Mercurial > repos > iuc > hmmer_nhmmscan

comparison test-data/nhmmer.out @ 0:a6098dd0cb46 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 4261b86af790a3535c0b9a8122f92225f8f67b47
author iuc
date Sat, 25 Jun 2016 15:07:32 -0400
parents
children f68b43be32d7
comparison
equal deleted inserted replaced
-1:000000000000 0:a6098dd0cb46
1 # nhmmer :: search a DNA model or alignment against a DNA database
2 # HMMER 3.1b2 (February 2015); http://hmmer.org/
3 # Copyright (C) 2015 Howard Hughes Medical Institute.
4 # Freely distributed under the GNU General Public License (GPLv3).
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query file: /tmp/tmpprnvgs/files/000/dataset_1.dat
7 # target sequence database: /tmp/tmpprnvgs/files/000/dataset_2.dat
8 # hits tabular output: /tmp/tmpprnvgs/files/000/dataset_4.dat
9 # hits output in Dfam format: None
10 # max ASCII text line length: unlimited
11 # SSV filter P threshold: <= 0.02
12 # Vit filter P threshold: <= 0.001
13 # Fwd filter P threshold: <= 1e-05
14 # input query is asserted as: DNA
15 # random number seed set to: 4
16 # number of worker threads: 1
17 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
18
19 Query: MADE1 [M=80]
20 Accession: DF0000629.2
21 Description: MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
22 Scores for complete hits:
23 E-value score bias Sequence start end Description
24 ------- ------ ----- -------- ----- ----- -----------
25 1.2e-10 38.6 7.4 humanchr1/239220001-239550000 302390 302466
26 7.8e-08 29.6 8.3 humanchr1/239220001-239550000 174456 174498
27 1.2e-07 28.9 6.0 humanchr1/239220001-239550000 302466 302390
28 7.2e-06 23.3 7.0 humanchr1/239220001-239550000 174493 174456
29 ------ inclusion threshold ------
30 1.4 6.3 7.0 humanchr1/239220001-239550000 304073 304104
31
32
33 Annotation for each hit (and alignments):
34 >> humanchr1/239220001-239550000
35 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
36 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
37 ! 38.6 7.4 1.2e-10 4 80 .] 302390 302466 .. 302387 302466 .. 330000 0.87
38
39 Alignment:
40 score: 38.6 bits
41 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
42 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
43 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc a aaa g a t ctttt caccaa ctaa
44 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttA-AAA--GTA-ATGCTTTTACACCAATCTAA 302466
45 899******************************************955533.443..334.4689***********99986 PP
46
47 >> humanchr1/239220001-239550000
48 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
49 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
50 ! 29.6 8.3 7.8e-08 1 43 [. 174456 174498 .. 174456 174518 .. 330000 0.92
51
52 Alignment:
53 score: 29.6 bits
54 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
55 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
56 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
57 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
58 589************************************9975 PP
59
60 >> humanchr1/239220001-239550000
61 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
62 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
63 ! 28.9 6.0 1.2e-07 1 77 [. 302466 302390 .. 302466 302387 .. 330000 0.74
64
65 Alignment:
66 score: 28.9 bits
67 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx................xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
68 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt................aatggcaaaaaccgcaattacttttgcaccaacc 77
69 ttag ttggtg aaaag cattactttt aatggcaaaaacc caatt ttttgcacc acc
70 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAG----------------CATTACTTTTaaaagcaattaaaagcAATGGCAAAAACCACAATTGATTTTGCACCGACC 302390
71 68999999999999998................5666777776222222222222222268****************************9998 PP
72
73 >> humanchr1/239220001-239550000
74 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
75 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
76 ! 23.3 7.0 7.2e-06 43 80 .] 174493 174456 .. 174513 174456 .. 330000 0.91
77
78 Alignment:
79 score: 23.3 bits
80 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
81 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
82 taatg caaaaacc caattacttttgcac aacctaa
83 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
84 689********************************985 PP
85
86 >> humanchr1/239220001-239550000
87 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to sq len acc
88 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
89 ? 6.3 7.0 1.4 41 72 .. 304073 304104 .. 304053 304109 .. 330000 0.85
90
91 Alignment:
92 score: 6.3 bits
93 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
94 MADE1 41 tttaatggcaaaaaccgcaattacttttgcac 72
95 tt a tgg aaaaa ca tta ttttgca
96 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCAT 304104
97 455779************************86 PP
98
99
100
101 Internal pipeline statistics summary:
102 -------------------------------------
103 Query model(s): 1 (80 nodes)
104 Target sequences: 1 (660000 residues searched)
105 Residues passing SSV filter: 61794 (0.0936); expected (0.02)
106 Residues passing bias filter: 46199 (0.07); expected (0.02)
107 Residues passing Vit filter: 2752 (0.00417); expected (0.001)
108 Residues passing Fwd filter: 2526 (0.00383); expected (1e-05)
109 Total number of hits: 5 (0.000405)
110 # CPU time: 0.03u 0.00s 00:00:00.03 Elapsed: 00:00:00.03
111 # Mc/sec: 1760.00
112 //
113 [ok]