number "1"; +chr1 StringTie transcript 161003085 161003516 . + . transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; xloc "XLOC_000002"; class_code "u"; tss_id "TSS5"; +chr1 StringTie exon 161003085 161003516 . + . transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; exon_number "1"; +chr1 StringTie transcript 161006151 161006466 . + . transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; xloc "XLOC_000003"; class_code "u"; tss_id "TSS6"; +chr1 StringTie exon 161006151 161006466 . + . transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; exon_number "1"; +chr1 StringTie transcript 161008375 161008625 . + . transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; xloc "XLOC_000004"; class_code "u"; tss_id "TSS7"; +chr1 StringTie exon 161008375 161008625 . + . transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; exon_number "1"; +chr1 StringTie transcript 161009768 161010195 . + . transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; xloc "XLOC_000005"; class_code "u"; tss_id "TSS8"; +chr1 StringTie exon 161009768 161010195 . + . transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; exon_number "1"; +chr1 StringTie transcript 161019713 161019962 . + . transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; gene_name "uc007der.1"; xloc "XLOC_000006"; cmp_ref "uc007der.1"; class_code "x"; tss_id "TSS9"; +chr1 StringTie exon 161019713 161019962 . + . transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; exon_number "1"; +chr1 StringTie transcript 161034351 161038539 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS10"; +chr1 StringTie exon 161034351 161034719 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "1"; +chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "2"; +chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "3"; +chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "4"; +chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "5"; +chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "6"; +chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "7"; +chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "8"; +chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "9"; +chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "10"; +chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "11"; +chr1 StringTie transcript 161034584 161038539 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11"; +chr1 StringTie exon 161034584 161034719 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "1"; +chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "2"; +chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "3"; +chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "4"; +chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "5"; +chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "6"; +chr1 StringTie exon 161037124 161037164 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "7"; +chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "8"; +chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "9"; +chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "10"; +chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "11"; +chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "12"; +chr1 StringTie transcript 161034642 161038338 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11"; +chr1 StringTie exon 161034642 161035194 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "1"; +chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "2"; +chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "3"; +chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "4"; +chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "5"; +chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "6"; +chr1 StringTie exon 161037124 161037164 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "7"; +chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "8"; +chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "9"; +chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "10"; +chr1 StringTie exon 161038225 161038338 . + . transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "11"; +chr1 StringTie transcript 161035095 161038539 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS12"; +chr1 StringTie exon 161035095 161035194 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "1"; +chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "2"; +chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "3"; +chr1 StringTie exon 161036208 161036244 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "4"; +chr1 