Mercurial > repos > iuc > hmmer_jackhmmer
diff test-data/MADE1.out @ 5:5113c71c7031 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
| author | iuc |
|---|---|
| date | Tue, 16 Jun 2020 05:32:33 -0400 |
| parents | 793967b6ae8a |
| children | 6e27bb3f0fa6 |
line wrap: on
line diff
--- a/test-data/MADE1.out Mon Jun 11 15:51:14 2018 -0400 +++ b/test-data/MADE1.out Tue Jun 16 05:32:33 2020 -0400 @@ -1,13 +1,13 @@ # hmmscan :: search sequence(s) against a profile database -# HMMER 3.2 (June 2018); http://hmmer.org/ -# Copyright (C) 2018 Howard Hughes Medical Institute. +# HMMER 3.3 (Nov 2019); http://hmmer.org/ +# Copyright (C) 2019 Howard Hughes Medical Institute. # Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query sequence file: /tmp/tmpp4O0Ju/files/000/dataset_20.dat +# query sequence file: /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat # target HMM database: localref.hmm -# per-seq hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_22.dat -# per-dom hits tabular output: /tmp/tmpp4O0Ju/files/000/dataset_23.dat -# pfam-style tabular hit output: /tmp/tmpp4O0Ju/files/000/dataset_24.dat +# per-seq hits tabular output: /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat +# per-dom hits tabular output: /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat +# pfam-style tabular hit output: /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat # max ASCII text line length: unlimited # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 @@ -20,54 +20,46 @@ --- full sequence --- --- best 1 domain --- -#dom- E-value score bias E-value score bias exp N Model Description ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- - 5.7e-18 51.8 27.9 2e-12 34.1 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 9.3e-18 51.2 26.3 1.3e-12 34.8 0.7 8.6 4 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Domain annotation for each model (and alignments): >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- - 1 ? -4.5 0.0 1 1 30 54 .. 80044 80068 .. 80033 80072 .. 0.81 - 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 - 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174577 .. 0.66 - 4 ! 34.1 0.7 2e-12 2e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 - 5 ? 2.8 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304022 304109 .. 0.62 + 1 ! 27.4 0.6 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174520 .. 0.93 + 2 ? -8.4 5.8 1 1 12 79 .. 197274 197341 .. 197272 197342 .. 0.86 + 3 ! 34.8 0.7 1.3e-12 1.3e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.87 + 4 ? 1.4 0.4 0.033 0.033 27 74 .. 304060 304106 .. 304029 304108 .. 0.71 Alignments for each domain: - == domain 1 score: -4.5 bits; conditional E-value: 1 - xxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 30 ttgccattacttttaatggcaaaaa 54 - t g catt ttt aatggcaaa a - humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 - 457899***************9865 PP - - == domain 2 score: -6.6 bits; conditional E-value: 1 - xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 - aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca - humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 - 78999999999999999999999984444444457777777899988765....67777778776 PP - - == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 + == domain 1 score: 27.4 bits; conditional E-value: 2.4e-10 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 - 79**************************************996 PP + 79**************************************997 PP + + == domain 2 score: -8.4 bits; conditional E-value: 1 + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79 + caa gtaatt + tttt c att ttt t c aaa c c tta tt t ac a cta + humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341 + 567789*******************999999999999*****99999999999988877777776666 PP - == domain 4 score: 34.1 bits; conditional E-value: 2e-12 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggca...aaaaccgcaattacttttgcaccaacctaa 80 - t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa - humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTtttAAAA--G-TAATGCTTTTACACCAATCTAA 302466 - 56899******************************************962223333..3.45578**************997 PP + == domain 3 score: 34.8 bits; conditional E-value: 1.3e-12 + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 + t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 + 6799*****************************************99953333333345578**************997 PP - == domain 5 score: 2.8 bits; conditional E-value: 0.011 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 - tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa - humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 - 222223222222.3556779************************98765 PP + == domain 4 score: 1.4 bits; conditional E-value: 0.033 + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74 + tttt g c ta tt a tgg aaaaa + ca tta ttttgca a + humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106 + 334444443333.356788*************************9766 PP @@ -81,7 +73,7 @@ Passed Fwd filter: 1 (1); expected 0.0 (1e-05) Initial search space (Z): 1 [actual number of targets] Domain search space (domZ): 1 [number of targets reported over threshold] -# CPU time: 0.14u 0.01s 00:00:00.15 Elapsed: 00:00:00.14 -# Mc/sec: 177.58 +# CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22 +# Mc/sec: 117.29 // [ok]