Mercurial > repos > iuc > hmmer_hmmfetch

comparison test-data/MADE1.out @ 5:fb459c8fb2ba draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
author iuc
date Tue, 16 Jun 2020 05:37:02 -0400
parents 74089c182a50
children a28fd001de59
comparison
equal deleted inserted replaced
4:74089c182a50 5:fb459c8fb2ba
1 # hmmscan :: search sequence(s) against a profile database 1 # hmmscan :: search sequence(s) against a profile database
2 # HMMER 3.2 (June 2018); http://hmmer.org/ 2 # HMMER 3.3 (Nov 2019); http://hmmer.org/
3 # Copyright (C) 2018 Howard Hughes Medical Institute. 3 # Copyright (C) 2019 Howard Hughes Medical Institute.
4 # Freely distributed under the BSD open source license. 4 # Freely distributed under the BSD open source license.
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_20.dat 6 # query sequence file: /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
7 # target HMM database: localref.hmm 7 # target HMM database: localref.hmm
8 # per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_22.dat 8 # per-seq hits tabular output: /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat
9 # per-dom hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_23.dat 9 # per-dom hits tabular output: /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat
10 # pfam-style tabular hit output: /tmp/tmpp4O0Ju/files/000/dataset_24.dat 10 # pfam-style tabular hit output: /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat
11 # max ASCII text line length: unlimited 11 # max ASCII text line length: unlimited
12 # Vit filter P threshold: <= 0.001 12 # Vit filter P threshold: <= 0.001
13 # Fwd filter P threshold: <= 1e-05 13 # Fwd filter P threshold: <= 1e-05
14 # random number seed set to: 4 14 # random number seed set to: 4
15 # number of worker threads: 1 15 # number of worker threads: 1
18 Query: humanchr1/239220001-239550000 [L=330000] 18 Query: humanchr1/239220001-239550000 [L=330000]
19 Scores for complete sequence (score includes all domains): 19 Scores for complete sequence (score includes all domains):
20 --- full sequence --- --- best 1 domain --- -#dom- 20 --- full sequence --- --- best 1 domain --- -#dom-
21 E-value score bias E-value score bias exp N Model Description 21 E-value score bias E-value score bias exp N Model Description
22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- 22 ------- ------ ----- ------- ------ ----- ---- -- -------- -----------
23 5.7e-18 51.8 27.9 2e-12 34.1 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 23 9.3e-18 51.2 26.3 1.3e-12 34.8 0.7 8.6 4 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
24 24
25 25
26 Domain annotation for each model (and alignments): 26 Domain annotation for each model (and alignments):
27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc 28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc
29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- 29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ----
30 1 ? -4.5 0.0 1 1 30 54 .. 80044 80068 .. 80033 80072 .. 0.81 30 1 ! 27.4 0.6 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174520 .. 0.93
31 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 31 2 ? -8.4 5.8 1 1 12 79 .. 197274 197341 .. 197272 197342 .. 0.86
32 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174577 .. 0.66 32 3 ! 34.8 0.7 1.3e-12 1.3e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.87
33 4 ! 34.1 0.7 2e-12 2e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 33 4 ? 1.4 0.4 0.033 0.033 27 74 .. 304060 304106 .. 304029 304108 .. 0.71
34 5 ? 2.8 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304022 304109 .. 0.62
35 34
36 Alignments for each domain: 35 Alignments for each domain:
37 == domain 1 score: -4.5 bits; conditional E-value: 1 36 == domain 1 score: 27.4 bits; conditional E-value: 2.4e-10
38 xxxxxxxxxxxxxxxxxxxxxxxxx RF
39 MADE1 30 ttgccattacttttaatggcaaaaa 54
40 t g catt ttt aatggcaaa a
41 humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
42 457899***************9865 PP
43
44 == domain 2 score: -6.6 bits; conditional E-value: 1
45 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
46 MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71
47 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca
48 humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
49 78999999999999999999999984444444457777777899988765....67777778776 PP
50
51 == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10
52 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
53 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 38 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
54 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt 39 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
55 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 40 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
56 79**************************************996 PP 41 79**************************************997 PP
57 42
58 == domain 4 score: 34.1 bits; conditional E-value: 2e-12 43 == domain 2 score: -8.4 bits; conditional E-value: 1
59 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 44 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
60 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggca...aaaaccgcaattacttttgcaccaacctaa 80 45 MADE1 12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79
61 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa 46 caa gtaatt + tttt c att ttt t c aaa c c tta tt t ac a cta
62 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTtttAAAA--G-TAATGCTTTTACACCAATCTAA 302466 47 humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341
63 56899******************************************962223333..3.45578**************997 PP 48 567789*******************999999999999*****99999999999988877777776666 PP
64 49
65 == domain 5 score: 2.8 bits; conditional E-value: 0.011 50 == domain 3 score: 34.8 bits; conditional E-value: 1.3e-12
66 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF 51 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
67 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 52 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80
68 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa 53 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a a t ctttt caccaa ctaa
69 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 54 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
70 222223222222.3556779************************98765 PP 55 6799*****************************************99953333333345578**************997 PP
56
57 == domain 4 score: 1.4 bits; conditional E-value: 0.033
58 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
59 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74
60 tttt g c ta tt a tgg aaaaa + ca tta ttttgca a
61 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106
62 334444443333.356788*************************9766 PP
71 63
72 64
73 65
74 Internal pipeline statistics summary: 66 Internal pipeline statistics summary:
75 ------------------------------------- 67 -------------------------------------
79 Passed bias filter: 1 (1); expected 0.0 (0.02) 71 Passed bias filter: 1 (1); expected 0.0 (0.02)
80 Passed Vit filter: 1 (1); expected 0.0 (0.001) 72 Passed Vit filter: 1 (1); expected 0.0 (0.001)
81 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) 73 Passed Fwd filter: 1 (1); expected 0.0 (1e-05)
82 Initial search space (Z): 1 [actual number of targets] 74 Initial search space (Z): 1 [actual number of targets]
83 Domain search space (domZ): 1 [number of targets reported over threshold] 75 Domain search space (domZ): 1 [number of targets reported over threshold]
84 # CPU time: 0.14u 0.01s 00:00:00.15 Elapsed: 00:00:00.14 76 # CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22
85 # Mc/sec: 177.58 77 # Mc/sec: 117.29
86 // 78 //
87 [ok] 79 [ok]