StringTie exon 161036549 161036579 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "5"; +chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "6"; +chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "7"; +chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "8"; +chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "9"; +chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "10"; +chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "11"; +chr1 StringTie transcript 161035164 161038539 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "="; tss_id "TSS12"; +chr1 StringTie exon 161035164 161035194 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "1"; +chr1 StringTie exon 161035752 161035804 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "2"; +chr1 StringTie exon 161035983 161036014 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "3"; +chr1 StringTie exon 161036208 161036579 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "4"; +chr1 StringTie exon 161036820 161036852 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "5"; +chr1 StringTie exon 161037124 161037164 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "6"; +chr1 StringTie exon 161037288 161037315 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "7"; +chr1 StringTie exon 161037505 161037547 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "8"; +chr1 StringTie exon 161037995 161038037 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "9"; +chr1 StringTie exon 161038225 161038272 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "10"; +chr1 StringTie exon 161038457 161038539 . + . transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "11"; +chr1 StringTie transcript 161041562 161070639 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS13"; +chr1 StringTie exon 161041562 161041930 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "1"; +chr1 StringTie exon 161043613 161043688 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "2"; +chr1 StringTie exon 161044959 161045069 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "3"; +chr1 StringTie exon 161045258 161045476 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "4"; +chr1 StringTie exon 161046777 161046929 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "5"; +chr1 StringTie exon 161049938 161050000 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "6"; +chr1 StringTie exon 161051331 161051438 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "7"; +chr1 StringTie exon 161056461 161056530 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "8"; +chr1 StringTie exon 161057447 161057553 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "9"; +chr1 StringTie exon 161060045 161060091 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "10"; +chr1 StringTie exon 161060736 161060859 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "11"; +chr1 StringTie exon 161062782 161062877 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "12"; +chr1 StringTie exon 161063247 161063348 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "13"; +chr1 StringTie exon 161065225 161065291 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "14"; +chr1 StringTie exon 161069080 161069179 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "15"; +chr1 StringTie exon 161069993 161070639 . + . transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "16"; +chr1 StringTie transcript 161045151 161056533 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS14"; +chr1 StringTie exon 161045151 161045476 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "1"; +chr1 StringTie exon 161046777 161046929 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "2"; +chr1 StringTie exon 161049938 161050000 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "3"; +chr1 StringTie exon 161051331 161051438 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "4"; +chr1 StringTie exon 161053941 161054120 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "5"; +chr1 StringTie exon 161056461 161056533 . + . transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "6"; +chr1 StringTie transcript 161070945 161078458 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; gene_name "uc007dfd.3"; xloc "XLOC_000009"; cmp_ref "uc007dfd.3"; class_code "c"; tss_id "TSS15"; +chr1 StringTie exon 161070945 161071356 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "1"; +chr1 StringTie exon 161074757 161074930 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "2"; +chr1 StringTie exon 161078329 