Mercurial > repos > iuc > hmmer_hmmemit
diff test-data/nhmmer.out @ 5:9415f29a3926 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
| author | iuc |
|---|---|
| date | Tue, 16 Jun 2020 05:27:39 -0400 |
| parents | 1cd4d0cf8fd9 |
| children | 96b127c59e6a |
line wrap: on
line diff
--- a/test-data/nhmmer.out Mon Jun 11 15:51:54 2018 -0400 +++ b/test-data/nhmmer.out Tue Jun 16 05:27:39 2020 -0400 @@ -1,12 +1,13 @@ # nhmmer :: search a DNA model, alignment, or sequence against a DNA database -# HMMER 3.2 (June 2018); http://hmmer.org/ -# Copyright (C) 2018 Howard Hughes Medical Institute. +# HMMER 3.3 (Nov 2019); http://hmmer.org/ +# Copyright (C) 2019 Howard Hughes Medical Institute. # Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query file: /tmp/tmpp4O0Ju/files/000/dataset_36.dat -# target sequence database: /tmp/tmpp4O0Ju/files/000/dataset_37.dat -# hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_39.dat -# hits output in Dfam format: None +# query file: /tmp/tmpqydies2m/files/c/4/e/dataset_c4e67f40-cb86-438e-8bc0-6020ada9fc86.dat +# target sequence database: /tmp/tmpqydies2m/files/a/1/b/dataset_a1b4364c-0e9a-4709-b4ef-ab7e5661d9e9.dat +# hits tabular output: /tmp/tmpqydies2m/files/b/d/d/dataset_bdd87d82-1ce1-4051-8d5f-f7251bf7fd18.dat +# hits output in Dfam format: /tmp/tmpqydies2m/files/d/8/e/dataset_d8ee0d50-d171-4e8a-9c7d-1cbd4394296f.dat +# alignment scores output: /tmp/tmpqydies2m/files/5/1/3/dataset_5139892f-c507-40c4-b43d-f73023c634f4.dat # max ASCII text line length: unlimited # SSV filter P threshold: <= 0.02 # Vit filter P threshold: <= 0.001 @@ -22,79 +23,79 @@ Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- - 8.7e-11 39.2 7.4 humanchr1/239220001-239550000 302390 302466 - 6.4e-08 30.0 8.3 humanchr1/239220001-239550000 174456 174498 - 9.3e-08 29.5 6.1 humanchr1/239220001-239550000 302466 302390 - 6.3e-06 23.7 7.0 humanchr1/239220001-239550000 174493 174456 + 4e-11 41.3 7.5 humanchr1/239220001-239550000 302390 302466 + 1.9e-08 32.8 8.3 humanchr1/239220001-239550000 174456 174498 + 6.3e-08 31.0 6.7 humanchr1/239220001-239550000 302466 302389 + 4.9e-06 25.0 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ - 1.4 6.5 7.0 humanchr1/239220001-239550000 304073 304104 + 2.2 6.9 7.2 humanchr1/239220001-239550000 304073 304103 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 39.2 7.4 8.7e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 + ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.88 Alignment: - score: 39.2 bits + score: 41.3 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 - ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa - humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GT-AATGCTTTTACACCAATCTAA 302466 - 899******************************************955533.443..33.44689************9986 PP + ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466 + 89*******************************************966644554...34.4578**************997 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 30.0 8.3 6.4e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 + ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.91 Alignment: - score: 30.0 bits + score: 32.8 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 - 589************************************9975 PP + 589************************************9986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 29.5 6.1 9.3e-08 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 + ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 330000 0.80 Alignment: - score: 29.5 bits - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 - ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc - humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 - 68999999999999998................4666777765222222222222222268****************************9998 PP + score: 31.0 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78 + ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc + humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389 + 6899************97543.2...23333455566666666666799*****************************9985 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ! 23.7 7.0 6.3e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 + ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.94 Alignment: - score: 23.7 bits + score: 25.0 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 - 689********************************986 PP + 5899*******************************986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- - ? 6.5 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 + ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 330000 0.85 Alignment: - score: 6.5 bits - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 - tt a tgg aaaaa ca tta ttttgca - humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 - 455779************************86 PP + score: 6.9 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71 + tt a tgg aaaaa ca tta ttttgca + humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103 + 456789************************8 PP @@ -102,12 +103,12 @@ ------------------------------------- Query model(s): 1 (80 nodes) Target sequences: 1 (660000 residues searched) -Residues passing SSV filter: 63737 (0.0966); expected (0.02) -Residues passing bias filter: 44695 (0.0677); expected (0.02) -Residues passing Vit filter: 2309 (0.0035); expected (0.001) -Residues passing Fwd filter: 2041 (0.00309); expected (1e-05) +Residues passing SSV filter: 60770 (0.0921); expected (0.02) +Residues passing bias filter: 35792 (0.0542); expected (0.02) +Residues passing Vit filter: 1612 (0.00244); expected (0.001) +Residues passing Fwd filter: 1194 (0.00181); expected (1e-05) Total number of hits: 5 (0.000405) -# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 -# Mc/sec: 1854.66 +# CPU time: 0.04u 0.00s 00:00:00.04 Elapsed: 00:00:00.05 +# Mc/sec: 1031.54 // [ok]