Mercurial > repos > iuc > khmer_normalize_by_median
comparison normalize-by-median.xml @ 7:557cc16931f4 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/khmer commit 7de685f4763d988a5a9abce4a9c2b4714daaf165"
author | iuc |
---|---|
date | Wed, 18 Dec 2019 16:01:09 -0500 |
parents | 73314e26dcfd |
children | e84073b420a8 |
comparison
equal
deleted
inserted
replaced
6:bfd859f04a89 | 7:557cc16931f4 |
---|---|
1 <tool id="khmer_normalize_by_median" name="Normalize By Median" version="@WRAPPER_VERSION@.0"> | 1 <tool id="khmer_normalize_by_median" name="khmer: Normalize By Median" version="@WRAPPER_VERSION@@TOOL_VERSION@"> |
2 <description>Filter reads using digital normalization via k-mer abundances</description> | 2 <description>Filter reads using digital normalization via k-mer abundances</description> |
3 <macros> | 3 <macros> |
4 <token name="@BINARY@">normalize-by-median.py</token> | 4 <token name="@BINARY@">normalize-by-median.py</token> |
5 <import>macros.xml</import> | 5 <import>macros.xml</import> |
6 </macros> | 6 </macros> |
7 <expand macro="requirements" /> | 7 <expand macro="requirements" /> |
8 <expand macro="stdio" /> | 8 <expand macro="stdio" /> |
9 <expand macro="version" /> | 9 <expand macro="version" /> |
10 <command><![CDATA[ | 10 <command><![CDATA[ |
11 set -xu && | 11 #import re |
12 #for $num, $input in enumerate($inputs) | 12 set -u && |
13 ln -s ${input} sequence-${num} && | |
14 #end for | |
15 mkdir output && | 13 mkdir output && |
16 cd output && | 14 |
15 @LINK_SEQUENCES@ | |
16 cd output/ && | |
17 normalize-by-median.py | 17 normalize-by-median.py |
18 ${paired_switch} | 18 ${paired_switch} |
19 ${force_single_switch} | 19 ${force_single_switch} |
20 @TABLEPARAMS@ | 20 @TABLEPARAMS@ |
21 --cutoff=${cutoff} | 21 --cutoff=${cutoff} |
27 #end if | 27 #end if |
28 #if $countgraph_to_load | 28 #if $countgraph_to_load |
29 --loadgraph=${countgraph_to_load} | 29 --loadgraph=${countgraph_to_load} |
30 #end if | 30 #end if |
31 --report=${report} | 31 --report=${report} |
32 ../sequence-* | 32 $gzip |
33 @USE_SEQUENCES@ | |
33 ]]> | 34 ]]> |
34 </command> | 35 </command> |
35 <inputs> | 36 <inputs> |
36 <expand macro="input_sequences_filenames" /> | 37 <expand macro="input_sequences_filenames" /> |
37 <param name="paired_switch" type="boolean" checked="false" truevalue="--paired" falsevalue="" | 38 <param argument="--paired" name="paired_switch" type="boolean" checked="false" truevalue="--paired" falsevalue="" |
38 label="Require all sequences be properly paired?" | 39 label="Require all sequences be properly paired?" |
39 help="(--paired) The tool will fail if given improperly paired reads and this option is selected." /> | 40 help="The tool will fail if given improperly paired reads and this option is selected." /> |
40 <param name="force_single_switch" type="boolean" checked="false" truevalue="--force_single" falsevalue="" | 41 <param argument="--force_single" name="force_single_switch" type="boolean" checked="false" truevalue="--force_single" falsevalue="" |
41 label="Ignore all pairing information?" | 42 label="Ignore all pairing information?" |
42 help="(--paired) By default this tool process reads in a pair-aware manner. This option disables that behavior." /> | 43 help="By default this tool process reads in a pair-aware manner. This option disables that behavior." /> |
43 <param name="unpaired_reads_filename" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" optional="true" | 44 <param argument="--unpaired-reads" name="unpaired_reads_filename" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" optional="true" |
44 label="Extra unpaired reads" | 45 label="Extra unpaired reads" |
45 help="(--unpaired-reads) If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." /> | 46 help="If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." /> |
46 <param name="countgraph_to_load" type="data" format="oxlicg" optional="true" | 47 <param argument="--loadgraph" name="countgraph_to_load" type="data" format="oxlicg" optional="true" |
47 label="Optional k-mer countgraph" | 48 label="Optional k-mer countgraph" |
48 help="(--loadgraph) The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." /> | 49 help="The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." /> |
49 <param name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="(--savegraph)" /> | 50 <param argument="--savegraph" name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="" /> |
