Mercurial > repos > iuc > hmmer3

comparison test-data/nhmmer.out @ 0:62479bdcc059 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4164b44c651bcbdac6637eccce61b2a802c9b569
author iuc
date Tue, 12 May 2015 15:04:26 -0400
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:62479bdcc059
1 # nhmmer :: search a DNA model or alignment against a DNA database
2 # HMMER 3.1b1 (May 2013); http://hmmer.org/
3 # Copyright (C) 2013 Howard Hughes Medical Institute.
4 # Freely distributed under the GNU General Public License (GPLv3).
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query file: test-data/MADE1.hmm
7 # target sequence database: test-data/dna_target.fa
8 # max ASCII text line length: unlimited
9 # number of worker threads: 8
10 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
11
12 Query: MADE1 [M=80]
13 Accession: DF0000629.2
14 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
15 Scores for complete hits:
16 E-value score bias Sequence start end Description
17 ------- ------ ----- -------- ----- ----- -----------
18 9.6e-11 38.8 7.4 humanchr1/239220001-239550000 302390 302466
19 6.5e-08 29.8 8.3 humanchr1/239220001-239550000 174456 174498
20 1e-07 29.2 6.0 humanchr1/239220001-239550000 302466 302390
21 6.2e-06 23.4 7.0 humanchr1/239220001-239550000 174493 174456
22 ------ inclusion threshold ------
23 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104
24
25
26 Annotation for each hit (and alignments):
27 >> humanchr1/239220001-239550000
28 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
29 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
30 ! 38.8 7.4 9.6e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87
31
32 Alignment:
33 score: 38.8 bits
34 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
35 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
36 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa
37 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
38 899******************************************955533.443..334.4689************9986 PP
39
40 >> humanchr1/239220001-239550000
41 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
42 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
43 ! 29.8 8.3 6.5e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92
44
45 Alignment:
46 score: 29.8 bits
47 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
48 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
49 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
50 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
51 589************************************9975 PP
52
53 >> humanchr1/239220001-239550000
54 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
55 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
56 ! 29.2 6.0 1e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.75
57
58 Alignment:
59 score: 29.2 bits
60 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
61 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77
62 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc
63 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
64 68999999999999998................5666777776222222222222222268****************************9998 PP
65
66 >> humanchr1/239220001-239550000
67 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
68 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
69 ! 23.4 7.0 6.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91
70
71 Alignment:
72 score: 23.4 bits
73 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
74 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
75 taatg caaaaacc caattacttttgcac aacctaa
76 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
77 689********************************986 PP
78
79 >> humanchr1/239220001-239550000
80 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
81 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
82 ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85
83
84 Alignment:
85 score: 6.3 bits
86 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
87 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72
88 tt a tgg aaaaa ca tta ttttgca
89 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
90 455779************************86 PP
91
92
93
94 Internal pipeline statistics summary:
95 -------------------------------------
96 Query model(s): 1 (80 nodes)
97 Target sequences: 1 (660000 residues searched)
98 Residues passing SSV filter: 61658 (0.0934); expected (0.02)
99 Residues passing bias filter: 45802 (0.0694); expected (0.02)
100 Residues passing Vit filter: 3544 (0.00537); expected (0.003)
101 Residues passing Fwd filter: 1934 (0.00293); expected (3e-05)
102 Total number of hits: 5 (0.000405)
103 # CPU time: 0.06u 0.00s 00:00:00.06 Elapsed: 00:00:00.05
104 # Mc/sec: 1056.00
105 //
106 [ok]