161078458 . + . transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "3"; +chr1 StringTie transcript 161082956 161083421 . + . transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS16"; +chr1 StringTie exon 161082956 161083421 . + . transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; exon_number "1"; +chr1 StringTie transcript 161084121 161084344 . + . transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS17"; +chr1 StringTie exon 161084121 161084344 . + . transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; exon_number "1"; +chr1 StringTie transcript 161085014 161086329 . + . transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; gene_name "uc056yep.1"; xloc "XLOC_000009"; cmp_ref "uc056yep.1"; class_code "c"; tss_id "TSS18"; +chr1 StringTie exon 161085014 161086329 . + . transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; exon_number "1"; +chr1 StringTie transcript 161088497 161088913 . + . transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; gene_name "uc007dff.1"; xloc "XLOC_000010"; cmp_ref "uc007dff.1"; class_code "x"; tss_id "TSS19"; +chr1 StringTie exon 161088497 161088913 . + . transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; exon_number "1"; +chr1 StringTie transcript 161089415 161131512 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; gene_name "uc007dff.1"; xloc "XLOC_000011"; cmp_ref "uc007dff.1"; class_code "s"; tss_id "TSS20"; +chr1 StringTie exon 161089415 161090511 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "1"; +chr1 StringTie exon 161093681 161093787 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "2"; +chr1 StringTie exon 161095529 161095737 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "3"; +chr1 StringTie exon 161098263 161098396 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "4"; +chr1 StringTie exon 161099142 161099285 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "5"; +chr1 StringTie exon 161101451 161101634 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "6"; +chr1 StringTie exon 161102979 161103094 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "7"; +chr1 StringTie exon 161105401 161105495 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "8"; +chr1 StringTie exon 161106707 161106865 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "9"; +chr1 StringTie exon 161109222 161109795 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "10"; +chr1 StringTie exon 161130389 161130452 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "11"; +chr1 StringTie exon 161131363 161131512 . + . transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "12"; +chr1 StringTie transcript 161123665 161123877 . + . transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; gene_name "uc007dff.1"; xloc "XLOC_000012"; cmp_ref "uc007dff.1"; class_code "i"; tss_id "TSS21"; +chr1 StringTie exon 161123665 161123877 . + . transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; exon_number "1"; +chr1 StringTie transcript 29485012 29485458 . - . transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; xloc "XLOC_000013"; class_code "u"; tss_id "TSS22"; +chr1 StringTie exon 29485012 29485458 . - . transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; exon_number "1"; +chr1 StringTie transcript 86909344 86909692 . - . transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; xloc "XLOC_000014"; class_code "u"; tss_id "TSS23"; +chr1 StringTie exon 86909344 86909692 . - . transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; exon_number "1"; +chr1 StringTie transcript 161003658 161004769 . - . transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; xloc "XLOC_000015"; class_code "u"; tss_id "TSS24"; +chr1 StringTie exon 161003658 161004769 . - . transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; exon_number "1"; +chr1 StringTie transcript 161005030 161005802 . - . transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; xloc "XLOC_000016"; class_code "u"; tss_id "TSS25"; +chr1 StringTie exon 161005030 161005802 . - . transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; exon_number "1"; +chr1 StringTie transcript 161007444 161007700 . - . transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; xloc "XLOC_000017"; class_code "u"; tss_id "TSS26"; +chr1 StringTie exon 161007444 161007700 . - . transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; exon_number "1"; +chr1 StringTie transcript 161032044 161032396 . - . transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; gene_name "uc007des.1"; xloc "XLOC_000018"; cmp_ref "uc007des.1"; class_code "c"; tss_id "TSS27"; +chr1 StringTie exon 161032044 161032396 . - . transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; exon_number "1"; +chr1 StringTie transcript 161041525 161050001 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS28"; +chr1 StringTie exon 161041525 161041930 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "1"; +chr1 StringTie exon 161043613 161043688 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "2"; +chr1 StringTie exon 161044959 161045069 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "3"; +chr1 StringTie exon 161045258 161045476 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "4"; +chr1 StringTie exon 161046777 161046929 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "5"; +chr1 StringTie exon 161049938 161050001 . - . transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "6"; +chr1 StringTie transcript 161051330 161070504 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS29"; +chr1 StringTie exon 161051330 161051438 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "1"; +chr1 StringTie exon 161053941 161054120 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "2"; +chr1 StringTie exon 161056461 161056530 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "3"; +chr1 StringTie exon 161057447 161057553 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "4"; +chr1 StringTie exon 161060045 161060091 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "5"; +chr1 StringTie exon 161060736 161060859 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "6"; +chr1 StringTie exon 161062782 161062877 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "7"; +chr1 StringTie exon 161063247 161063348 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "8"; +chr1 StringTie exon 161065225 161065291 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "9"; +chr1 StringTie exon 161069080 161069179 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "10"; +chr1 StringTie exon 161069993 161070504 . - . transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "11"; +chr1 StringTie transcript 161051331 161070649 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "j"; tss_id "TSS30"; +chr1 StringTie exon 161051331 161051438 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "1"; +chr1 StringTie exon 161056461 161056530 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "2"; +chr1 StringTie exon 161057447 161057553 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "3"; +chr1 StringTie exon 161060045 161060091 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "4"; +chr1 StringTie exon 161060736 161060859 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "5"; +chr1 StringTie exon 161062782 161062877 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "6"; +chr1 StringTie exon 161063247 161063348 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "7"; +chr1 StringTie exon 161065225 161065291 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "8"; +chr1 StringTie exon 161069080 161069179 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "9"; +chr1 StringTie exon 161069993 161070649 . - . transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "10"; +chr1 StringTie transcript 161088915 161090275 . - . transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "c"; tss_id "TSS31"; +chr1 StringTie exon 161088915 161090275 . - . transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; exon_number "1"; +chr1 StringTie transcript 161090412 161131492 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "="; tss_id "TSS32"; +chr1 StringTie exon 161090412 161090511 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "1"; +chr1 StringTie exon 161093681 161093787 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "2"; +chr1 StringTie exon 161095529 161095737 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "3"; +chr1 StringTie exon 161098263 161098396 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "4"; +chr1 StringTie exon 161099142 161099285 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "5"; +chr1 StringTie exon 161101451 161101634 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "6"; +chr1 StringTie exon 161102979 161103094 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "7"; +chr1 StringTie exon 161105401 161105495 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "8"; +chr1 StringTie exon 161106707 161106865 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "9"; +chr1 StringTie exon 161109222 161109795 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "10"; +chr1 StringTie exon 161130389 161130452 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "11"; +chr1 StringTie exon 161131363 161131492 . - . transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "12"; +chr1 StringTie transcript 192074156 192074378 . - . transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; xloc "XLOC_000021"; class_code "u"; tss_id "TSS33"; +chr1 StringTie exon 192074156 192074378 . - . transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; exon_number "1";
