Mercurial > repos > iuc > hmmer_jackhmmer
changeset 3:036df14999e8 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
| author | iuc |
|---|---|
| date | Sat, 07 Apr 2018 03:48:57 -0400 |
| parents | d4fda6672a64 |
| children | 793967b6ae8a |
| files | jackhmmer.xml macros.xml test-data/MADE1.nhmmscan_out test-data/MADE1.nhmmscan_out.aliscoresout test-data/MADE1.nhmmscan_out.dfamtblout test-data/MADE1.nhmmscan_out.tblout test-data/nhmmer.out.dfamtblout test-data/nhmmer.out.tblout |
| diffstat | 8 files changed, 304 insertions(+), 118 deletions(-) [+] |
line wrap: on
line diff
--- a/jackhmmer.xml Wed Apr 04 14:00:07 2018 -0400 +++ b/jackhmmer.xml Sat Apr 07 03:48:57 2018 -0400 @@ -1,5 +1,5 @@ <?xml version="1.0"?> -<tool id="hmmer_jackhmmer" name="jackhmmer" version="@WRAPPER_VERSION@.0"> +<tool id="hmmer_jackhmmer" name="jackhmmer" version="@TOOL_VERSION@"> <description>iteratively search a protein sequence against a protein database (PSIBLAST-like)</description> <macros> <import>macros.xml</import> @@ -23,10 +23,10 @@ @CPU@ @SEED@ -$seqfile -$seqdb -> $output - ]]></command> +'$seqfile' +'$seqdb' +> '$output' + ]]></command> <inputs> <param name="seqfile" type="data" format="fasta" label="Protein sequence to search with"/> <!-- todo use Galaxy features like data libraries/data tables/??? --> @@ -45,11 +45,11 @@ <expand macro="seed"/> </inputs> <outputs> - <data format="txt" name="output" label="PHMMER search of $seqfile.name in $seqdb.name"/> - <data format="txt" name="tblout" label="Table of per-sequence hits from HMM matches of $seqfile.name in $seqdb.name"> + <data name="output" format="txt" label="PHMMER search of $seqfile.name in $seqdb.name"/> + <data name="tblout" format="txt" label="Table of per-sequence hits from HMM matches of $seqfile.name in $seqdb.name"> <filter>oformat and 'tblout' in oformat</filter> </data> - <data format="txt" name="domtblout" label="Table of per-domain hits from HMM matches of $seqfile.name in $seqdb.name"> + <data name="domtblout" format="txt" label="Table of per-domain hits from HMM matches of $seqfile.name in $seqdb.name"> <filter>oformat and 'domtblout' in oformat</filter> </data> </outputs> @@ -91,6 +91,6 @@ @SEED_HELP@ @ATTRIBUTION@ -]]></help> + ]]></help> <expand macro="citation"/> </tool>
--- a/macros.xml Wed Apr 04 14:00:07 2018 -0400 +++ b/macros.xml Sat Apr 07 03:48:57 2018 -0400 @@ -2,11 +2,11 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="3.1b2">hmmer</requirement> + <requirement type="package" version="@TOOL_VERSION@">hmmer</requirement> <yield/> </requirements> </xml> - <token name="@WRAPPER_VERSION@">0.1</token> + <token name="@TOOL_VERSION@">3.1b2</token> <xml name="stdio"> <stdio> <!-- Anything other than zero is an error --> @@ -21,64 +21,64 @@ -E $E --domE $domE -#if $T: --T $T +#if str($T): + -T $T #end if -#if $domT: ---domT $domT +#if str($domT): + --domT $domT #end if -#if $incE: ---incE $incE +#if str($incE): + --incE $incE #end if -#if $incT: ---incT $incT +#if str($incdomE): + --incdomE $incdomE #end if -#if $incdomE: ---incdomE $incdomE +#if str($incT): + --incT $incT #end if -#if $incdomT: ---incdomT $incdomT +#if str($incdomT): + --incdomT $incdomT #end if </token> <xml name="thresholds_xml"> <!-- Options controlling reporting thresholds --> - <param name="E" label="report sequences <= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/> - <param name="domE" label="report domains <= this E-Value threshold in output" help="(--domE)" value="10.0" type="float" min="0"/> - <param name="T" label="report sequences >= this score threshold in output" help="(-T)" type="float" optional="True"/> - <param name="domT" label="report domains >= this score threshold in output" help="(--domT)" type="float" optional="True"/> + <param argument="-E" type="float" min="0" value="10.0" label="report sequences <= this E-Value threshold in output" /> + <param argument="--domE" type="float" min="0" value="10.0" label="report domains <= this E-Value threshold in output" /> + <param argument="-T" type="float" optional="true" label="report sequences >= this score threshold in output" /> + <param argument="--domT" type="float" optional="true" label="report domains >= this score threshold in output" /> <!