diff test-data/MADE1.out @ 4:274d66a6368b draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
author iuc
date Mon, 11 Jun 2018 15:50:51 -0400
parents a20b2c7c5eee
children b4dc65565864
line wrap: on
line diff
--- a/test-data/MADE1.out	Sat Apr 07 03:48:26 2018 -0400
+++ b/test-data/MADE1.out	Mon Jun 11 15:50:51 2018 -0400
@@ -1,13 +1,13 @@
 # hmmscan :: search sequence(s) against a profile database
-# HMMER 3.1b2 (February 2015); http://hmmer.org/
-# Copyright (C) 2015 Howard Hughes Medical Institute.
-# Freely distributed under the GNU General Public License (GPLv3).
+# HMMER 3.2 (June 2018); http://hmmer.org/
+# Copyright (C) 2018 Howard Hughes Medical Institute.
+# Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpYWzicI/files/000/dataset_20.dat
-# target HMM database:             /tmp/tmpYWzicI/files/000/dataset_19.dat
-# per-seq hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_22.dat
-# per-dom hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_23.dat
-# pfam-style tabular hit output:   /tmp/tmpYWzicI/files/000/dataset_24.dat
+# query sequence file:             /tmp/tmpp4O0Ju/files/000/dataset_20.dat
+# target HMM database:             localref.hmm
+# per-seq hits tabular output:     /tmp/tmpp4O0Ju/files/000/dataset_22.dat
+# per-dom hits tabular output:     /tmp/tmpp4O0Ju/files/000/dataset_23.dat
+# pfam-style tabular hit output:   /tmp/tmpp4O0Ju/files/000/dataset_24.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
@@ -20,54 +20,54 @@
    --- full sequence ---   --- best 1 domain ---    -#dom-
     E-value  score  bias    E-value  score  bias    exp  N  Model    Description
     ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
-      1e-17   51.0  28.5    2.7e-12   33.7   0.7    9.6  5  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+    5.7e-18   51.8  27.9      2e-12   34.1   0.7    9.6  5  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
 
 
 Domain annotation for each model (and alignments):
 >> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
    #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
  ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
-   1 ?   -4.2   0.1         1         1      30      54 ..   80044   80068 ..   80030   80073 .. 0.80
+   1 ?   -4.5   0.0         1         1      30      54 ..   80044   80068 ..   80033   80072 .. 0.81
    2 ?   -6.6   3.3         1         1      13      71 ..  154012  154072 ..  154011  154076 .. 0.75
-   3 !   27.4   0.7   2.4e-10   2.4e-10       1      44 [.  174456  174514 ..  174456  174577 .. 0.62
-   4 !   33.7   0.7   2.7e-12   2.7e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.86
-   5 ?    2.9   0.7     0.011     0.011      27      75 ..  304060  304107 ..  304021  304109 .. 0.61
+   3 !   27.4   0.7   2.4e-10   2.4e-10       1      43 [.  174456  174498 ..  174456  174577 .. 0.66
+   4 !   34.1   0.7     2e-12     2e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.86
+   5 ?    2.8   0.7     0.011     0.011      27      75 ..  304060  304107 ..  304022  304109 .. 0.62
 
   Alignments for each domain:
-  == domain 1  score: -4.2 bits;  conditional E-value: 1
+  == domain 1  score: -4.5 bits;  conditional E-value: 1
                                       xxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1    30 ttgccattacttttaatggcaaaaa 54
+                          MADE1    30 ttgccattacttttaatggcaaaaa 54   
                                       t g catt  ttt aatggcaaa a
   humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
-                                      45789****************9966 PP
+                                      457899***************9865 PP
 
   == domain 2  score: -6.6 bits;  conditional E-value: 1
                                        xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71
+                          MADE1     13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71    
                                        aaaagta tt +   ttttgc att      a  tttaa  gcaaa a +    tta  tttgca
   humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
-                                       78999999999999999999999984444444457777777899998876....77777888876 PP
+                                       78999999999999999999999984444444457777777899988765....67777778776 PP
 
   == domain 3  score: 27.4 bits;  conditional E-value: 2.4e-10
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF
-                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44
-                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt               a
-  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514
-                                       79***************************************964443333333333330 PP
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
+                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
+  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
+                                       79**************************************996 PP
 
-  == domain 4  score: 33.7 bits;  conditional E-value: 2.7e-12
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80
-                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a  +  a t ctttt caccaa ctaa
-  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
-                                       56899******************************************963333233345578**************996 PP
+  == domain 4  score: 34.1 bits;  conditional E-value: 2e-12
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggca...aaaaccgcaattacttttgcaccaacctaa 80    
+                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    aaaa  g  a t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTtttAAAA--G-TAATGCTTTTACACCAATCTAA 302466
+                                       56899******************************************962223333..3.45578**************997 PP
 
-  == domain 5  score: 2.9 bits;  conditional E-value: 0.011
+  == domain 5  score: 2.8 bits;  conditional E-value: 0.011
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75
+                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75    
                                        tttt g c  ta  tt a tgg aaaaa ++ca tta ttttgca  aa
   humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107
-                                       222222222222.3455779************************98765 PP
+                                       222223222222.3556779************************98765 PP
 
 
 
@@ -81,7 +81,7 @@
 Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
 Initial search space (Z):                  1  [actual number of targets]
 Domain search space  (domZ):               1  [number of targets reported over threshold]
-# CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16
-# Mc/sec: 165.00
+# CPU time: 0.14u 0.01s 00:00:00.15 Elapsed: 00:00:00.14
+# Mc/sec: 177.58
 //
 [ok]