Mercurial > repos > iuc > hmmer_nhmmer
view test-data/MADE1.out @ 2:ae4754e7c97a draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit a1a31824fc24d5e652c263b998b7f2363cbd7610
author | iuc |
---|---|
date | Wed, 04 Apr 2018 14:01:13 -0400 |
parents | f239ab5f45f4 |
children | be0cc39776f9 |
line wrap: on
line source
# hmmscan :: search sequence(s) against a profile database # HMMER 3.1b2 (February 2015); http://hmmer.org/ # Copyright (C) 2015 Howard Hughes Medical Institute. # Freely distributed under the GNU General Public License (GPLv3). # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - # query sequence file: /tmp/tmpYWzicI/files/000/dataset_20.dat # target HMM database: /tmp/tmpYWzicI/files/000/dataset_19.dat # per-seq hits tabular output: /tmp/tmpYWzicI/files/000/dataset_22.dat # per-dom hits tabular output: /tmp/tmpYWzicI/files/000/dataset_23.dat # pfam-style tabular hit output: /tmp/tmpYWzicI/files/000/dataset_24.dat # max ASCII text line length: unlimited # Vit filter P threshold: <= 0.001 # Fwd filter P threshold: <= 1e-05 # random number seed set to: 4 # number of worker threads: 1 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Query: humanchr1/239220001-239550000 [L=330000] Scores for complete sequence (score includes all domains): --- full sequence --- --- best 1 domain --- -#dom- E-value score bias E-value score bias exp N Model Description ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- 1e-17 51.0 28.5 2.7e-12 33.7 0.7 9.6 5 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon Domain annotation for each model (and alignments): >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ---- 1 ? -4.2 0.1 1 1 30 54 .. 80044 80068 .. 80030 80073 .. 0.80 2 ? -6.6 3.3 1 1 13 71 .. 154012 154072 .. 154011 154076 .. 0.75 3 ! 27.4 0.7 2.4e-10 2.4e-10 1 44 [. 174456 174514 .. 174456 174577 .. 0.62 4 ! 33.7 0.7 2.7e-12 2.7e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.86 5 ? 2.9 0.7 0.011 0.011 27 75 .. 304060 304107 .. 304021 304109 .. 0.61 Alignments for each domain: == domain 1 score: -4.2 bits; conditional E-value: 1 xxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 30 ttgccattacttttaatggcaaaaa 54 t g catt ttt aatggcaaa a humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068 45789****************9966 PP == domain 2 score: -6.6 bits; conditional E-value: 1 xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71 aaaagta tt + ttttgc att a tttaa gcaaa a + tta tttgca humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072 78999999999999999999999984444444457777777899998876....77777888876 PP == domain 3 score: 27.4 bits; conditional E-value: 2.4e-10 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt a humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514 79***************************************964443333333333330 PP == domain 4 score: 33.7 bits; conditional E-value: 2.7e-12 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a + a t ctttt caccaa ctaa humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466 56899******************************************963333233345578**************996 PP == domain 5 score: 2.9 bits; conditional E-value: 0.011 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75 tttt g c ta tt a tgg aaaaa ++ca tta ttttgca aa humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107 222222222222.3455779************************98765 PP Internal pipeline statistics summary: ------------------------------------- Query sequence(s): 1 (330000 residues searched) Target model(s): 1 (80 nodes) Passed MSV filter: 1 (1); expected 0.0 (0.02) Passed bias filter: 1 (1); expected 0.0 (0.02) Passed Vit filter: 1 (1); expected 0.0 (0.001) Passed Fwd filter: 1 (1); expected 0.0 (1e-05) Initial search space (Z): 1 [actual number of targets] Domain search space (domZ): 1 [number of targets reported over threshold] # CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16 # Mc/sec: 165.00 // [ok]