Mercurial > repos > iuc > hmmer_hmmbuild
comparison test-data/MADE1.nhmmscan_out @ 3:7ea31fc35394 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
author | iuc |
---|---|
date | Sat, 07 Apr 2018 03:51:18 -0400 |
parents | |
children | d0875d3f6544 |
comparison
equal
deleted
inserted
replaced
2:691cd6c40568 | 3:7ea31fc35394 |
---|---|
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database | |
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/ | |
3 # Copyright (C) 2015 Howard Hughes Medical Institute. | |
4 # Freely distributed under the GNU General Public License (GPLv3). | |
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | |
6 # query sequence file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat | |
7 # target HMM database: /tmp/tmpc_c3amjg/files/000/dataset_1.dat | |
8 # per-seq hits tabular output: /tmp/tmpc_c3amjg/files/000/dataset_4.dat | |
9 # hits output in Dfam format: /tmp/tmpc_c3amjg/files/000/dataset_5.dat | |
10 # max ASCII text line length: unlimited | |
11 # Vit filter P threshold: <= 0.001 | |
12 # Fwd filter P threshold: <= 1e-05 | |
13 # random number seed set to: 4 | |
14 # number of worker threads: 1 | |
15 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | |
16 | |
17 Query: humanchr1/239220001-239550000 [L=330000] | |
18 Scores for complete hit: | |
19 E-value score bias Model start end Description | |
20 ------- ------ ----- -------- ----- ----- ----------- | |
21 1.2e-10 38.6 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
22 7.8e-08 29.6 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
23 1.2e-07 28.9 6.0 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
24 7.2e-06 23.3 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
25 ------ inclusion threshold ------ | |
26 1.4 6.3 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
27 | |
28 | |
29 Annotation for each hit (and alignments): | |
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | |
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | |
33 ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 | |
34 | |
35 Alignment: | |
36 score: 38.6 bits | |
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 | |
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa | |
40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 | |
41 899******************************************955533.443..334.4689***********99986 PP | |
42 | |
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | |
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | |
46 ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 | |
47 | |
48 Alignment: | |
49 score: 29.6 bits | |
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 | |
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt | |
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 | |
54 589************************************9975 PP | |
55 | |
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | |
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | |
59 ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 | |
60 | |
61 Alignment: | |
62 score: 28.9 bits | |
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
64 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 | |
65 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc | |
66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 | |
67 68999999999999998................5666777776222222222222222268****************************9998 PP | |
68 | |
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | |
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | |
72 ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 | |
73 | |
74 Alignment: | |
75 score: 23.3 bits | |
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 | |
78 taatg caaaaacc caattacttttgcac aacctaa | |
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 | |
80 689********************************985 PP | |
81 | |
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc | |
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- | |
85 ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 | |
86 | |
87 Alignment: | |
88 score: 6.3 bits | |
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 | |
91 tt a tgg aaaaa ca tta ttttgca | |
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 | |
93 455779************************86 PP | |
94 | |
95 | |
96 | |
97 Internal pipeline statistics summary: | |
98 ------------------------------------- | |
99 Query sequence(s): 1 (660000 residues searched) | |
100 Target model(s): 1 (80 nodes) | |
101 Residues passing SSV filter: 61794 (0.0936); expected (0.02) | |
102 Residues passing bias filter: 46199 (0.07); expected (0.02) | |
103 Residues passing Vit filter: 2752 (0.00417); expected (0.001) | |
104 Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) | |
105 Total number of hits: 5 (0.000405) | |
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 | |
107 # Mc/sec: 2640.00 | |
108 // | |
109 [ok] |