-- Options controlling inclusion (significance) thresholds --> - <param name="incE" label="consider sequences <= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/> - <param name="incdomE" label="consider domains <= this E-Value threshold as significant" help="(--incdomE)" type="float" optional="True"/> - <param name="incT" label="consider sequences >= this score threshold as significant" help="(--incT)" type="float" optional="True"/> - <param name="incdomT" label="consider domains >= this score threshold as significant" help="(--incdomT)" type="float" optional="True"/> + <param argument="--incE" type="float" optional="true" label="consider sequences <= this E-Value threshold as significant" /> + <param argument="--incdomE" type="float" optional="true" label="consider domains <= this E-Value threshold as significant" /> + <param argument="--incT" type="float" optional="true" label="consider sequences >= this score threshold as significant" /> + <param argument="--incdomT" type="float" optional="true" label="consider domains >= this score threshold as significant" /> </xml> <token name="@THRESHOLDS_NODOM@"> -E $E -#if $T: --T $T +#if str($T): + -T $T #end if -#if $incE: ---incE $incE +#if str($incE): + --incE $incE #end if -#if $incT: ---incT $incT +#if str($incT): + --incT $incT #end if </token> <xml name="thresholds_nodom"> <!-- Options controlling reporting thresholds --> - <param name="E" label="report sequences <= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/> - <param name="T" label="report sequences >= this score threshold in output" help="(-T)" type="float" optional="True"/> + <param argument="-E" type="float" min="0" value="10.0" label="report sequences <= this E-Value threshold in output" /> + <param argument="-T" type="float" optional="true" label="report sequences >= this score threshold in output" /> <!-- Options controlling inclusion (significance) thresholds --> - <param name="incE" label="consider sequences <= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/> - <param name="incT" label="consider sequences >= this score threshold as significant" help="(--incT)" type="float" optional="True"/> + <param argument="--incE" type="float" optional="true" label="consider sequences <= this E-Value threshold as significant" /> + <param argument="--incT" type="float" optional="true" label="consider sequences >= this score threshold as significant" /> </xml> <token name="@ACCEL_HEUR@"> $max @@ -86,15 +86,14 @@ --F2 $F2 --F3 $F3 $nobias - </token> <xml name="accel_heur_xml"> <!-- Options controlling acceleration heuristics --> - <param name="max" type="boolean" truevalue="--max" label="Turn all heuristic filters off (less speed, more power)" help="(--max)" falsevalue=""/> - <param name="F1" type="float" label="Stage 1 (MSV) threshold: promote hits w/ P <= F1" help="(--F1)" value="0.02"/> - <param name="F2" type="float" label="Stage 2 (Vit) threshold: promote hits w/ P <= F2" help="(--F2)" value="1e-3"/> - <param name="F3" type="float" label="Stage 3 (Fwd) threshold: promote hits w/ P <= F3" help="(--F3)" value="1e-5"/> - <param name="nobias" type="boolean" truevalue="--nobias" label="Turn off composition bias filter" help="(--nobias)" falsevalue=""/> + <param argument="--max" type="boolean" truevalue="--max" falsevalue="" label="Turn all heuristic filters off (less speed, more power)" /> + <param argument="--F1" type="float" value="0.02" label="Stage 1 (MSV) threshold: promote hits w/ P <= F1" /> + <param argument="--F2" type="float" value="1e-3" label="Stage 2 (Vit) threshold: promote hits w/ P <= F2" /> + <param argument="--F3" type="float" value="1e-5" label="Stage 3 (Fwd) threshold: promote hits w/ P <= F3" /> + <param argument="--nobias" type="boolean" truevalue="--nobias" falsevalue="" label="Turn off composition bias filter" /> </xml> <token name="@EVAL_CALIB@"> --EmL $EmL @@ -107,90 +106,90 @@ </token> <xml name="eval_calib_xml"> <!