diff test-data/MADE1.out @ 0:f239ab5f45f4 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
author iuc
date Sat, 25 Jun 2016 15:07:17 -0400
parents
children be0cc39776f9
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.out	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,87 @@
+# hmmscan :: search sequence(s) against a profile database
+# HMMER 3.1b2 (February 2015); http://hmmer.org/
+# Copyright (C) 2015 Howard Hughes Medical Institute.
+# Freely distributed under the GNU General Public License (GPLv3).
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+# query sequence file:             /tmp/tmpYWzicI/files/000/dataset_20.dat
+# target HMM database:             /tmp/tmpYWzicI/files/000/dataset_19.dat
+# per-seq hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_22.dat
+# per-dom hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_23.dat
+# pfam-style tabular hit output:   /tmp/tmpYWzicI/files/000/dataset_24.dat
+# max ASCII text line length:      unlimited
+# Vit filter P threshold:       <= 0.001
+# Fwd filter P threshold:       <= 1e-05
+# random number seed set to:       4
+# number of worker threads:        1
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+
+Query:       humanchr1/239220001-239550000  [L=330000]
+Scores for complete sequence (score includes all domains):
+   --- full sequence ---   --- best 1 domain ---    -#dom-
+    E-value  score  bias    E-value  score  bias    exp  N  Model    Description
+    ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
+      1e-17   51.0  28.5    2.7e-12   33.7   0.7    9.6  5  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+
+
+Domain annotation for each model (and alignments):
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+   #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
+ ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
+   1 ?   -4.2   0.1         1         1      30      54 ..   80044   80068 ..   80030   80073 .. 0.80
+   2 ?   -6.6   3.3         1         1      13      71 ..  154012  154072 ..  154011  154076 .. 0.75
+   3 !   27.4   0.7   2.4e-10   2.4e-10       1      44 [.  174456  174514 ..  174456  174577 .. 0.62
+   4 !   33.7   0.7   2.7e-12   2.7e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.86
+   5 ?    2.9   0.7     0.011     0.011      27      75 ..  304060  304107 ..  304021  304109 .. 0.61
+
+  Alignments for each domain:
+  == domain 1  score: -4.2 bits;  conditional E-value: 1
+                                      xxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1    30 ttgccattacttttaatggcaaaaa 54
+                                      t g catt  ttt aatggcaaa a
+  humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
+                                      45789****************9966 PP
+
+  == domain 2  score: -6.6 bits;  conditional E-value: 1
+                                       xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71
+                                       aaaagta tt +   ttttgc att      a  tttaa  gcaaa a +    tta  tttgca
+  humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
+                                       78999999999999999999999984444444457777777899998876....77777888876 PP
+
+  == domain 3  score: 27.4 bits;  conditional E-value: 2.4e-10
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44
+                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt               a
+  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514
+                                       79***************************************964443333333333330 PP
+
+  == domain 4  score: 33.7 bits;  conditional E-value: 2.7e-12
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80
+                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a  +  a t ctttt caccaa ctaa
+  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
+                                       56899******************************************963333233345578**************996 PP
+
+  == domain 5  score: 2.9 bits;  conditional E-value: 0.011
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75
+                                       tttt g c  ta  tt a tgg aaaaa ++ca tta ttttgca  aa
+  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107
+                                       222222222222.3455779************************98765 PP
+
+
+
+Internal pipeline statistics summary:
+-------------------------------------
+Query sequence(s):                         1  (330000 residues searched)
+Target model(s):                           1  (80 nodes)
+Passed MSV filter:                         1  (1); expected 0.0 (0.02)
+Passed bias filter:                        1  (1); expected 0.0 (0.02)
+Passed Vit filter:                         1  (1); expected 0.0 (0.001)
+Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
+Initial search space (Z):                  1  [actual number of targets]
+Domain search space  (domZ):               1  [number of targets reported over threshold]
+# CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16
+# Mc/sec: 165.00
+//
+[ok]