view test-data/nhmmer.out @ 7:d753d9169482 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author iuc
date Wed, 21 Jul 2021 14:14:52 +0000
parents b774ae8e1609
children
line wrap: on
line source

# nhmmer :: search a DNA model, alignment, or sequence against a DNA database
# HMMER 3.3.2 (Nov 2020); http://hmmer.org/
# Copyright (C) 2020 Howard Hughes Medical Institute.
# Freely distributed under the BSD open source license.
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# query file:                      /tmp/tmpzdnl83p_/files/9/7/3/dataset_973ac44a-c86b-42ed-b8fe-f747795642c7.dat
# target sequence database:        /tmp/tmpzdnl83p_/files/6/5/6/dataset_65678542-5e91-4d72-9409-b7213a529ca0.dat
# max ASCII text line length:      unlimited
# SSV filter P threshold:       <= 0.02
# Vit filter P threshold:       <= 0.001
# Fwd filter P threshold:       <= 1e-05
# input query is asserted as:      DNA
# random number seed set to:       4
# number of worker threads:        0
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Query:       MADE1  [M=80]
Accession:   DF0000629.2
Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
Scores for complete hits:
    E-value  score  bias  Sequence                       start    end  Description
    ------- ------ -----  --------                       -----  -----  -----------
      4e-11   41.3   7.5  humanchr1/239220001-239550000 302390 302466 
    1.9e-08   32.8   8.3  humanchr1/239220001-239550000 174456 174498 
    6.3e-08   31.0   6.7  humanchr1/239220001-239550000 302466 302389 
    4.9e-06   25.0   7.0  humanchr1/239220001-239550000 174493 174456 
  ------ inclusion threshold ------
        2.2    6.9   7.2  humanchr1/239220001-239550000 304073 304103 


Annotation for each hit  (and alignments):
>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   41.3   7.5     4e-11         4        80 .]    302390    302466 ..    302387    302466 ..    330000    0.88

  Alignment:
  score: 41.3 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80    
                                       ggt ggtgcaaaa  aattg ggtttttgccatt cttttaat gc    aaaa   g  a t ctttt caccaa ctaa
  humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466
                                       89*******************************************966644554...34.4578**************997 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   32.8   8.3   1.9e-08         1        43 [.    174456    174498 ..    174456    174518 ..    330000    0.91

  Alignment:
  score: 32.8 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
                                       ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
                                       589************************************9986 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   31.0   6.7   6.3e-08         1        78 [.    302466    302389 ..    302466    302387 ..    330000    0.80

  Alignment:
  score: 31.0 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1      1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78    
                                       ttag ttggtg aaaag a t      tttt    gc atta    +aatggcaaaaacc caatt  ttttgcacc acc 
  humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389
                                       6899************97543.2...23333455566666666666799*****************************9985 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 !   25.0   7.0   4.9e-06        43        80 .]    174493    174456 ..    174513    174456 ..    330000    0.94

  Alignment:
  score: 25.0 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80    
                                       taatg caaaaacc caattacttttgcac aacctaa
  humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
                                       5899*******************************986 PP

>> humanchr1/239220001-239550000  
    score  bias    Evalue   hmmfrom    hmm to     alifrom    ali to      envfrom    env to       sq len      acc
   ------ ----- ---------   -------   -------    --------- ---------    --------- ---------    ---------    ----
 ?    6.9   7.2       2.2        41        71 ..    304073    304103 ..    304053    304109 ..    330000    0.85

  Alignment:
  score: 6.9 bits
                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
                          MADE1     41 tttaatggcaaaaaccgcaattacttttgca 71    
                                       tt a tgg aaaaa   ca tta ttttgca
  humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103
                                       456789************************8 PP



Internal pipeline statistics summary:
-------------------------------------
Query model(s):                            1  (80 nodes)
Target sequences:                          1  (660000 residues searched)
Residues passing SSV filter:           60770  (0.0921); expected (0.02)
Residues passing bias filter:          35792  (0.0542); expected (0.02)
Residues passing Vit filter:            1612  (0.00244); expected (0.001)
Residues passing Fwd filter:            1194  (0.00181); expected (1e-05)
Total number of hits:                      5  (0.000405)
# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02
# Mc/sec: 2197.54
//
[ok]