# HG changeset patch # User iuc # Date 1511651829 18000 # Node ID 288db50d1fb9a883aeb9c28b7bee7f7e5647e3ef # Parent 05ee0a74faef23b1bcb39add2a8579842873cf9a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/iqtree/ commit d4423a8641e86485dde733e8148c5bced4d8410c diff -r 05ee0a74faef -r 288db50d1fb9 iqtree.xml --- a/iqtree.xml Wed Nov 15 12:45:24 2017 -0500 +++ b/iqtree.xml Sat Nov 25 18:17:09 2017 -0500 @@ -1,4 +1,4 @@ - + Phylogenomic / evolutionary tree construction from multiple sequences iqtree @@ -6,7 +6,7 @@ -
+
- -st NT2AA tells IQ-TREE to translate protein-coding DNA into AA sequences and then subsequent analysis will work on the AA sequences. You can also use a genetic code like -st NT2AA5 for the Invertebrate Mitochondrial Code (see genetic code table).]]> - - - - - - - +
-st NT2AA tells IQ-TREE to translate protein-coding DNA into AA sequences and then subsequent analysis will work on the AA sequences. You can also use a genetic code like -st NT2AA5 for the Invertebrate Mitochondrial Code (see genetic code table).]]> + + + + + + + -
-
+
+
-
-
+
+
- - - - - - - - - - - - + + + + + + + + + + + Note: Only TEST and custom models that do not rely on MF can be used in conjunction with bootstrap parameters (-b)

+IQ-TREE also works for codon, binary and morphogical data. @@ -348,174 +347,175 @@
TESTONLY
]]> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+
+ +
+
+ + + + + + + + + + + + + +
+
+ + + +
+
+ + +
-
- -
-
- - - - - - - - - - - - - -
-
- - - -
-
- - - -
-
-
-
- - - - - - - - - - -
-
- - - -
-
- - - - -
-
- - - - - - -
-
- - - -
-
- - - - - - - - - - -
-
-
-
- - - - - - - - - - - - - -
-
- - - -
-
-
- - - - - -
+
+
+
+ + + + + + + + + + +
+
+ + + +
+
+ + + + +
+
+ + + + + + +
+
+ + + +
+
+ + + + + + + + + + +
+
+
+
+ + + + + + + + + + + + + +
+
+ + + +
+
+
+ + + + + +
- - - - - - + + + + + + - + @@ -523,7 +523,7 @@ - + @@ -560,6 +560,74 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + @@ -606,21 +674,21 @@ :: - >Frog + >Frog AAATTTGGTCCTGTGATTCAGCAGTGAT - >Turtle + >Turtle CTTCCACACCCCAGGACTCAGCAGTGAT - >Bird + >Bird CTACCACACCCCAGGACTCAGCAGTAAT - >Human + >Human CTACCACACCCCAGGAAACAGCAGTGAT - >Cow + >Cow CTACCACACCCCAGGAAACAGCAGTGAC - >Whale + >Whale CTACCACGCCCCAGGACACAGCAGTGAT - >Mouse + >Mouse CTACCACACCCCAGGACTCAGCAGTGAT - + **NOTE**: If you have raw sequences, you need to first apply alignment programs like MAFFT_ or ClustalW_ to align the sequences, before feeding them into IQ-TREE. .. _MAFFT: http://mafft.cbrc.jp/alignment/software/ @@ -656,10 +724,10 @@ * **-merit** asserts the type of optimality criterion * **-bb** defines the number of replicates - + Each of these parameters are available under the relevant sub-sections in the main tool interface. - + At the end of the run IQ-TREE will write several output files including: * **example.phy.iqtree**: the main report file that is self-readable. You should look at this file to see the computational results. It also contains a textual representation of the final tree (see below). @@ -706,7 +774,7 @@ +----------| | +----------------Platypus +---| - +-------------Opossum + +-------------Opossum This makes sense as the mammals (**Human** to **Opossum**) form a clade, whereas the reptiles **Turtle** to **Crocodile**) and **Bird** form a separate sister clade. Here the tree is drawn at the *outgroup* Lungfish which is more accient than other species in this example. However, please note that IQ-TREE always produces an **unrooted tree** as it knows nothing about this biological background; IQ-TREE simply draws the tree this way as **LngfishAu** is the first sequence occuring in the alignment. @@ -731,15 +799,15 @@ :: - iqtree -s coding_gene.phy -st CODON + iqtree -s coding_gene.phy -st CODON If your alignment length is not divisible by 3, IQ-TREE will stop with an error message. IQ-TREE will group sites 1,2,3 into codon site 1; sites 4,5,6 to codon site 2; etc. Moreover, any codon, which has at least one gap/unknown/ambiguous nucleotide, will be treated as unknown codon character. Note that the above command assumes the standard genetic code. If your sequences follow 'The Invertebrate Mitochondrial Code', then run: :: - - iqtree -s coding_gene.phy -st CODON5 + + iqtree -s coding_gene.phy -st CODON5 Note that ModelFinder works for codon alignments. IQ-TREE version >= 1.5.4 will automatically invokes ModelFinder to find the best-fit codon model. @@ -749,7 +817,7 @@ To overcome the computational burden required by the nonparametric bootstrap, IQ-TREE introduces an ultrafast bootstrap approximation (UFBoot) ([Minh et al., 2013]) that is orders of magnitude faster than the standard procedure and provides relatively unbiased branch support values. Citation for UFBoot: - B.Q. Minh, M.A.T. Nguyen, and A. von Haeseler (2013) Ultrafast approximation for phylogenetic bootstrap. _Mol. Biol. Evol., 30:1188-1195. + B.Q. Minh, M.A.T. Nguyen, and A. von Haeseler (2013) Ultrafast approximation for phylogenetic bootstrap. _Mol. Biol. Evol., 30:1188-1195. :: @@ -788,7 +856,7 @@ iqtree -s example.phy -m TIM2+I+G -b 100 **-b** specifies the number of bootstrap replicates where 100 -is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure. +is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure. @@ -801,7 +869,7 @@ iqtree -s example.phy -m TIM2+I+G -alrt 1000 -**-alrt** specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended. +**-alrt** specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended. IQ-TREE also supports other tests such as the aBayes test (Anisimova et al., 2011) and the local bootstrap test (Adachi and Hasegawa, 1996).