comparison test-data/MADE1.out @ 4:74089c182a50 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
author iuc
date Mon, 11 Jun 2018 15:52:28 -0400
parents 1d78de693262
children fb459c8fb2ba
comparison
equal deleted inserted replaced
3:cd078bda9921 4:74089c182a50
1 # hmmscan :: search sequence(s) against a profile database 1 # hmmscan :: search sequence(s) against a profile database
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/ 2 # HMMER 3.2 (June 2018); http://hmmer.org/
3 # Copyright (C) 2015 Howard Hughes Medical Institute. 3 # Copyright (C) 2018 Howard Hughes Medical Institute.
4 # Freely distributed under the GNU General Public License (GPLv3). 4 # Freely distributed under the BSD open source license.
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat 6 # query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_20.dat
7 # target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat 7 # target HMM database: localref.hmm
8 # per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat 8 # per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_22.dat
9 # per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat 9 # per-dom hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_23.dat
10 # pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat 10 # pfam-style tabular hit output: /tmp/tmpp4O0Ju/files/000/dataset_24.dat
11 # max ASCII text line length: unlimited 11 # max ASCII text line length: unlimited
12 # Vit filter P threshold: <= 0.001 12 # Vit filter P threshold: <= 0.001
13 # Fwd filter P threshold: <= 1e-05 13 # Fwd filter P threshold: <= 1e-05
14 # random number seed set to: 4 14 # random number seed set to: 4
15 # number of worker threads: 1 15 # number of worker threads: 1
18 Query: humanchr1/239220001-239550000 [L=330000] 18 Query: humanchr1/239220001-239550000 [L=330000]
19 Scores for complete sequence (score includes all domains): 19 Scores for complete sequence (score includes all domains):
20 --- full sequence --- --- best 1 domain --- -#dom- 20 --- full sequence --- --- best 1 domain --- -#dom-
21 E-value score bias E-value score bias exp N Model Description 21 E-value score bias E-value score bias exp N Model Description
22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- 22 ------- ------ ----- ------- ------ ----- ---- -- -------- -----------
23 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 23 5.7e-18 51.8 27.9 2e-12 34.1 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
24 24
25 25
26 Domain annotation for each model (and alignments): 26 Domain annotation for each model (and alignments):
27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc 28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc
29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- 29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ----
30 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 30 1 ? -4.5 0.0 1 1 30 54 .. 80044 80068 .. 80033 80072 .. 0.81
31 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 31 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75
32 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 32 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174577 .. 0.66
33 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 33 4 ! 34.1 0.7 2e-12 2e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86
34 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 34 5 ? 2.8 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304022 304109 .. 0.62
35 35
36 Alignments for each domain: 36 Alignments for each domain:
37 == domain 1 score: -4.2 bits; conditional E-value: 1 37 == domain 1 score: -4.5 bits; conditional E-value: 1
38 xxxxxxxxxxxxxxxxxxxxxxxxx RF 38 xxxxxxxxxxxxxxxxxxxxxxxxx RF
39 MADE1 30 ttgccattacttttaatggcaaaaa 54 39 MADE1 30 ttgccattacttttaatggcaaaaa 54
40 t g catt ttt aatggcaaa a 40 t g catt ttt aatggcaaa a
41 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 41 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
42 45789****************9966 PP 42 457899***************9865 PP
43 43
44 == domain 2 score: -6.6 bits; conditional E-value: 1 44 == domain 2 score: -6.6 bits; conditional E-value: 1
45 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 45 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
46 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 46 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71
47 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca 47 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca
48 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 48 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
49 78999999999999999999999984444444457777777899998876....77777888876 PP 49 78999999999999999999999984444444457777777899988765....67777778776 PP
50 50
51 == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 51 == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10
52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF 52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
54 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a 54 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
56 79***************************************964443333333333330 PP 56 79**************************************996 PP
57 57
58 == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12 58 == domain 4 score: 34.1 bits; conditional E-value: 2e-12
59 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 59 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
60 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 60 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggca...aaaaccgcaattacttttgcaccaacctaa 80
61 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa 61 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa
62 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 62 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTtttAAAA--G-TAATGCTTTTACACCAATCTAA 302466
63 56899******************************************963333233345578**************996 PP 63 56899******************************************962223333..3.45578**************997 PP
64 64
65 == domain 5 score: 2.9 bits; conditional E-value: 0.011 65 == domain 5 score: 2.8 bits; conditional E-value: 0.011
66 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 66 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
67 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 67 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75
68 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa 68 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa
69 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 69 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107
70 222222222222.3455779************************98765 PP 70 222223222222.3556779************************98765 PP
71 71
72 72
73 73
74 Internal pipeline statistics summary: 74 Internal pipeline statistics summary:
75 ------------------------------------- 75 -------------------------------------
79 Passed bias filter: 1 (1); expected 0.0 (0.02) 79 Passed bias filter: 1 (1); expected 0.0 (0.02)
80 Passed Vit filter: 1 (1); expected 0.0 (0.001) 80 Passed Vit filter: 1 (1); expected 0.0 (0.001)
81 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) 81 Passed Fwd filter: 1 (1); expected 0.0 (1e-05)
82 Initial search space (Z): 1 [actual number of targets] 82 Initial search space (Z): 1 [actual number of targets]
83 Domain search space (domZ): 1 [number of targets reported over threshold] 83 Domain search space (domZ): 1 [number of targets reported over threshold]
84 # CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16 84 # CPU time: 0.14u 0.01s 00:00:00.15 Elapsed: 00:00:00.14
85 # Mc/sec: 165.00 85 # Mc/sec: 177.58
86 // 86 //
87 [ok] 87 [ok]