Mercurial > repos > iuc > hmmer_hmmconvert

comparison test-data/MADE1.nhmmscan_out @ 4:f92edeb5e4c4 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
author iuc
date Mon, 11 Jun 2018 15:52:53 -0400
parents b03487ad64c8
children 8d5ec58d2172
comparison
equal deleted inserted replaced
3:b03487ad64c8 4:f92edeb5e4c4
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database 1 # nhmmscan :: search DNA sequence(s) against a DNA profile database
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/ 2 # HMMER 3.2 (June 2018); http://hmmer.org/
3 # Copyright (C) 2015 Howard Hughes Medical Institute. 3 # Copyright (C) 2018 Howard Hughes Medical Institute.
4 # Freely distributed under the GNU General Public License (GPLv3). 4 # Freely distributed under the BSD open source license.
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query sequence file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat 6 # query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_41.dat
7 # target HMM database: /tmp/tmpc_c3amjg/files/000/dataset_1.dat 7 # target HMM database: localref.hmm
8 # per-seq hits tabular output: /tmp/tmpc_c3amjg/files/000/dataset_4.dat 8 # per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_43.dat
9 # hits output in Dfam format: /tmp/tmpc_c3amjg/files/000/dataset_5.dat 9 # hits output in Dfam format: /tmp/tmpp4O0Ju/files/000/dataset_44.dat
10 # max ASCII text line length: unlimited 10 # max ASCII text line length: unlimited
11 # Vit filter P threshold: <= 0.001 11 # Vit filter P threshold: <= 0.001
12 # Fwd filter P threshold: <= 1e-05 12 # Fwd filter P threshold: <= 1e-05
13 # random number seed set to: 4 13 # random number seed set to: 4
14 # number of worker threads: 1 14 # number of worker threads: 1
16 16
17 Query: humanchr1/239220001-239550000 [L=330000] 17 Query: humanchr1/239220001-239550000 [L=330000]
18 Scores for complete hit: 18 Scores for complete hit:
19 E-value score bias Model start end Description 19 E-value score bias Model start end Description
20 ------- ------ ----- -------- ----- ----- ----------- 20 ------- ------ ----- -------- ----- ----- -----------
21 1.2e-10 38.6 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 21 8.7e-11 39.2 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
22 7.8e-08 29.6 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 22 6.4e-08 30.0 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
23 1.2e-07 28.9 6.0 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 23 9.3e-08 29.5 6.1 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
24 7.2e-06 23.3 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 24 6.3e-06 23.7 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
25 ------ inclusion threshold ------ 25 ------ inclusion threshold ------
26 1.4 6.3 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 26 1.4 6.5 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
27 27
28 28
29 Annotation for each hit (and alignments): 29 Annotation for each hit (and alignments):
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc 31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
33 ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 33 ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87
34 34
35 Alignment: 35 Alignment:
36 score: 38.6 bits 36 score: 39.2 bits
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa 39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa
40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466
41 899******************************************955533.443..334.4689***********99986 PP 41 899******************************************955533.443..33.44689************9986 PP
42 42
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc 44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
46 ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 46 ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92
47 47
48 Alignment: 48 Alignment:
49 score: 29.6 bits 49 score: 30.0 bits
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt 52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
54 589************************************9975 PP 54 589************************************9975 PP
55 55
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc 57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
59 ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 59 ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74
60 60
61 Alignment: 61 Alignment:
62 score: 28.9 bits 62 score: 29.5 bits
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
64 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 64 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77
65 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc 65 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc
66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
67 68999999999999998................5666777776222222222222222268****************************9998 PP 67 68999999999999998................4666777765222222222222222268****************************9998 PP
68 68
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc 70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
72 ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 72 ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91
73 73
74 Alignment: 74 Alignment:
75 score: 23.3 bits 75 score: 23.7 bits
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
78 taatg caaaaacc caattacttttgcac aacctaa 78 taatg caaaaacc caattacttttgcac aacctaa
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
80 689********************************985 PP 80 689********************************986 PP
81 81
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc 83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- 84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
85 ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 85 ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85
86 86
87 Alignment: 87 Alignment:
88 score: 6.3 bits 88 score: 6.5 bits
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 90 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72
91 tt a tgg aaaaa ca tta ttttgca 91 tt a tgg aaaaa ca tta ttttgca
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
93 455779************************86 PP 93 455779************************86 PP
96 96
97 Internal pipeline statistics summary: 97 Internal pipeline statistics summary:
98 ------------------------------------- 98 -------------------------------------
99 Query sequence(s): 1 (660000 residues searched) 99 Query sequence(s): 1 (660000 residues searched)
100 Target model(s): 1 (80 nodes) 100 Target model(s): 1 (80 nodes)
101 Residues passing SSV filter: 61794 (0.0936); expected (0.02) 101 Residues passing SSV filter: 63737 (0.0966); expected (0.02)
102 Residues passing bias filter: 46199 (0.07); expected (0.02) 102 Residues passing bias filter: 44695 (0.0677); expected (0.02)
103 Residues passing Vit filter: 2752 (0.00417); expected (0.001) 103 Residues passing Vit filter: 2309 (0.0035); expected (0.001)
104 Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) 104 Residues passing Fwd filter: 2041 (0.00309); expected (1e-05)
105 Total number of hits: 5 (0.000405) 105 Total number of hits: 5 (0.000405)
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
107 # Mc/sec: 2640.00 107 # Mc/sec: 2407.09
108 // 108 //
109 [ok] 109 [ok]