Mercurial > repos > iuc > hmmer_hmmfetch
view test-data/MADE1.out @ 6:01c842e297f5 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit db615ae8a189ad988ec08090051a128355a4be70"
author | iuc |
---|---|
date | Thu, 14 Jan 2021 15:42:21 +0000 |
parents | fb459c8fb2ba |
children | a28fd001de59 |
line wrap: on
line source
# hmmscan :: search sequence(s) against a profile database # HMMER 3.3 (Nov 2019); http://hmmer.org/ # Copyright (C) 2019 Howard Hughes Medical Institute. # Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - # query sequence file: /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat # target HMM database: localref.hmm # per-seq hits tabular output: /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat # per-dom hits tabular output: /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat # pfam-style tabular hit output: /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat # max ASCII text line length: unlimited # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # random number seed set to: 4 # number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: humanchr1/239220001-239550000 [L=330000] Scores for complete sequence (score includes all domains): --- full sequence --- --- best 1 domain --- -#dom- E-value score bias E-value score bias exp N Model Description ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- 9.3e-18 51.2 26.3 1.3e-12 34.8 0.7 8.6 4 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Domain annotation for each model (and alignments): >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- 1 ! 27.4 0.6 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174520 .. 0.93 2 ? -8.4 5.8 1 1 12 79 .. 197274 197341 .. 197272 197342 .. 0.86 3 ! 34.8 0.7 1.3e-12 1.3e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.87 4 ? 1.4 0.4 0.033 0.033 27 74 .. 304060 304106 .. 304029 304108 .. 0.71 Alignments for each domain: == domain 1 score: 27.4 bits; conditional E-value: 2.4e-10 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 79**************************************997 PP == domain 2 score: -8.4 bits; conditional E-value: 1 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79 caa gtaatt + tttt c att ttt t c aaa c c tta tt t ac a cta humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341 567789*******************999999999999*****99999999999988877777776666 PP == domain 3 score: 34.8 bits; conditional E-value: 1.3e-12 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a a t ctttt caccaa ctaa humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 6799*****************************************99953333333345578**************997 PP == domain 4 score: 1.4 bits; conditional E-value: 0.033 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74 tttt g c ta tt a tgg aaaaa + ca tta ttttgca a humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106 334444443333.356788*************************9766 PP Internal pipeline statistics summary: ------------------------------------- Query sequence(s): 1 (330000 residues searched) Target model(s): 1 (80 nodes) Passed MSV filter: 1 (1); expected 0.0 (0.02) Passed bias filter: 1 (1); expected 0.0 (0.02) Passed Vit filter: 1 (1); expected 0.0 (0.001) Passed Fwd filter: 1 (1); expected 0.0 (1e-05) Initial search space (Z): 1 [actual number of targets] Domain search space (domZ): 1 [number of targets reported over threshold] # CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22 # Mc/sec: 117.29 // [ok]