-- Control of E-value calibration --> - <param name="EmL" type="integer" value="200" min="1" help="(--EmL)" label="Length of sequences for MSV Gumbel mu fit"/> - <param name="EmN" type="integer" value="200" min="1" help="(--EmN)" label="Number of sequences for MSV Gumbel mu fit"/> - <param name="EvL" type="integer" value="200" min="1" help="(--EvL)" label="Length of sequences for Viterbi Gumbel mu fit"/> - <param name="EvN" type="integer" value="200" min="1" help="(--EvN)" label="Number of sequences for Viterbi Gumbel mu fit"/> - <param name="EfL" type="integer" value="100" min="1" help="(--EfL)" label="Length of sequences for Forward exp tail tau fit"/> - <param name="EfN" type="integer" value="200" min="1" help="(--EfN)" label="Number of sequences for Forward exp tail tau fit"/> - <param name="Eft" type="float" value="0.04" min="0" max="1" help="(--Eft)" label="tail mass for Forward exponential tail tau fit"/> + <param argument="--EmL" type="integer" min="1" value="200" label="Length of sequences for MSV Gumbel mu fit" /> + <param argument="--EmN" type="integer" min="1" value="200" label="Number of sequences for MSV Gumbel mu fit" /> + <param argument="--EvL" type="integer" min="1" value="200" label="Length of sequences for Viterbi Gumbel mu fit" /> + <param argument="--EvN" type="integer" min="1" value="200" label="Number of sequences for Viterbi Gumbel mu fit" /> + <param argument="--EfL" type="integer" min="1" value="100" label="Length of sequences for Forward exp tail tau fit" /> + <param argument="--EfN" type="integer" min="1" value="200" label="Number of sequences for Forward exp tail tau fit" /> + <param argument="--Eft" type="float" min="0" max="1" value="0.04" label="tail mass for Forward exponential tail tau fit" /> </xml> <token name="@OFORMAT_WITH_OPTS_NOPFAM@"> #if 'tblout' in str($oformat): - --tblout $tblout + --tblout '$tblout' #end if #if 'domtblout' in str($oformat): - --domtblout $domtblout + --domtblout '$domtblout' #end if $acc $noali $notextw </token> <xml name="oformat_with_opts_nopfam"> <!-- Options directing output --> - <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select"> + <param name="oformat" multiple="true" display="checkboxes" label="Output Formats" type="select"> <option value="tblout" selected="true">Table of per-sequence hits (--tblout)</option> <option value="domtblout" selected="true">Table of per-domain hits (--domtblout)</option> </param> - <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/> - <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/> - <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/> + <param argument="--acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" /> + <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" /> + <param argument="--notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" /> </xml> <token name="@OFORMAT_WITH_OPTS@"> #if 'tblout' in str($oformat): - --tblout $tblout + --tblout '$tblout' #end if #if 'domtblout' in str($oformat): - --domtblout $domtblout + --domtblout '$domtblout' #end if #if 'pfamtblout' in str($oformat): - --pfamtblout $pfamtblout + --pfamtblout '$pfamtblout' #end if $acc $noali $notextw </token> <xml name="oformat_with_opts"> <!-- Options directing output --> - <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select"> + <param name="oformat" type="select" multiple="true" display="checkboxes" label="Output Formats"> <option value="tblout" selected="true">Table of per-sequence hits (--tblout)</option> <option value="domtblout" selected="true">Table of per-domain hits (--domtblout)</option> <option value="pfamtblout" selected="true">Table of hits and domains in Pfam format (--pfamtblout)</option> </param> - <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/> - <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/> - <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/> + <param argument="--acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" /> + <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" /> + <param argument="--notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" /> </xml> <xml name="oformat_test"> - <param name="notextw" value="True" /> + <param name="notextw" value="true" /> </xml> <!