50 <param name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="(--cutoff)" /> | 51 <param argument="--cutoff" name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="" /> |
51 <expand macro="tableinputs" /> | 52 <expand macro="tableinputs" /> |
52 </inputs> | 53 </inputs> |
53 <outputs> | 54 <outputs> |
54 <data name="countgraph" format="oxlicg" label="${tool.name} k-mer countgraph"> | 55 <data name="countgraph" format="oxlicg" label="${tool.name} k-mer countgraph"> |
55 <filter>save_countgraph == True</filter> | 56 <filter>save_countgraph == True</filter> |
56 </data> | 57 </data> |
57 <data name="report" format="txt" label="${tool.name} report" /> | 58 <data name="report" format="txt" label="${tool.name} report" /> |
58 <collection name="sequences" type="list"> | 59 <expand macro="output_sequences" extension="keep"/> |
59 <discover_datasets pattern="__name__" directory="output" /> | |
60 </collection> | |
61 </outputs> | 60 </outputs> |
62 <tests> | 61 <tests> |
63 <test> | 62 <test> |
64 <param name="inputs" value="test-abund-read-2.fa"/> | 63 <param name="inputs" value="test-abund-read-2.fa" ftype="fasta"/> |
65 <param name="type" value="specific" /> | 64 <param name="type" value="specific" /> |
66 <param name="cutoff" value="1" /> | 65 <param name="cutoff" value="1" /> |
67 <param name="ksize" value="17" /> | 66 <param name="ksize" value="17" /> |
68 <output name="report" file="normalize-by-median.report.txt" /> | 67 <output name="report" file="normalize-by-median.report.txt" /> |
69 <output_collection name="sequences" type="list"> | 68 <output_collection name="sequences" type="list"> |
70 <element name="sequence-0.keep"> | 69 <element name="test-abund-read-2.fa" ftype="fasta"> |
71 <assert_contents> | 70 <assert_contents> |
72 <has_text text="GGTTGACGGGGCTCAGGGGG" /> | 71 <has_text text="GGTTGACGGGGCTCAGGGGG" /> |
73 </assert_contents> | 72 </assert_contents> |
74 </element> | 73 </element> |
75 </output_collection> | 74 </output_collection> |
76 </test> | 75 </test> |
77 <test> | 76 <test> |
78 <param name="inputs" value="test-abund-read-2.fa" /> | 77 <param name="inputs" value="test-abund-read-2.fa.gz" ftype="fasta.gz"/> |
79 <param name="type" value="specific" /> | 78 <param name="type" value="specific" /> |
80 <param name="cutoff" value="2" /> | 79 <param name="cutoff" value="2" /> |
81 <param name="ksize" value="17" /> | 80 <param name="ksize" value="17" /> |
82 <output name="report" file="normalize-by-median.c2.report.txt" /> | 81 <output name="report" file="normalize-by-median.c2.report.txt" /> |
83 <output_collection name="sequences" type="list"> | 82 <output_collection name="sequences" type="list"> |
84 <element name="sequence-0.keep"> | 83 <element name="test-abund-read-2.fa.gz" ftype="fasta.gz"> |
85 <assert_contents> | 84 <assert_contents> |
86 <has_text text="GGTTGACGGGGCTCAGGGGG" /> | 85 <has_text text="GGTTGACGGGGCTCAGGGGG" /> |
87 <has_text text="GGTTGACGGGGCTCAGGG" /> | 86 <has_text text="GGTTGACGGGGCTCAGGG" /> |
88 </assert_contents> | 87 </assert_contents> |
89 </element> | 88 </element> |
90 </output_collection> | 89 </output_collection> |
91 </test> | 90 </test> |
92 <test> | 91 <test> |
93 <param name="inputs" value="test-abund-read-paired.fa" /> | 92 <param name="inputs" value="test-abund-read-paired.fa" ftype="fasta"/> |
94 <param name="type" value="specific" /> | 93 <param name="type" value="specific" /> |
95 <param name="cutoff" value="1" /> | 94 <param name="cutoff" value="1" /> |
96 <param name="ksize" value="17" /> | 95 <param name="ksize" value="17" /> |
97 <param name="paired" value="true" /> | 96 <param name="paired" value="true" /> |
98 <output name="report" file="normalize-by-median.paired.report.txt" /> | 97 <output name="report" file="normalize-by-median.paired.report.txt" /> |
99 <output_collection name="sequences" type="list"> | 98 <output_collection name="sequences" type="list"> |
100 <element name="sequence-0.keep"> | 99 <element name="test-abund-read-paired.fa" ftype="fasta"> |
101 <assert_contents> | 100 <assert_contents> |
102 <has_text text="GGTTGACGGGGCTCAGGGGG" /> | 101 <has_text text="GGTTGACGGGGCTCAGGGGG" /> |
103 <has_text text="GGTTGACGGGGCTCAGGG" /> | 102 <has_text text="GGTTGACGGGGCTCAGGG" /> |
104 </assert_contents> | 103 </assert_contents> |
105 </element> | 104 </element> |