Mercurial > repos > iuc > hmmer3
diff test-data/nhmmer.out @ 0:62479bdcc059 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4164b44c651bcbdac6637eccce61b2a802c9b569
| author | iuc |
|---|---|
| date | Tue, 12 May 2015 15:04:26 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nhmmer.out Tue May 12 15:04:26 2015 -0400 @@ -0,0 +1,106 @@ +# nhmmer :: search a DNA model or alignment against a DNA database +# HMMER 3.1b1 (May 2013); http://hmmer.org/ +# Copyright (C) 2013 Howard Hughes Medical Institute. +# Freely distributed under the GNU General Public License (GPLv3). +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - +# query file: test-data/MADE1.hmm +# target sequence database: test-data/dna_target.fa +# max ASCII text line length: unlimited +# number of worker threads: 8 +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + +Query: MADE1 [M=80] +Accession: DF0000629.2 +Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +Scores for complete hits: + E-value score bias Sequence start end Description + ------- ------ ----- -------- ----- ----- ----------- + 9.6e-11 38.8 7.4 humanchr1/239220001-239550000 302390 302466 + 6.5e-08 29.8 8.3 humanchr1/239220001-239550000 174456 174498 + 1e-07 29.2 6.0 humanchr1/239220001-239550000 302466 302390 + 6.2e-06 23.4 7.0 humanchr1/239220001-239550000 174493 174456 + ------ inclusion threshold ------ + 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104 + + +Annotation for each hit (and alignments): +>> humanchr1/239220001-239550000 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 38.8 7.4 9.6e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 + + Alignment: + score: 38.8 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 + ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 + 899******************************************955533.443..334.4689************9986 PP + +>> humanchr1/239220001-239550000 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 29.8 8.3 6.5e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 + + Alignment: + score: 29.8 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 + ttaggtt gtgcaaaagtaattg ggtttttg cattactttt + humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 + 589************************************9975 PP + +>> humanchr1/239220001-239550000 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 29.2 6.0 1e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.75 + + Alignment: + score: 29.2 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 + ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc + humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 + 68999999999999998................5666777776222222222222222268****************************9998 PP + +>> humanchr1/239220001-239550000 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 23.4 7.0 6.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 + + Alignment: + score: 23.4 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 + taatg caaaaacc caattacttttgcac aacctaa + humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 + 689********************************986 PP + +>> humanchr1/239220001-239550000 + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 + + Alignment: + score: 6.3 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 + tt a tgg aaaaa ca tta ttttgca + humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 + 455779************************86 PP + + + +Internal pipeline statistics summary: +------------------------------------- +Query model(s): 1 (80 nodes) +Target sequences: 1 (660000 residues searched) +Residues passing SSV filter: 61658 (0.0934); expected (0.02) +Residues passing bias filter: 45802 (0.0694); expected (0.02) +Residues passing Vit filter: 3544 (0.00537); expected (0.003) +Residues passing Fwd filter: 1934 (0.00293); expected (3e-05) +Total number of hits: 5 (0.000405) +# CPU time: 0.06u 0.00s 00:00:00.06 Elapsed: 00:00:00.05 +# Mc/sec: 1056.00 +// +[ok]