diff test-data/nhmmer.out @ 5:b4dc65565864 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
author iuc
date Tue, 16 Jun 2020 05:37:27 -0400
parents 274d66a6368b
children 80c713789d13
line wrap: on
line diff
--- a/test-data/nhmmer.out	Mon Jun 11 15:50:51 2018 -0400
+++ b/test-data/nhmmer.out	Tue Jun 16 05:37:27 2020 -0400
@@ -1,12 +1,13 @@
 # nhmmer :: search a DNA model, alignment, or sequence against a DNA database
-# HMMER 3.2 (June 2018); http://hmmer.org/
-# Copyright (C) 2018 Howard Hughes Medical Institute.
+# HMMER 3.3 (Nov 2019); http://hmmer.org/
+# Copyright (C) 2019 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query file:                      /tmp/tmpp4O0Ju/files/000/dataset_36.dat
-# target sequence database:        /tmp/tmpp4O0Ju/files/000/dataset_37.dat
-# hits tabular output:             /tmp/tmpp4O0Ju/files/000/dataset_39.dat
-# hits output in Dfam format:      None
+# query file:                      /tmp/tmpqydies2m/files/c/4/e/dataset_c4e67f40-cb86-438e-8bc0-6020ada9fc86.dat
+# target sequence database:        /tmp/tmpqydies2m/files/a/1/b/dataset_a1b4364c-0e9a-4709-b4ef-ab7e5661d9e9.dat
+# hits tabular output:             /tmp/tmpqydies2m/files/b/d/d/dataset_bdd87d82-1ce1-4051-8d5f-f7251bf7fd18.dat
+# hits output in Dfam format:      /tmp/tmpqydies2m/files/d/8/e/dataset_d8ee0d50-d171-4e8a-9c7d-1cbd4394296f.dat
+# alignment scores output:         /tmp/tmpqydies2m/files/5/1/3/dataset_5139892f-c507-40c4-b43d-f73023c634f4.dat
 # max ASCII text line length:      unlimited
 # SSV filter P threshold:       <= 0.02
 # Vit filter P threshold:       <= 0.001
@@ -22,79 +23,79 @@
 Scores for complete hits:
     E-value  score  bias  Sequence                       start    end  Description
     ------- ------ -----  --------                       -----  -----  -----------
-    8.7e-11   39.2   7.4  humanchr1/239220001-239550000 302390 302466 
-    6.4e-08   30.0   8.3  humanchr1/239220001-239550000 174456 174498 
-    9.3e-08   29.5   6.1  humanchr1/239220001-239550000 302466 302390 
-    6.3e-06   23.7   7.0  humanchr1/239220001-239550000 174493 174456 
+      4e-11   41.3   7.5  humanchr1/239220001-239550000 302390 302466 
+    1.9e-08   32.8   8.3  humanchr1/239220001-239550000 174456 174498 
+    6.3e-08   31.0   6.7  humanchr1/239220001-239550000 302466 302389 
+    4.9e-06   25.0   7.0  humanchr1/239220001-239550000 174493 174456 
   ------ inclusion threshold ------
-        1.4    6.5   7.0  humanchr1/239220001-239550000 304073 304104 
+        2.2    6.9   7.2  humanchr1/239220001-239550000 304073 304103 
 
 
 Annotation for each hit  (and alignments):
 >> humanchr1/239220001-239550000  
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   39.2   7.4   8.7e-11         4        80 .]    302390    302466 ..    302387    302466 ..    330000    0.87
+ !   41.3   7.5     4e-11         4        80 .]    302390    302466 ..    302387    302466 ..    330000    0.88
 
   Alignment:
-  score: 39.2 bits
+  score: 41.3 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80    
-                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    a aaa  g  a t ctttt caccaa ctaa
-  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466
-                                       899******************************************955533.443..33.44689************9986 PP
+                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    aaaa   g  a t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466
+                                       89*******************************************966644554...34.4578**************997 PP
 
 >> humanchr1/239220001-239550000  
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   30.0   8.3   6.4e-08         1        43 [.    174456    174498 ..    174456    174518 ..    330000    0.92
+ !   32.8   8.3   1.9e-08         1        43 [.    174456    174498 ..    174456    174518 ..    330000    0.91
 
   Alignment:
-  score: 30.0 bits
+  score: 32.8 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
                                        ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
   humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
-                                       589************************************9975 PP
+                                       589************************************9986 PP
 
 >> humanchr1/239220001-239550000  
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   29.5   6.1   9.3e-08         1        77 [.    302466    302390 ..    302466    302387 ..    330000    0.74
+ !   31.0   6.7   6.3e-08         1        78 [.    302466    302389 ..    302466    302387 ..    330000    0.80
 
   Alignment:
-  score: 29.5 bits
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77    
-                                       ttag ttggtg aaaag                cattactttt                aatggcaaaaacc caatt  ttttgcacc acc
-  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
-                                       68999999999999998................4666777765222222222222222268****************************9998 PP
+  score: 31.0 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78    
+                                       ttag ttggtg aaaag a t      tttt    gc atta    +aatggcaaaaacc caatt  ttttgcacc acc 
+  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389
+                                       6899************97543.2...23333455566666666666799*****************************9985 PP
 
 >> humanchr1/239220001-239550000  
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- !   23.7   7.0   6.3e-06        43        80 .]    174493    174456 ..    174513    174456 ..    330000    0.91
+ !   25.0   7.0   4.9e-06        43        80 .]    174493    174456 ..    174513    174456 ..    330000    0.94
 
   Alignment:
-  score: 23.7 bits
+  score: 25.0 bits
                                        xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                           MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80    
                                        taatg caaaaacc caattacttttgcac aacctaa
   humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
-                                       689********************************986 PP
+                                       5899*******************************986 PP
 
 >> humanchr1/239220001-239550000  
     score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
    ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
- ?    6.5   7.0       1.4        41        72 ..    304073    304104 ..    304053    304109 ..    330000    0.85
+ ?    6.9   7.2       2.2        41        71 ..    304073    304103 ..    304053    304109 ..    330000    0.85
 
   Alignment:
-  score: 6.5 bits
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     41 tttaatggcaaaaaccgcaattacttttgcac 72    
-                                       tt a tgg aaaaa   ca tta ttttgca 
-  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
-                                       455779************************86 PP
+  score: 6.9 bits
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     41 tttaatggcaaaaaccgcaattacttttgca 71    
+                                       tt a tgg aaaaa   ca tta ttttgca
+  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103
+                                       456789************************8 PP
 
 
 
@@ -102,12 +103,12 @@
 -------------------------------------
 Query model(s):                            1  (80 nodes)
 Target sequences:                          1  (660000 residues searched)
-Residues passing SSV filter:           63737  (0.0966); expected (0.02)
-Residues passing bias filter:          44695  (0.0677); expected (0.02)
-Residues passing Vit filter:            2309  (0.0035); expected (0.001)
-Residues passing Fwd filter:            2041  (0.00309); expected (1e-05)
+Residues passing SSV filter:           60770  (0.0921); expected (0.02)
+Residues passing bias filter:          35792  (0.0542); expected (0.02)
+Residues passing Vit filter:            1612  (0.00244); expected (0.001)
+Residues passing Fwd filter:            1194  (0.00181); expected (1e-05)
 Total number of hits:                      5  (0.000405)
-# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
-# Mc/sec: 1854.66
+# CPU time: 0.04u 0.00s 00:00:00.04 Elapsed: 00:00:00.05
+# Mc/sec: 1031.54
 //
 [ok]