Mercurial > repos > iuc > hmmer_hmmscan
view test-data/nhmmer.out @ 1:b49a4465041d draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 2c4b4a154e2f07730fdfdaf66a09e1e09ac5efde
| author | iuc |
|---|---|
| date | Mon, 14 Nov 2016 15:11:16 -0500 |
| parents | 216b19e6c317 |
| children | 01219a31c48e |
line wrap: on
line source
# nhmmer :: search a DNA model or alignment against a DNA database # HMMER 3.1b2 (February 2015); http://hmmer.org/ # Copyright (C) 2015 Howard Hughes Medical Institute. # Freely distributed under the GNU General Public License (GPLv3). # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - # query file: /tmp/tmpprnvgs/files/000/dataset_1.dat # target sequence database: /tmp/tmpprnvgs/files/000/dataset_2.dat # hits tabular output: /tmp/tmpprnvgs/files/000/dataset_4.dat # hits output in Dfam format: None # max ASCII text line length: unlimited # SSV filter P threshold: <= 0.02 # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # input query is asserted as: DNA # random number seed set to: 4 # number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: MADE1 [M=80] Accession: DF0000629.2 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Scores for complete hits: E-value score bias Sequence start end Description ------- ------ ----- -------- ----- ----- ----------- 1.2e-10 38.6 7.4 humanchr1/239220001-239550000 302390 302466 7.8e-08 29.6 8.3 humanchr1/239220001-239550000 174456 174498 1.2e-07 28.9 6.0 humanchr1/239220001-239550000 302466 302390 7.2e-06 23.3 7.0 humanchr1/239220001-239550000 174493 174456 ------ inclusion threshold ------ 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104 Annotation for each hit (and alignments): >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87 Alignment: score: 38.6 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 899******************************************955533.443..334.4689***********99986 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92 Alignment: score: 29.6 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 589************************************9975 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74 Alignment: score: 28.9 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 68999999999999998................5666777776222222222222222268****************************9998 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91 Alignment: score: 23.3 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 taatg caaaaacc caattacttttgcac aacctaa humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 689********************************985 PP >> humanchr1/239220001-239550000 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85 Alignment: score: 6.3 bits xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 tt a tgg aaaaa ca tta ttttgca humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 455779************************86 PP Internal pipeline statistics summary: ------------------------------------- Query model(s): 1 (80 nodes) Target sequences: 1 (660000 residues searched) Residues passing SSV filter: 61794 (0.0936); expected (0.02) Residues passing bias filter: 46199 (0.07); expected (0.02) Residues passing Vit filter: 2752 (0.00417); expected (0.001) Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) Total number of hits: 5 (0.000405) # CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03 # Mc/sec: 1760.00 // [ok]