# HG changeset patch
# User iuc
# Date 1525767781 14400
# Node ID d35cc8e07d00a14b1aeb5a1cebfd34bd7de7cb47

planemo upload for repository https://github.com/AbeelLab/lorikeet commit 01d9bfef91bbdfbdaa31c3fc023504181132c001

diff -r 000000000000 -r d35cc8e07d00 lorikeet.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/lorikeet.xml	Tue May 08 04:23:01 2018 -0400
@@ -0,0 +1,75 @@
+<tool id="lorikeet_spoligotype" name="lorikeet spoligotyping" version="@TOOL_VERSION@+galaxy0" profile="17.01">
+  <description>M. tuberculosis DNA fingerprinting</description>
+
+  <macros>
+    <token name="@TOOL_VERSION@">17</token>
+  </macros>
+
+  <requirements>
+    <requirement type="package" version="@TOOL_VERSION@">lorikeet</requirement>
+  </requirements>
+
+  <command detect_errors="exit_code"><![CDATA[
+    #set $input_file = 'input.' + $input.extension
+    ln -s '${input}' $input_file &&
+    lorikeet spoligotype
+    -o '${output_txt}'
+    $input_file
+    #if $spacer_source.source_type == 'file':
+    -s '${spacer_source.spacer}'
+    #end if
+    ]]>
+  </command>
+  <inputs>
+    <param name="input" label="Input sequences" type="data" format="bam" help="Reads of sample(s) being spoligotyped" />
+    <conditional name="spacer_source">
+      <param type="select" name="source_type" label="Source for spacer sequences">
+        <option selected="true" value="builtin">Built-in</option>
+        <option value="file">File with custom spacers</option>
+      </param>
+      <when value="builtin">
+      </when>
+      <when value="file">
+        <param argument="--spacer" type="data" format="fasta" label="Spacer file" help="FASTA format file containing customer spacer library" />
+      </when>
+    </conditional>
+  </inputs>
+  <outputs>
+    <data name="output_txt" format="txt" label="Spoligotype on ${on_string}" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input" value="input.bam" ftype="bam" />
+      <output name="output_txt">
+        <assert_contents>
+          <has_text text="1111111111 1111111011 1111111111 1100001111 111" />
+        </assert_contents>
+      </output>
+    </test>
+    <test>
+      <param name="input" value="input.bam" ftype="bam" />
+      <param name="source_type" value="file" />
+      <param name="spacer" value="custom_spacers.fasta" ftype="fasta" />
+      <output name="output_txt">
+        <assert_contents>
+          <has_text text="1111111111 0000000000 0000000000 0000000000 000" />
+        </assert_contents>
+      </output>
+    </test>
+  </tests>
+  <help><![CDATA[
+Lorikeet_ is a tool for digital spoligotyping_ of M. tuberculosis strains
+from Illumina data. Input is a file of Illumina reads and output is
+a spoligotyping report.
+
+While by default lorikeet uses its own built-in collection of spacer
+sequences, a custom file of spacers can be provided if necessary.
+
+.. _Lorikeet: https://github.com/AbeelLab/lorikeet
+.. _spoligotyping: https://link.springer.com/protocol/10.1007%2F978-1-60327-999-4_10
+    ]]>
+  </help>
+  <citations>
+    <citation type="doi">10.1371/journal.pmed.1001880</citation>
+  </citations>
+</tool>
diff -r 000000000000 -r d35cc8e07d00 test-data/custom_spacers.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/custom_spacers.fasta	Tue May 08 04:23:01 2018 -0400
@@ -0,0 +1,20 @@
+>spacers_1
+ATAGAGGGTCGCCGGCTCTGGATCA
+>spacers_2
+CCTCATGCTTGGGCGACAGCTTTTG
+>spacers_3
+CCGTGCTTCCAGTGATCGCCTTCTA
+>spacers_4
+ACGTCATACGCCGACCAATCATCAG
+>spacers_5
+TTTTCTGACCACTTGTGCGGGATTA
+>spacers_6
+CGTCGTCATTTCCGGCTTCAATTTC
+>spacers_7
+GAGGAGAGCGAGTACTCGGGGCTGC
+>spacers_8
+CGTGAAACCGCCCCCAGCCTCGCCG
+>spacers_9
+ACTCGGAATCCCATGTGCTGACAGC
+>spacers_10
+TCGACACCCGCTCTAGTTGACTTCC
diff -r 000000000000 -r d35cc8e07d00 test-data/input.bam
Binary file test-data/input.bam has changed