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out3.loci Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,21 @@ +XLOC_000001 chr1[+]160930303-160974977 uc007del.2|uc007del.2 MSTRG.4.1,MSTRG.5.1,MSTRG.6.1,MSTRG.3.1 +XLOC_000002 chr1[+]161003085-161003516 - MSTRG.7.1 +XLOC_000003 chr1[+]161006151-161006466 - MSTRG.10.1 +XLOC_000004 chr1[+]161008375-161008625 - MSTRG.12.1 +XLOC_000005 chr1[+]161009768-161010195 - MSTRG.13.1 +XLOC_000006 chr1[+]161019713-161019962 - MSTRG.14.1 +XLOC_000007 chr1[+]161034351-161038539 uc007det.1|uc007det.1,uc007deu.1|uc007deu.1,uc007dev.1|uc007dev.1,uc007dew.1|uc007dew.1,uc011wun.1|uc011wun.1,uc007dex.1|uc007dex.1 MSTRG.16.1,MSTRG.16.2,MSTRG.16.3,MSTRG.16.4,MSTRG.16.5 +XLOC_000008 chr1[+]161041562-161070639 - MSTRG.18.1,MSTRG.18.2 +XLOC_000009 chr1[+]161070945-161086329 uc007dfe.4|uc007dfe.4,uc007dfc.3|uc007dfc.3,uc007dfd.3|uc007dfd.3,uc056yep.1|uc056yep.1 MSTRG.20.1,MSTRG.21.1,MSTRG.22.1,MSTRG.23.1 +XLOC_000010 chr1[+]161088497-161088913 - MSTRG.24.1 +XLOC_000011 chr1[+]161089415-161131512 - MSTRG.26.1 +XLOC_000012 chr1[+]161123665-161123877 - MSTRG.28.1 +XLOC_000013 chr1[-]29485012-29485458 - MSTRG.1.1 +XLOC_000014 chr1[-]86909344-86909692 - MSTRG.2.1 +XLOC_000015 chr1[-]161003658-161004769 - MSTRG.8.1 +XLOC_000016 chr1[-]161005030-161005802 - MSTRG.9.1 +XLOC_000017 chr1[-]161007444-161007700 - MSTRG.11.1 +XLOC_000018 chr1[-]161019713-161034848 uc007der.1|uc007der.1,uc007des.1|uc007des.1 MSTRG.15.1 +XLOC_000019 chr1[-]161041525-161070649 uc007dey.2|uc007dey.2,uc007dez.2|uc007dez.2 MSTRG.17.1,MSTRG.19.1,MSTRG.19.2 +XLOC_000020 chr1[-]161088497-161131492 uc007dff.1|uc007dff.1,uc007dfg.1|uc007dfg.1,uc007dfh.1|uc007dfh.1,uc007dfi.1|uc007dfi.1 MSTRG.25.1,MSTRG.27.1 +XLOC_000021 chr1[-]192074156-192074378 - MSTRG.29.1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out3.stats Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,30 @@ +# gffcompare v0.10.6 | Command line was: +#gffcompare -r ref_annotation -R -T -e 100 -d 100 -p TCONS gffcompare_in4_gtf +# + +#= Summary for dataset: gffcompare_in4_gtf +# Query mRNAs : 35 in 29 loci (15 multi-exon transcripts) +# (3 multi-transcript loci, ~1.2 transcripts per locus) +# Reference mRNAs : 20 in 7 loci (19 multi-exon) +# Super-loci w/ reference transcripts: 6 +#-----------------| Sensitivity | Precision | + Base level: 72.6 | 60.7 | + Exon level: 80.0 | 55.7 | + Intron level: 81.2 | 64.4 | +Intron chain level: 10.5 | 13.3 | + Transcript level: 10.0 | 5.7 | + Locus level: 28.6 | 6.9 | + + Matching intron chains: 2 + Matching transcripts: 2 + Matching loci: 2 + + Missed exons: 3/85 ( 3.5%) + Novel exons: 46/122 ( 37.7%) + Missed introns: 11/69 ( 15.9%) + Novel introns: 28/87 ( 32.2%) + Missed loci: 0/7 ( 0.0%) + Novel loci: 15/29 ( 51.7%) + + Total union super-loci across all input datasets: 21 +35 out of 35 consensus transcripts written in gffcmp.annotated.gtf (0 discarded as redundant)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gffcompare_out3.tracking Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,35 @@ +TCONS_00000001 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.3|MSTRG.3.1|3|0.000000|0.000000|0.000000|403 +TCONS_00000002 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.4|MSTRG.4.1|16|0.000000|0.000000|0.000000|3003 +TCONS_00000003 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.5|MSTRG.5.1|1|0.000000|0.000000|0.000000|3377 +TCONS_00000004 XLOC_000001 uc007del.2|uc007del.2 c q1:MSTRG.6|MSTRG.6.1|1|0.000000|0.000000|0.000000|2040 +TCONS_00000005 XLOC_000002 - u q1:MSTRG.7|MSTRG.7.1|1|0.000000|0.000000|0.000000|432 +TCONS_00000006 XLOC_000003 - u q1:MSTRG.10|MSTRG.10.1|1|0.000000|0.000000|0.000000|316 +TCONS_00000007 XLOC_000004 - u q1:MSTRG.12|MSTRG.12.1|1|0.000000|0.000000|0.000000|251 +TCONS_00000008 XLOC_000005 - u q1:MSTRG.13|MSTRG.13.1|1|0.000000|0.000000|0.000000|428 +TCONS_00000009 XLOC_000006 uc007der.1|uc007der.1 x q1:MSTRG.14|MSTRG.14.1|1|0.000000|0.000000|0.000000|250 +TCONS_00000010 