Mercurial > repos > iuc > khmer_normalize_by_median

comparison normalize-by-median.xml @ 10:4d23ab83ea29 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/khmer commit 238d0992c63de53623c4fc05eec8bd8d67001997
author iuc
date Thu, 03 Oct 2024 13:46:42 +0000
parents b1fe2ef3d244
children
comparison
equal deleted inserted replaced
9:b1fe2ef3d244 10:4d23ab83ea29
1 <tool id="khmer_normalize_by_median" name="khmer: Normalize By Median" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> 1 <tool id="khmer_normalize_by_median" name="khmer: Normalize By Median" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">
2 <description>Filter reads using digital normalization via k-mer abundances</description> 2 <description>Filter reads using digital normalization via k-mer abundances</description>
3 <expand macro="bio_tools"/>
4 <macros> 3 <macros>
5 <token name="@BINARY@">normalize-by-median.py</token> 4 <token name="@BINARY@">normalize-by-median.py</token>
6 <import>macros.xml</import> 5 <import>macros.xml</import>
7 </macros> 6 </macros>
7 <expand macro="bio_tools"/>
8 <expand macro="requirements" /> 8 <expand macro="requirements" />
9 <expand macro="stdio" /> 9 <expand macro="stdio" />
10 <expand macro="version" /> 10 <expand macro="version" />
11 <command><![CDATA[ 11 <command><![CDATA[
12 #import re 12 #import re
47 help="If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." /> 47 help="If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." />
48 <param argument="--loadgraph" name="countgraph_to_load" type="data" format="oxlicg" optional="true" 48 <param argument="--loadgraph" name="countgraph_to_load" type="data" format="oxlicg" optional="true"
49 label="Optional k-mer countgraph" 49 label="Optional k-mer countgraph"
50 help="The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." /> 50 help="The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." />
51 <param argument="--savegraph" name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="" /> 51 <param argument="--savegraph" name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="" />
52 <param argument="--cutoff" name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="" /> 52 <param argument="--cutoff" type="integer" min="1" value="20" label="Cutoff" help="" />
53 <expand macro="tableinputs" /> 53 <expand macro="tableinputs" />
54 </inputs> 54 </inputs>
55 <outputs> 55 <outputs>
56 <data name="countgraph" format="oxlicg" label="${tool.name} k-mer countgraph"> 56 <data name="countgraph" format="oxlicg" label="${tool.name} on ${on_string}: k-mer countgraph">
57 <filter>save_countgraph == True</filter> 57 <filter>save_countgraph == True</filter>
58 </data> 58 </data>
59 <data name="report" format="txt" label="${tool.name} report" /> 59 <data name="report" format="csv" label="${tool.name} on ${on_string}: report" />
60 <expand macro="output_sequences" extension="keep"/> 60 <expand macro="output_sequences" extension="keep"/>
61 </outputs> 61 </outputs>
62 <tests> 62 <tests>
63 <test> 63 <test expect_num_outputs="2">
64 <param name="inputs" value="test-abund-read-2.fa" ftype="fasta"/> 64 <param name="inputs" value="test-abund-read-2.fa" ftype="fasta"/>
65 <param name="type" value="specific" /> 65 <param name="type" value="specific" />
66 <param name="cutoff" value="1" /> 66 <param name="cutoff" value="1" />
67 <param name="ksize" value="17" /> 67 <param name="ksize" value="17" />
68 <output name="report" file="normalize-by-median.report.txt" /> 68 <output name="report" file="normalize-by-median.report.txt" />
72 <has_text text="GGTTGACGGGGCTCAGGGGG" /> 72 <has_text text="GGTTGACGGGGCTCAGGGGG" />
73 </assert_contents> 73 </assert_contents>
74 </element> 74 </element>
75 </output_collection> 75 </output_collection>
76 </test> 76 </test>
77 <test> 77 <test expect_num_outputs="2">
78 <param name="inputs" value="test-abund-read-2.fa.gz" ftype="fasta.gz"/> 78 <param name="inputs" value="test-abund-read-2.fa.gz" ftype="fasta.gz"/>
79 <param name="type" value="specific" /> 79 <param name="type" value="specific" />
80 <param name="cutoff" value="2" /> 80 <param name="cutoff" value="2" />
81 <param name="ksize" value="17" /> 81 <param name="ksize" value="17" />
82 <output name="report" file="normalize-by-median.c2.report.txt" /> 82 <output name="report" file="normalize-by-median.c2.report.txt" />
87 <has_text text="GGTTGACGGGGCTCAGGG" /> 87 <has_text text="GGTTGACGGGGCTCAGGG" />
88 </assert_contents> 88 </assert_contents>
89 </element> 89 </element>
90 </output_collection> 90 </output_collection>
91 </test> 91 </test>
92 <test> 92 <test expect_num_outputs="3">
93 <param name="inputs" value="test-abund-read-paired.fa" ftype="fasta"/> 93 <param name="inputs" value="test-abund-read-paired.fa" ftype="fasta"/>
94 <param name="type" value="specific" /> 94 <param name="type" value="specific" />
95 <param name="cutoff" value="1" /> 95 <param name="cutoff" value="1" />
96 <param name="ksize" value="17" /> 96 <param name="ksize" value="17" />
97 <param name="paired" value="true" /> 97 <param name="paired" value="true" />
98 <param name="save_countgraph" value="true"/>
98 <output name="report" file="normalize-by-median.paired.report.txt" /> 99 <output name="report" file="normalize-by-median.paired.report.txt" />
99 <output_collection name="sequences" type="list"> 100 <output_collection name="sequences" type="list">
100 <element name="test-abund-read-paired.fa" ftype="fasta"> 101 <element name="test-abund-read-paired.fa" ftype="fasta">
101 <assert_contents> 102 <assert_contents>
102 <has_text text="GGTTGACGGGGCTCAGGGGG" /> 103 <has_text text="GGTTGACGGGGCTCAGGGGG" />
103 <has_text text="GGTTGACGGGGCTCAGGG" /> 104 <has_text text="GGTTGACGGGGCTCAGGG" />
104 </assert_contents> 105 </assert_contents>
105 </element> 106 </element>
106 </output_collection> 107 </output_collection>
108 <output name="countgraph">
109 <assert_contents>
110 <has_size size="1k"/>
111 </assert_contents>
112 </output>
107 </test> 113 </test>
108 </tests> 114 </tests>
109 <help><![CDATA[ 115 <help><![CDATA[
110 Do digital normalization (remove mostly redundant sequences) 116 Do digital normalization (remove mostly redundant sequences)
111 117