-- TODO: tblout will match 'pfamtblout,dfamtblout' --> <token name="@OFORMAT_WITH_OPTS_N@"> #if 'tblout' in str($oformat): - --tblout $tblout + --tblout '$tblout' #end if #if 'dfamtblout' in str($oformat): - --dfamtblout $dfamtblout + --dfamtblout '$dfamtblout' #end if #if 'aliscoresout' in str($oformat): - --aliscoresout $aliscoresout + --aliscoresout '$aliscoresout' #end if $acc $noali $notextw </token> <xml name="oformat_with_opts_n"> <!-- Options directing output --> - <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select"> + <param name="oformat" type="select" multiple="true" display="checkboxes" label="Output Formats"> <option value="tblout" selected="true">Table of hits (--tblout)</option> <option value="dfamtblout" selected="true">Table of hits in Dfam format (--dfamtblout)</option> <option value="aliscoresout">Scores for each position in each alignment to file (--aliscoresout)</option> </param> - <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/> - <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/> - <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/> + <param argument="--acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" /> + <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" /> + <param argument="--notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" /> </xml> <token name="@HSSI@"> #if $hssi.hssi_select == "singlemx": @@ -205,11 +204,10 @@ <option value="false" selected="true">Disable</option> <option value="singlemx">Use substitution score matrix for single-sequence inputs</option> </param> + <when value="false" /> <when value="singlemx"> - <param name="popen" type="float" value="0.02" label="Gap open probability" help="(--popen)" min="0.0" max="0.5"/> - <param name="pextend" type="float" value="0.4" label="Gap extend probability" help="(--pextend)" min="0.0" max="1.0"/> - </when> - <when value="false"> + <param argument="--popen" type="float" min="0.0" max="0.5" value="0.02" label="Gap open probability" /> + <param argument="--pextend" type="float" min="0.0" max="1.0" value="0.4" label="Gap extend probability" /> </when> <!-- -mx <s> : substitution score matrix (built-in matrices, with -singlemx)--> <!-- -mxfile <f> : read substitution score matrix from file <f> (with -singlemx)--> @@ -222,7 +220,7 @@ --seed $seed </token> <xml name="seed"> - <param name="seed" label="RNG seed, 0 generates a random seed" value="42" type="integer" help="(--seed)" min="0"/> + <param argument="--seed" type="integer" min="0" value="42" label="RNG seed, 0 generates a random seed" /> </xml> <xml name="seed_test"> <param name="seed" value="4" /> @@ -230,19 +228,19 @@ <token name="@ADV_OPTS@"> $nonull2 -#if $Z: --Z $Z +#if str($Z): + -Z $Z #end if -#if $domZ: ---domZ $domZ +#if str($domZ): + --domZ $domZ #end if </token> <xml name="adv_opts"> <!-- Other options --> - <param name="nonull2" type="boolean" truevalue="--nonull2" label="Turn off biased composition score corrections" help="(--nonull2)" falsevalue=""/> - <param name="Z" type="integer" label="# of comparisons done for E-value calculation" help="(-Z)" optional="True"/> - <param name="domZ" type="integer" label="# of significant sequences, for domain E-value calculation" help="(--domZ)" optional="True"/> + <param argument="--nonull2" type="boolean" truevalue="--nonull2" falsevalue="" label="Turn off biased composition score corrections" /> + <param argument="-Z" type="integer" optional="true" label="# of comparisons done for E-value calculation" /> + <param argument="--domZ" type="integer" optional="true" label="# of significant sequences, for domain E-value calculation" /> </xml> <token name="@FORMAT_SELECTOR@"> $input_format_select @@ -264,7 +262,7 @@ $arsws.arsws_select #if $arsws.arsws_select == "--wblosum": ---wid $arsws.wid + --wid $arsws.wid #end if </token> <xml name="arsws"> @@ -282,7 +280,7 @@ <when value="--wgsc"> </when> <when value="--wblosum"> - <param name="wid" label="Set identity cutoff" value="0.62" type="float" help="(--wid)"/> + <param argument="--wid" type="float" value="0.62" label="Set identity cutoff" /> </when> <when value="--wnone"> </when> @@ -315,13 +313,13 @@ <when value=""> </when> <when value="eent"> - <param name="eset" type="float" value="0" label="set eff seq # for all models" help="(--eset)"/> - <param name="ere" type="float" value="0" label="set minimum rel entropy/position" help="(--ere)"/> - <param name="esigma" type="float" value="45" label="set sigma param" help="(--esigma)"/> + <param argument="--eset" type="float" value="0" label="set eff seq # for all models" /> + <param argument="--ere" type="float" value="0" label="set minimum rel entropy/position" /> + <param argument="--esigma" type="float" value="45" label="set sigma param" /> </when> <when value="eclust"> - <param name="eset" type="float" value="0" label="set eff seq # for all models" help="(--eset)"/> - <param name="eid" type="float" value="0.62" label="set fractional identity cutoff" min="0" max="1" help="(--eid)"/> + <param argument="--eset" type="float" value="0" label="set eff seq # for all models" /> + <param argument="--eid" type="float" min="0" max="1" value="0.62" label="set fractional identity cutoff" /> </when> <when value="enone"> </when> @@ -333,17 +331,19 @@ $cut_tc </token> <xml name="cut"> - <param name="cut_ga" type="boolean" truevalue="--cut_ga" label="use profile's GA gathering cutoffs to set all thresholding" help="(--cut_ga)" falsevalue=""/> - <param name="cut_nc" type="boolean" truevalue="--cut_nc" label="use profile's NC gathering cutoffs to set all thresholding" help="(--cut_nc)" falsevalue=""/> - <param name="cut_tc" type="boolean" truevalue="--cut_tc" label="use profile's TC gathering cutoffs to set all thresholding" help="(--cut_tc)" falsevalue=""/> + <param argument="--cut_ga" type="boolean" truevalue="--cut_ga" falsevalue="" label="use profile's GA gathering cutoffs to set all thresholding" /> + <param argument="--cut_nc" type="boolean" truevalue="--cut_nc" falsevalue="" label="use profile's NC gathering cutoffs to set all thresholding" /> + <param argument="--cut_tc" type="boolean" truevalue="--cut_tc" falsevalue="" label="use profile's TC gathering cutoffs to set all thresholding" /> </xml> <token name="@MCSS@"> --$mcs.model_construction_strategy_select #if $mcs.model_construction_strategy_select == "fast": ---symfrac $mcs.symfrac + --symfrac $mcs.symfrac #end if - +#if str($fragthresh) + --fragthresh $fragthresh +#end if </token> <xml name="mcss"> <!-- Alternative model construction strategies --> @@ -353,12 +353,11 @@ <option value="hand">Manual construction (requires reference annotation) (--hand)</option> </param> <when value="fast"> - <param name="symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/> + <param argument="--symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/> </when> <when value="hand"></when> </conditional> - <param name="fragthresh" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns (--fragthresh)" value="0.5" optional="True" type="float" /> - + <param argument="--fragthresh" type="float" value="0.5" optional="true" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns" /> </xml> <token name="@PRIOR@"> $aps_select @@ -376,32 +375,32 @@ </citations> </xml> <token name="@LENGTHS@"> -#if $w_beta: ---w_beta $w_beta +#if str($w_beta): + --w_beta $w_beta #end if -#if $w_length: ---w_length $w_length +#if str($w_length): + --w_length $w_length #end if - </token> <xml name="lengths"> - <param name="w_beta" label="Tail mass at which window length is determined" - help="(--w_beta)" optional="True" type="float"/> - <param name="w_length" label="Window Length" - help="(--w_length)" optional="True" type="integer" /> + <param argument="--w_beta" type="float" optional="true" label="Tail mass at which window length is determined" /> + <param argument="--w_length" type="integer" optional="true" label="Window Length" /> </xml> - <token name="@INPUTHMMCHOICE@"> + <token name="@INPUTHMMCHOICE@"><![CDATA[ #if $input_hmm_conditional.input_hmm_source == "history": - '$input_hmm_conditional.hmmfile' + #set $input_hmm_filename = "localref.hmm" + ln -s '${input_hmm_conditional.hmmfile}' '${input_hmm_filename}' && + ## "Press" database + hmmpress '${input_hmm_filename}' && #else: - '$input_hmm_conditional.index.fields.db_path' + #set $input_hmm_filename = str($input_hmm_conditional.index.fields.db_path) #end if - </token> + ]]></token> <xml name="input_hmm_choice"> <conditional name="input_hmm_conditional"> <param name="input_hmm_source" type="select" label="Use a built-in HMM model database or own from your history" > - <option value="indexed" selected="True">Use a built-in HMM model database</option> + <option value="indexed" selected="true">Use a built-in HMM model database</option> <option value="history">Use a HMM database from history</option> </param> <when value="indexed"> @@ -413,12 +412,12 @@ </param> </when> <when value="history"> - <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/> + <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" /> </when> <!-- history --> </conditional> <!-- input_hmm_conditional --> </xml> <xml name="input_hmm"> - <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/> + <param name="hmmfile" type="data" format="hmm2,hmm3" label="HMM model" /> </xml> <xml name="input_msa"> <param name="msafile" type="data" label="Multiple Sequence Alignment" format="stockholm,clustal,fasta"
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out Sat Apr 07 03:48:57 2018 -0400 @@ -0,0 +1,109 @@ +# nhmmscan :: search DNA sequence(s) against a DNA profile database +# HMMER 3.1b2 (February 2015); http://hmmer.org/ +# Copyright (C) 2015 Howard Hughes Medical Institute. +# Freely distributed under the GNU General Public License (GPLv3). +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - +# query sequence file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# target HMM database: /tmp/tmpc_c3amjg/files/000/dataset_1.dat +# per-seq hits tabular output: /tmp/tmpc_c3amjg/files/000/dataset_4.dat +# hits output in Dfam format: /tmp/tmpc_c3amjg/files/000/dataset_5.dat +# max ASCII text line length: unlimited +# Vit filter P threshold: <= 0.001 +# Fwd filter P threshold: <= 1e-05 +# random number seed set to: 4 +# number of worker threads: 1 +# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + +Query: humanchr1/239220001-239550000 [L=330000] +Scores for complete hit: + E-value score bias Model start end Description + ------- ------ ----- -------- ----- ----- ----------- + 1.2e-10 38.6 7.4 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 7.8e-08 29.6 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 1.2e-07 28.9 6.0 MADE1 302466 302390 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + 7.2e-06 23.3 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + ------ inclusion threshold ------ + 1.4 6.3 7.0 MADE1 304073 304104 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + + +Annotation for each hit (and alignments): +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.87 + + Alignment: + score: 38.6 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 + ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa + humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466 + 899******************************************955533.443..334.4689***********99986 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.92 + + Alignment: + score: 29.6 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 + ttaggtt gtgcaaaagtaattg ggtttttg cattactttt + humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 + 589************************************9975 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 80 0.74 + + Alignment: + score: 28.9 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77 + ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc + humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390 + 68999999999999998................5666777776222222222222222268****************************9998 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.91 + + Alignment: + score: 23.3 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 + taatg caaaaacc caattacttttgcac aacctaa + humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 + 689********************************985 PP + +>> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc + ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- + ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 80 0.85 + + Alignment: + score: 6.3 bits + xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF + MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72 + tt a tgg aaaaa ca tta ttttgca + humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104 + 455779************************86 PP + + + +Internal pipeline statistics summary: +------------------------------------- +Query sequence(s): 1 (660000 residues searched) +Target model(s): 1 (80 nodes) +Residues passing SSV filter: 61794 (0.0936); expected (0.02) +Residues passing bias filter: 46199 (0.07); expected (0.02) +Residues passing Vit filter: 2752 (0.00417); expected (0.001) +Residues passing Fwd filter: 2526 (0.00383); expected (1e-05) +Total number of hits: 5 (0.000405) +# CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.02 +# Mc/sec: 2640.00 +// +[ok]
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out.aliscoresout Sat Apr 07 03:48:57 2018 -0400 @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to modlen strand E-value score bias description of target +#------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 4 80 302390 302466 302387 302466 80 + 1.2e-10 38.6 7.4 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 43 174456 174498 174456 174518 80 + 7.8e-08 29.6 8.3 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 77 302466 302390 302466 302387 80 - 1.2e-07 28.9 6.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 43 80 174493 174456 174513 174456 80 - 7.2e-06 23.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 41 72 304073 304104 304053 304109 80 + 1.4 6.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +# +# Program: hmmscan +# Version: 3.1b2 (February 2015) +# Pipeline mode: SCAN +# Query file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Target file: /tmp/tmpc_c3amjg/files/000/dataset_1.dat +# Option settings: nhmmscan --tblout /tmp/tmpc_c3amjg/files/000/dataset_4.dat --dfamtblout /tmp/tmpc_c3amjg/files/000/dataset_5.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 /tmp/tmpc_c3amjg/files/000/dataset_1.dat /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Current dir: /tmp/tmpc_c3amjg/job_working_directory/000/3/working +# Date: Wed Apr 4 16:58:45 2018 +# [ok]
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out.dfamtblout Sat Apr 07 03:48:57 2018 -0400 @@ -0,0 +1,10 @@ +# hit scores +# ---------- +# +# target name acc query name bits e-value bias hmm-st hmm-en strand ali-st ali-en env-st env-en modlen description of target +# ------------------- ------------------- ------------------- ------ --------- ----- ------- ------- ------ ------- ------- ------- ------- ------- --------------------- +MADE1 DF0000629.2 humanchr1/239220001-239550000 38.6 1.2e-10 7.4 4 80 + 302390 302466 302387 302466 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 29.6 7.8e-08 8.3 1 43 + 174456 174498 174456 174518 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 28.9 1.2e-07 6.0 1 77 - 302466 302390 302466 302387 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 23.3 7.2e-06 7.0 43 80 - 174493 174456 174513 174456 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 6.3 1.4 7.0 41 72 + 304073 304104 304053 304109 80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MADE1.nhmmscan_out.tblout Sat Apr 07 03:48:57 2018 -0400 @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to modlen strand E-value score bias description of target +#------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 4 80 302390 302466 302387 302466 80 + 1.2e-10 38.6 7.4 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 43 174456 174498 174456 174518 80 + 7.8e-08 29.6 8.3 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 1 77 302466 302390 302466 302387 80 - 1.2e-07 28.9 6.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 43 80 174493 174456 174513 174456 80 - 7.2e-06 23.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +MADE1 DF0000629.2 humanchr1/239220001-239550000 - 41 72 304073 304104 304053 304109 80 + 1.4 6.3 7.0 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon +# +# Program: hmmscan +# Version: 3.1b2 (February 2015) +# Pipeline mode: SCAN +# Query file: /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Target file: /tmp/tmpc_c3amjg/files/000/dataset_1.dat +# Option settings: nhmmscan --tblout /tmp/tmpc_c3amjg/files/000/dataset_4.dat --dfamtblout /tmp/tmpc_c3amjg/files/000/dataset_5.dat --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --B1 110 --B2 240 --B3 1000 --cpu 1 /tmp/tmpc_c3amjg/files/000/dataset_1.dat /tmp/tmpc_c3amjg/files/000/dataset_2.dat +# Current dir: /tmp/tmpc_c3amjg/job_working_directory/000/3/working +# Date: Wed Apr 4 16:58:45 2018 +# [ok]
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nhmmer.out.dfamtblout Sat Apr 07 03:48:57 2018 -0400 @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to sq len strand E-value score bias description of target +# ------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +humanchr1/239220001-239550000 - MADE1 DF0000629.2 4 80 302390 302466 302387 302466 330000 + 1.2e-10 38.6 7.4 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 43 174456 174498 174456 174518 330000 + 7.8e-08 29.6 8.3 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 77 302466 302390 302466 302387 330000 - 1.2e-07 28.9 6.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 43 80 174493 174456 174513 174456 330000 - 7.2e-06 23.3 7.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 41 72 304073 304104 304053 304109 330000 + 1.4 6.3 7.0 - +# +# Program: nhmmer +# Version: 3.1b2 (February 2015) +# Pipeline mode: SEARCH +# Query file: /tmp/tmpnpsbd_6p/files/000/dataset_1.dat +# Target file: /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Option settings: nhmmer --tblout /tmp/tmpnpsbd_6p/files/000/dataset_4.dat --dfamtblout None --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpnpsbd_6p/files/000/dataset_1.dat /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Current dir: /tmp/tmpnpsbd_6p/job_working_directory/000/3/working +# Date: Fri Apr 6 16:39:46 2018 +# [ok]
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nhmmer.out.tblout Sat Apr 07 03:48:57 2018 -0400 @@ -0,0 +1,17 @@ +# target name accession query name accession hmmfrom hmm to alifrom ali to envfrom env to sq len strand E-value score bias description of target +# ------------------- ---------- -------------------- ---------- ------- ------- ------- ------- ------- ------- ------- ------ --------- ------ ----- --------------------- +humanchr1/239220001-239550000 - MADE1 DF0000629.2 4 80 302390 302466 302387 302466 330000 + 1.2e-10 38.6 7.4 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 43 174456 174498 174456 174518 330000 + 7.8e-08 29.6 8.3 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 1 77 302466 302390 302466 302387 330000 - 1.2e-07 28.9 6.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 43 80 174493 174456 174513 174456 330000 - 7.2e-06 23.3 7.0 - +humanchr1/239220001-239550000 - MADE1 DF0000629.2 41 72 304073 304104 304053 304109 330000 + 1.4 6.3 7.0 - +# +# Program: nhmmer +# Version: 3.1b2 (February 2015) +# Pipeline mode: SEARCH +# Query file: /tmp/tmpnpsbd_6p/files/000/dataset_1.dat +# Target file: /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Option settings: nhmmer --tblout /tmp/tmpnpsbd_6p/files/000/dataset_4.dat --dfamtblout None --notextw -E 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --dna --seed 4 --cpu 1 /tmp/tmpnpsbd_6p/files/000/dataset_1.dat /tmp/tmpnpsbd_6p/files/000/dataset_2.dat +# Current dir: /tmp/tmpnpsbd_6p/job_working_directory/000/3/working +# Date: Fri Apr 6 16:39:46 2018 +# [ok]