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.1|11|0.000000|0.000000|0.000000|800 +TCONS_00000011 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.2|12|0.000000|0.000000|0.000000|608 +TCONS_00000012 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.3|11|0.000000|0.000000|0.000000|1008 +TCONS_00000013 XLOC_000007 uc007dev.1|uc007dev.1 j q1:MSTRG.16|MSTRG.16.4|11|0.000000|0.000000|0.000000|531 +TCONS_00000014 XLOC_000007 uc007dev.1|uc007dev.1 = q1:MSTRG.16|MSTRG.16.5|11|0.000000|0.000000|0.000000|807 +TCONS_00000015 XLOC_000008 uc007dey.2|uc007dey.2 s q1:MSTRG.18|MSTRG.18.1|16|0.000000|0.000000|0.000000|2459 +TCONS_00000016 XLOC_000008 uc007dey.2|uc007dey.2 s q1:MSTRG.18|MSTRG.18.2|6|0.000000|0.000000|0.000000|903 +TCONS_00000017 XLOC_000009 uc007dfd.3|uc007dfd.3 c q1:MSTRG.20|MSTRG.20.1|3|0.000000|0.000000|0.000000|716 +TCONS_00000018 XLOC_000009 uc007dfe.4|uc007dfe.4 c q1:MSTRG.21|MSTRG.21.1|1|0.000000|0.000000|0.000000|466 +TCONS_00000019 XLOC_000009 uc007dfe.4|uc007dfe.4 c q1:MSTRG.22|MSTRG.22.1|1|0.000000|0.000000|0.000000|224 +TCONS_00000020 XLOC_000009 uc056yep.1|uc056yep.1 c q1:MSTRG.23|MSTRG.23.1|1|0.000000|0.000000|0.000000|1316 +TCONS_00000021 XLOC_000010 uc007dff.1|uc007dff.1 x q1:MSTRG.24|MSTRG.24.1|1|0.000000|0.000000|0.000000|417 +TCONS_00000022 XLOC_000011 uc007dff.1|uc007dff.1 s q1:MSTRG.26|MSTRG.26.1|12|0.000000|0.000000|0.000000|3033 +TCONS_00000023 XLOC_000012 uc007dff.1|uc007dff.1 i q1:MSTRG.28|MSTRG.28.1|1|0.000000|0.000000|0.000000|213 +TCONS_00000024 XLOC_000013 - u q1:MSTRG.1|MSTRG.1.1|1|0.000000|0.000000|0.000000|447 +TCONS_00000025 XLOC_000014 - u q1:MSTRG.2|MSTRG.2.1|1|0.000000|0.000000|0.000000|349 +TCONS_00000026 XLOC_000015 - u q1:MSTRG.8|MSTRG.8.1|1|0.000000|0.000000|0.000000|1112 +TCONS_00000027 XLOC_000016 - u q1:MSTRG.9|MSTRG.9.1|1|0.000000|0.000000|0.000000|773 +TCONS_00000028 XLOC_000017 - u q1:MSTRG.11|MSTRG.11.1|1|0.000000|0.000000|0.000000|257 +TCONS_00000029 XLOC_000018 uc007des.1|uc007des.1 c q1:MSTRG.15|MSTRG.15.1|1|0.000000|0.000000|0.000000|353 +TCONS_00000030 XLOC_000019 uc007dey.2|uc007dey.2 c q1:MSTRG.17|MSTRG.17.1|6|0.000000|0.000000|0.000000|1029 +TCONS_00000031 XLOC_000019 uc007dey.2|uc007dey.2 c q1:MSTRG.19|MSTRG.19.1|11|0.000000|0.000000|0.000000|1514 +TCONS_00000032 XLOC_000019 uc007dey.2|uc007dey.2 j q1:MSTRG.19|MSTRG.19.2|10|0.000000|0.000000|0.000000|1478 +TCONS_00000033 XLOC_000020 uc007dff.1|uc007dff.1 c q1:MSTRG.25|MSTRG.25.1|1|0.000000|0.000000|0.000000|1361 +TCONS_00000034 XLOC_000020 uc007dff.1|uc007dff.1 = q1:MSTRG.27|MSTRG.27.1|12|0.000000|0.000000|0.000000|2016 +TCONS_00000035 XLOC_000021 - u q1:MSTRG.29|MSTRG.29.1|1|0.000000|0.000000|0.000000|223
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sequence.fa Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,2 @@ +>chr1 +AGACACGACCTGCTCGGGTGAGCATCCTTAATTCGAGACAATGTCTAATCAATTGCCACGTATTCAGCTGCCGAACGTAGTGGGCACCACGAGTTTGGTT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/gene_sets.loc.sample Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,14 @@ +# This is a sample file that enables tools to use gene/exon annotations in the GFF/GTF format. +# +# The gene_sets.loc file syntax is: +#<unique_build_id> <dbkey> <display_name> <path> +# +# Please ensure that the above fields are tab separated. +# +# In case you have TWO or MORE providers PER dbkey, the one mentioned +# first in the file, should have the "default" priority. +# +#Example: +# +#Homo_sapiens.GRCh37.74 hg19 GRCh37 (hg19) annotation from Ensembl, release 74 /depot/data2/galaxy/hg19/gene_sets/Homo_sapiens.GRCh37.74.gtf +#Homo_sapiens.NCBI36.54 hg18 hg18 annotation from Ensembl, release 54 /depot/data2/galaxy/hg18/gene_sets/Homo_sapiens.NCBI36.54.gtf
--- a/tool_data_table_conf.xml.sample Tue Feb 05 15:51:44 2019 -0500 +++ b/tool_data_table_conf.xml.sample Mon May 27 13:54:15 2019 -0400 @@ -1,4 +1,9 @@ <tables> + <!-- Location of all GFF/GTF files --> + <table name="gene_sets" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/gene_sets.loc" /> + </table> <!-- Location of SAMTools indexed FASTA files --> <table name="fasta_indexes" comment_char="#"> <columns>value, dbkey, name, path</columns>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Mon May 27 13:54:15 2019 -0400 @@ -0,0 +1,12 @@ +<tables> + <!-- Location of all GFF/GTF files --> + <table name="gene_sets" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/gene_sets.loc" /> + </table> + <!-- Location of SAMTools indexed FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/fasta_indexes.loc" /> + </table> +</tables>