Mercurial > repos > iuc > hmmer_alimask
diff test-data/nhmmer.out @ 4:274d66a6368b draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
author | iuc |
---|---|
date | Mon, 11 Jun 2018 15:50:51 -0400 |
parents | a20b2c7c5eee |
children | b4dc65565864 |
line wrap: on
line diff
--- a/test-data/nhmmer.out Sat Apr 07 03:48:26 2018 -0400 +++ b/test-data/nhmmer.out Mon Jun 11 15:50:51 2018 -0400 @@ -1,11 +1,11 @@ -# nhmmer :: search a DNA model or alignment against a DNA database -# HMMER 3.1b2 (February 2015); http://hmmer.org/ -# Copyright (C) 2015 Howard Hughes Medical Institute. -# Freely distributed under the GNU General Public License (GPLv3). +# nhmmer :: search a DNA model, alignment, or sequence against a DNA database +# HMMER 3.2 (June 2018); http://hmmer.org/ +# Copyright (C) 2018 Howard Hughes Medical Institute. +# Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query file: /tmp/tmpprnvgs/files/000/dataset_1.dat -# target sequence database: /tmp/tmpprnvgs/files/000/dataset_2.dat -# hits tabular output: /tmp/tmpprnvgs/files/000/dataset_4.dat +# query file: /tmp/tmpp4O0Ju/files/000/dataset_36.dat +# target sequence database: /tmp/tmpp4O0Ju/files/000/dataset_37.dat +# hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_39.dat # hits output in Dfam format: None # max ASCII text line length: unlimited # SSV filter P threshold: <= 0.02 @@ -22,35 +22,35 @@ Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- - 1.2e-10 38.6 7.4 humanchr1/239220001-239550000 302390 302466 - 7.8e-08 29.6 8.3 humanchr1/239220001-239550000 174456 174498 - 1.2e-07 28.9 6.0 humanchr1/239220001-239550000 302466 302390 - 7.2e-06 23.3 7.0 humanchr1/239220001-239550000 174493 174456 + 8.7e-11 39.2 7.4 humanchr1/239220001-239550000 302390 302466 + 6.4e-08 30.0 8.3 humanchr1/239220001-239550000 174456 174498 + 9.3e-08 29.5 6.1 humanchr1/239220001-239550000 302466 302390 + 6.3e-06 23.7 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ - 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104 + 1.4 6.5 7.0 humanchr1/239220001-239550000 304073 304104 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 + ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 Alignment: - score: 38.6 bits + score: 39.2 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 - ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa - humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 - 899******************************************955533.443..334.4689***********99986 PP + ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466 + 899******************************************955533.443..33.44689************9986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 + ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 Alignment: - score: 29.6 bits + score: 30.0 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt @@ -60,36 +60,36 @@ >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 + ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 Alignment: - score: 28.9 bits + score: 29.5 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 - 68999999999999998................5666777776222222222222222268****************************9998 PP + 68999999999999998................4666777765222222222222222268****************************9998 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 + ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 Alignment: - score: 23.3 bits + score: 23.7 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 - 689********************************985 PP + 689********************************986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 + ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 Alignment: - score: 6.3 bits + score: 6.5 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 tt a tgg aaaaa ca tta ttttgca @@ -100,14 +100,14 @@ Internal pipeline statistics summary: ------------------------------------- -Query model(s): 1 (80 nodes) -Target sequences: 1 (660000 residues searched) -Residues passing SSV filter: 61794 (0.0936); expected (0.02) -Residues passing bias filter: 46199 (0.07); expected (0.02) -Residues passing Vit filter: 2752 (0.00417); expected (0.001) -Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) -Total number of hits: 5 (0.000405) -# CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03 -# Mc/sec: 1760.00 +Query model(s): 1 (80 nodes) +Target sequences: 1 (660000 residues searched) +Residues passing SSV filter: 63737 (0.0966); expected (0.02) +Residues passing bias filter: 44695 (0.0677); expected (0.02) +Residues passing Vit filter: 2309 (0.0035); expected (0.001) +Residues passing Fwd filter: 2041 (0.00309); expected (1e-05) +Total number of hits: 5 (0.000405) +# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 +# Mc/sec: 1854.66 // [ok]