Mercurial > repos > iuc > megahit

changeset 3:98242353faa4 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/megahit commit aaac63680661511b90969309434043ce946d6501
author iuc
date Mon, 14 May 2018 06:11:34 -0400
parents edc663aadfa8
children de387b2b2803
files megahit_wrapper.xml test-data/single_result.fa
diffstat 2 files changed, 42 insertions(+), 20 deletions(-) [+]
line wrap: on
line diff
--- a/megahit_wrapper.xml	Fri Nov 17 08:10:37 2017 -0500
+++ b/megahit_wrapper.xml	Mon May 14 06:11:34 2018 -0400
@@ -1,5 +1,5 @@
 <?xml version='1.0' encoding='utf-8'?>
-<tool id="megahit" name="MEGAHIT" version="@VERSION@.2">
+<tool id="megahit" name="MEGAHIT" version="@VERSION@.3">
     <description>for metagenomics assembly</description>
     <macros>
         <token name="@VERSION@">1.1.2</token>
@@ -14,8 +14,14 @@
         -1 '${input_option.fastq_input1}'
         -2 '${input_option.fastq_input2}'
     #else if $input_option.choice == 'paired_collection'
-        -1 ${ ','.join(['"%s"' % x.forward for x in $input_option.fastq_input1]) }
-        -2 ${ ','.join(['"%s"' % x.reverse for x in $input_option.fastq_input1]) }
+
+        #if $input_option.batchmode.processmode == 'merge':
+            -1 ${ ','.join(['"%s"' % x.forward for x in $input_option.batchmode.pair_input_list]) }
+            -2 ${ ','.join(['"%s"' % x.reverse for x in $input_option.batchmode.pair_input_list]) }
+        #else:
+            -1 '${input_option.batchmode.pair_input.forward}'
+            -2 '${input_option.batchmode.pair_input.reverse}'
+        #end if
     #else
         -r '${input_option.single_files}'
     #end if
@@ -51,7 +57,18 @@
                 <param name="fastq_input2" argument="-2" type="data" format="fastq,fastqsanger,fasta,fastq.gz,fastqsanger.gz" multiple="true" label="Mate 2 input reads"/>
             </when>
             <when value="paired_collection">
-                <param name="fastq_input1" type="data_collection" format="fastq,fastqsanger,fasta,fastq.gz,fastqsanger.gz" collection_type="list:paired" label="Select a paired collection"/>
+              <conditional name="batchmode">
+                <param name="processmode" type="select" label="Run in batch mode?" help="Selecting individual mode will generate one assembly dataset for each fastq pair-end dataset. Selecting the merge option will produce one assembly dataset for all input fastq pair-end datasets" display="radio">
+                  <option value="individual" selected="true">Run individually</option>
+                  <option value="merge">Merge all fastq pair-end</option>
+                </param>
+                <when value="individual">
+                  <param name="pair_input" type="data_collection" format="fastq,fastqsanger,fasta,fastq.gz,fastqsanger.gz" collection_type="paired" label="Select a paired collection"/>
+                </when>
+                <when value="merge">
+                  <param name="pair_input_list" type="data_collection" format="fastq,fastqsanger,fasta,fastq.gz,fastqsanger.gz" collection_type="list:paired" label="Select a paired collection"/>
+                </when>
+              </conditional>
             </when>
         </conditional>
         <section name="basic_section" title="Basic assembly options" expanded="True">
@@ -81,7 +98,11 @@
                 <param name="choice" value="single"/>
                 <param name="single_files" value="refExample.fa" ftype="fasta"/>
             </conditional>
-            <output name="output" file="single_result.fa"/>
+            <output name="output">
+            <assert_contents>
+              <has_line_matching expression=">k21_1 flag=3 multi=1.0486 len=576" />
+            </assert_contents>
+            </output>
         </test>
         <test>
             <conditional name="input_option">
@@ -92,20 +113,23 @@
             <output name="output" file="paired_result.fa"/>
         </test>
         <test>
-            <conditional name="input_option">
-                <param name="choice" value="paired_collection"/>
-                <param name="fastq_input1">
-                    <collection type="list:paired">
-                        <element name="Pair1">
-                            <collection type="paired">
-                                <element name="forward" value="paired-fq1.fa" ftype="fasta"/>
-                                <element name="reverse" value="paired-fq2.fa" ftype="fasta"/>
-                            </collection>
-                        </element>
-                    </collection>
-                </param>
+          <conditional name="input_option">
+            <param name="choice" value="paired_collection"/>
+            <conditional name="batchmode">
+              <param name="processmode" value="merge"/>
+              <param name="pair_input_list">
+                <collection type="list:paired">
+                <element name="Pair1">
+                  <collection type="paired">
+                    <element name="forward" value="paired-fq1.fa" ftype="fasta"/>
+                    <element name="reverse" value="paired-fq2.fa" ftype="fasta"/>
+                  </collection>
+                </element>
+                </collection>
+              </param>
             </conditional>
-            <output name="output" file="paired_result.fa"/>
+          </conditional>
+          <output name="output" file="paired_result.fa"/>
         </test>
     </tests>
     <help><![CDATA[
--- a/test-data/single_result.fa	Fri Nov 17 08:10:37 2017 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
->k21_1 flag=3 multi=1.0486 len=576
-GGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCAGGTTTCACCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAAC