Mercurial > repos > iuc > hmmer_nhmmer
diff test-data/MADE1.out @ 7:b28e8ed99424 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author | iuc |
---|---|
date | Wed, 21 Jul 2021 14:11:12 +0000 |
parents | b4fe2f703b4b |
children |
line wrap: on
line diff
--- a/test-data/MADE1.out Thu Jan 14 15:42:52 2021 +0000 +++ b/test-data/MADE1.out Wed Jul 21 14:11:12 2021 +0000 @@ -1,79 +1,45 @@ # hmmscan :: search sequence(s) against a profile database -# HMMER 3.3 (Nov 2019); http://hmmer.org/ -# Copyright (C) 2019 Howard Hughes Medical Institute. +# HMMER 3.3.2 (Nov 2020); http://hmmer.org/ +# Copyright (C) 2020 Howard Hughes Medical Institute. # Freely distributed under the BSD open source license. # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query sequence file: /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat +# query sequence file: /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat # target HMM database: localref.hmm -# per-seq hits tabular output: /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat -# per-dom hits tabular output: /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat -# pfam-style tabular hit output: /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat +# per-seq hits tabular output: /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat +# per-dom hits tabular output: /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat +# pfam-style tabular hit output: /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat # max ASCII text line length: unlimited # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # random number seed set to: 4 -# number of worker threads: 1 +# number of worker threads: 0 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -Query: humanchr1/239220001-239550000 [L=330000] +Query: humanchr1/239220001-239550000 [L=59940] Scores for complete sequence (score includes all domains): --- full sequence --- --- best 1 domain --- -#dom- E-value score bias E-value score bias exp N Model Description ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- - 9.3e-18 51.2 26.3 1.3e-12 34.8 0.7 8.6 4 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon + + [No hits detected that satisfy reporting thresholds] Domain annotation for each model (and alignments): ->> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon - # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc - --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- - 1 ! 27.4 0.6 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174520 .. 0.93 - 2 ? -8.4 5.8 1 1 12 79 .. 197274 197341 .. 197272 197342 .. 0.86 - 3 ! 34.8 0.7 1.3e-12 1.3e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.87 - 4 ? 1.4 0.4 0.033 0.033 27 74 .. 304060 304106 .. 304029 304108 .. 0.71 - Alignments for each domain: - == domain 1 score: 27.4 bits; conditional E-value: 2.4e-10 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 - ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt - humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 - 79**************************************997 PP - - == domain 2 score: -8.4 bits; conditional E-value: 1 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79 - caa gtaatt + tttt c att ttt t c aaa c c tta tt t ac a cta - humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341 - 567789*******************999999999999*****99999999999988877777776666 PP - - == domain 3 score: 34.8 bits; conditional E-value: 1.3e-12 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 - t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a a t ctttt caccaa ctaa - humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 - 6799*****************************************99953333333345578**************997 PP - - == domain 4 score: 1.4 bits; conditional E-value: 0.033 - xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF - MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74 - tttt g c ta tt a tgg aaaaa + ca tta ttttgca a - humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106 - 334444443333.356788*************************9766 PP - + [No targets detected that satisfy reporting thresholds] Internal pipeline statistics summary: ------------------------------------- -Query sequence(s): 1 (330000 residues searched) +Query sequence(s): 1 (59940 residues searched) Target model(s): 1 (80 nodes) -Passed MSV filter: 1 (1); expected 0.0 (0.02) -Passed bias filter: 1 (1); expected 0.0 (0.02) -Passed Vit filter: 1 (1); expected 0.0 (0.001) -Passed Fwd filter: 1 (1); expected 0.0 (1e-05) +Passed MSV filter: 0 (0); expected 0.0 (0.02) +Passed bias filter: 0 (0); expected 0.0 (0.02) +Passed Vit filter: 0 (0); expected 0.0 (0.001) +Passed Fwd filter: 0 (0); expected 0.0 (1e-05) Initial search space (Z): 1 [actual number of targets] -Domain search space (domZ): 1 [number of targets reported over threshold] -# CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22 -# Mc/sec: 117.29 +Domain search space (domZ): 0 [number of targets reported over threshold] +# CPU time: 0.00u 0.00s 00:00:00.00 Elapsed: 00:00:00.00 +# Mc/sec: 7920.43 // [ok]