Mercurial > repos > iuc > hmmer_hmmfetch
comparison test-data/MADE1.out @ 0:1d78de693262 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
author | iuc |
---|---|
date | Sat, 25 Jun 2016 15:05:58 -0400 (2016-06-25) |
parents | |
children | 74089c182a50 |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:1d78de693262 |
---|---|
1 # hmmscan :: search sequence(s) against a profile database | |
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/ | |
3 # Copyright (C) 2015 Howard Hughes Medical Institute. | |
4 # Freely distributed under the GNU General Public License (GPLv3). | |
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | |
6 # query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat | |
7 # target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat | |
8 # per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat | |
9 # per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat | |
10 # pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat | |
11 # max ASCII text line length: unlimited | |
12 # Vit filter P threshold: <= 0.001 | |
13 # Fwd filter P threshold: <= 1e-05 | |
14 # random number seed set to: 4 | |
15 # number of worker threads: 1 | |
16 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - | |
17 | |
18 Query: humanchr1/239220001-239550000 [L=330000] | |
19 Scores for complete sequence (score includes all domains): | |
20 --- full sequence --- --- best 1 domain --- -#dom- | |
21 E-value score bias E-value score bias exp N Model Description | |
22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- | |
23 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
24 | |
25 | |
26 Domain annotation for each model (and alignments): | |
27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon | |
28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc | |
29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- | |
30 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 | |
31 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 | |
32 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 | |
33 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 | |
34 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 | |
35 | |
36 Alignments for each domain: | |
37 == domain 1 score: -4.2 bits; conditional E-value: 1 | |
38 xxxxxxxxxxxxxxxxxxxxxxxxx RF | |
39 MADE1 30 ttgccattacttttaatggcaaaaa 54 | |
40 t g catt ttt aatggcaaa a | |
41 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 | |
42 45789****************9966 PP | |
43 | |
44 == domain 2 score: -6.6 bits; conditional E-value: 1 | |
45 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
46 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 | |
47 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca | |
48 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 | |
49 78999999999999999999999984444444457777777899998876....77777888876 PP | |
50 | |
51 == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 | |
52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF | |
53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 | |
54 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a | |
55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 | |
56 79***************************************964443333333333330 PP | |
57 | |
58 == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12 | |
59 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
60 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 | |
61 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa | |
62 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 | |
63 56899******************************************963333233345578**************996 PP | |
64 | |
65 == domain 5 score: 2.9 bits; conditional E-value: 0.011 | |
66 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF | |
67 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 | |
68 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa | |
69 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 | |
70 222222222222.3455779************************98765 PP | |
71 | |
72 | |
73 | |
74 Internal pipeline statistics summary: | |
75 ------------------------------------- | |
76 Query sequence(s): 1 (330000 residues searched) | |
77 Target model(s): 1 (80 nodes) | |
78 Passed MSV filter: 1 (1); expected 0.0 (0.02) | |
79 Passed bias filter: 1 (1); expected 0.0 (0.02) | |
80 Passed Vit filter: 1 (1); expected 0.0 (0.001) | |
81 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) | |
82 Initial search space (Z): 1 [actual number of targets] | |
83 Domain search space (domZ): 1 [number of targets reported over threshold] | |
84 # CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16 | |
85 # Mc/sec: 165.00 | |
86 // | |
87 [ok] |