Mercurial > repos > iuc > hmmer_hmmsearch
diff test-data/MADE1.out @ 4:6867ed975e25 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
| author | iuc |
|---|---|
| date | Mon, 11 Jun 2018 15:51:39 -0400 |
| parents | 1dde27bbdcba |
| children | b774ae8e1609 |
line wrap: on
line diff
--- a/test-data/MADE1.out Sat Apr 07 03:49:37 2018 -0400 +++ b/test-data/MADE1.out Mon Jun 11 15:51:39 2018 -0400 @@ -1,13 +1,13 @@ # hmmscan :: search sequence(s) against a profile database -# HMMER 3.1b2 (February 2015); http://hmmer.org/ -# Copyright (C) 2015 Howard Hughes Medical Institute. -# Freely distributed under the GNU General Public License (GPLv3). +# HMMER 3.2 (June 2018); http://hmmer.org/ +# Copyright (C) 2018 Howard Hughes Medical Institute. +# Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat -# target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat -# per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat -# per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat -# pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat +# query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_20.dat +# target HMM database: localref.hmm +# per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_22.dat +# per-dom hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_23.dat +# pfam-style tabular hit output: /tmp/tmpp4O0Ju/files/000/dataset_24.dat # max ASCII text line length: unlimited # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 @@ -20,54 +20,54 @@ --- full sequence --- --- best 1 domain --- -#dom- E-value score bias E-value score bias exp N Model Description ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- - 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 5.7e-18 51.8 27.9 2e-12 34.1 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Domain annotation for each model (and alignments): >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- - 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 + 1 ? -4.5 0.0 1 1 30 54 .. 80044 80068 .. 80033 80072 .. 0.81 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 - 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 - 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 - 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 + 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174577 .. 0.66 + 4 ! 34.1 0.7 2e-12 2e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 + 5 ? 2.8 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304022 304109 .. 0.62 Alignments for each domain: - == domain 1 score: -4.2 bits; conditional E-value: 1 + == domain 1 score: -4.5 bits; conditional E-value: 1 xxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 30 ttgccattacttttaatggcaaaaa 54 + MADE1 30 ttgccattacttttaatggcaaaaa 54 t g catt ttt aatggcaaa a humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 - 45789****************9966 PP + 457899***************9865 PP == domain 2 score: -6.6 bits; conditional E-value: 1 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 + MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 - 78999999999999999999999984444444457777777899998876....77777888876 PP + 78999999999999999999999984444444457777777899988765....67777778776 PP == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF - MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 - ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a - humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 - 79***************************************964443333333333330 PP + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 + ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt + humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 + 79**************************************996 PP - == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 - t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa - humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 - 56899******************************************963333233345578**************996 PP + == domain 4 score: 34.1 bits; conditional E-value: 2e-12 + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggca...aaaaccgcaattacttttgcaccaacctaa 80 + t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTtttAAAA--G-TAATGCTTTTACACCAATCTAA 302466 + 56899******************************************962223333..3.45578**************997 PP - == domain 5 score: 2.9 bits; conditional E-value: 0.011 + == domain 5 score: 2.8 bits; conditional E-value: 0.011 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 + MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 - 222222222222.3455779************************98765 PP + 222223222222.3556779************************98765 PP @@ -81,7 +81,7 @@ Passed Fwd filter: 1 (1); expected 0.0 (1e-05) Initial search space (Z): 1 [actual number of targets] Domain search space (domZ): 1 [number of targets reported over threshold] -# CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16 -# Mc/sec: 165.00 +# CPU time: 0.14u 0.01s 00:00:00.15 Elapsed: 00:00:00.14 +# Mc/sec: 177.58 // [ok]