Mercurial > repos > iuc > meme_fimo
changeset 5:eca84de658b0 draft
Uploaded
author | iuc |
---|---|
date | Fri, 17 Jun 2016 13:15:48 -0400 (2016-06-17) |
parents | cd54079f0f72 |
children | cdcc4bb60bc3 |
files | fimo.xml fimo_wrapper.py test-data/fimo_output_html_1.html test-data/fimo_output_html_2.html test-data/fimo_output_xml_1.xml test-data/fimo_output_xml_2.xml test-data/meme_input_1.fasta test-data/meme_output_html_1.html test-data/meme_output_html_2.html test-data/meme_output_txt_1.txt test-data/meme_output_txt_2.txt test-data/motif1.gff test-data/prior30.plib tool_dependencies.xml |
diffstat | 14 files changed, 230 insertions(+), 393 deletions(-) [+] |
line wrap: on
line diff
--- a/fimo.xml Tue Mar 08 08:10:52 2016 -0500 +++ b/fimo.xml Fri Jun 17 13:15:48 2016 -0400 @@ -1,4 +1,4 @@ -<tool id="meme_fimo" name="FIMO" version="4.11.0.2"> +<tool id="meme_fimo" name="FIMO" version="4.11.0.3"> <description>- Scan a set of sequences for motifs.</description> <requirements> <requirement type="package" version="6.9.3">imagemagick</requirement> @@ -6,6 +6,7 @@ </requirements> <command> <![CDATA[ + mkdir -p output && python $__tool_directory__/fimo_wrapper.py --input_motifs "${input_motifs}" #if str($fasta_type.fasta_type_selector) == 'history': @@ -28,10 +29,14 @@ --motif "${motif.motif}" #end for #end if + --output_separate_motifs ${options_type.output_separate_motifs} --motif_pseudo "${options_type.motif_pseudo}" ${options_type.no_qvalue} ${options_type.norc} - ${options_type.parse_genomic_coord} + #if str($options_type.parse_genomic_coord_cond.parse_genomic_coord) == 'yes': + --parse_genomic_coord 'yes' + --remove_duplicate_coords ${options_type.parse_genomic_coord_cond.remove_duplicate_coords} + #end if #if str($options_type.psp_cond.psp_selector) == 'yes': --input_psp "${input_psp}" #end if @@ -99,10 +104,23 @@ </repeat> </when> </conditional> + <param name="output_separate_motifs" type="select" label="Output a dataset per motif?" help="Output a collection consisting of a separate dataset for each motif in the input"> + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> <param name="motif_pseudo" type="float" value="0.1" label="Pseudocount to add to counts in motif matrix" help="A pseudocount to be added to each count in the motif matrix, after first multiplying by the corresponding background frequency"/> <param name="no_qvalue" label="Do not compute a q-value for each p-value" type="boolean" truevalue="--no_qvalue" falsevalue="" checked="True" help="The q-value calculation is that of Benjamini and Hochberg (1995)."/> <param name="norc" label="Do not score the reverse complement DNA strand" type="boolean" truevalue="--norc" falsevalue="" checked="False" /> - <param name="parse_genomic_coord" label="Check each sequence header for UCSC style genomic coordinates" type="boolean" truevalue="--parse_genomic_coord" falsevalue="" checked="False" /> + <conditional name="parse_genomic_coord_cond"> + <param name="parse_genomic_coord" label="Check each sequence header for UCSC style genomic coordinates" type="select"> + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> + <when value="yes"> + <param name="remove_duplicate_coords" type="boolean" truevalue="yes" falsevalue="no" label="Remove duplicate entries in unique GFF coordinates?" help="Remove duplicate entries as defined by the unique GFF coordinates" /> + </when> + <when value="no"/> + </conditional> <conditional name="psp_cond"> <param name="psp_selector" type="select" label="Use position-specific priors?"> <option value="no" selected="true">No</option> @@ -160,6 +178,7 @@ </actions> </data> <data format="tabular" name="gff_outfile" label="${tool.name} on ${on_string} (almost-gff)"> + <filter>options_type['output_separate_motifs'] == 'no'</filter> <actions> <conditional name="fasta_type.fasta_type_selector"> <when value="cached"> @@ -172,6 +191,10 @@ </conditional> </actions> </data> + <collection name="motifs" type="list" label="Motifs: ${tool.name} on ${on_string}"> + <discover_datasets pattern="(?P<designation>.*)" directory="output" ext="gff" visible="false" /> + <filter>options_type['output_separate_motifs'] == 'yes'</filter> + </collection> <data format="cisml" name="xml_outfile" label="${tool.name} on ${on_string} (xml)"> <actions> <conditional name="fasta_type.fasta_type_selector"> @@ -209,7 +232,7 @@ <output name="html_outfile" file="fimo_output_html_1.html" compare="contains"/> <output name="txt_outfile" file="fimo_output_txt_1.txt" compare="contains"/> <output name="gff_outfile" file="fimo_output_almost-gff_1.txt" compare="contains"/> - <output name="xml_outfile" file="fimo_output_xml_1.xml" lines_diff="8"/> + <output name="xml_outfile" file="fimo_output_xml_1.xml" compare="contains"/> <output name="interval_outfile" file="fimo_output_interval_1.txt" compare="contains"/> </test> <test> @@ -221,7 +244,24 @@ <output name="html_outfile" file="fimo_output_html_2.html" compare="contains"/> <output name="txt_outfile" file="fimo_output_txt_2.txt" compare="contains"/> <output name="gff_outfile" file="fimo_output_almost-gff_2.txt" compare="contains"/> - <output name="xml_outfile" file="fimo_output_xml_2.xml" lines_diff="8"/> + <output name="xml_outfile" file="fimo_output_xml_2.xml" compare="contains"/> + <output name="interval_outfile" file="fimo_output_interval_2.txt" compare="contains"/> + </test> + <test> + <param name="input_motifs" value="meme_output_xml_1.xml" ftype="memexml"/> + <param name="fasta_type_selector" value="history"/> + <param name="input_database" value="phiX.fasta" ftype="fasta"/> + <param name="options_type_selector" value="advanced"/> + <param name="parse_genomic_coord" value="--parse_genomic_coord"/> + <param name="remove_duplicate_coords" value="yes"/> + <param name="output_separate_motifs" value="yes"/> + <param name="non_commercial_use" value="True"/> + <output name="html_outfile" file="fimo_output_html_2.html" compare="contains"/> + <output name="txt_outfile" file="fimo_output_txt_2.txt" compare="contains"/> + <output_collection name="motifs" type="list"> + <element name="MOTIF1.gff" file="motif1.gff" ftype="gff" compare="contains"/> + </output_collection> + <output name="xml_outfile" file="fimo_output_xml_2.xml" compare="contains"/> <output name="interval_outfile" file="fimo_output_interval_2.txt" compare="contains"/> </test> </tests> @@ -235,7 +275,7 @@ FIMO scans a sequence database for individual matches to each of the motifs you provide (sample output for motifs and sequences). The name FIMO stands for 'Find Individual Motif Occurrences'. The program searches a database of sequences for occurrences of known motifs, treating each motif independently. Motifs must be in MEME Motif Format. You can define the statistical threshold -(p-value) for motifs and whether FIMO scans just the given sequences or their reverse complements (where applicable), too. +(p-value) for motifs and whether FIMO scans just the given sequences or their reverse complements (where applicable). .. class:: infomark
--- a/fimo_wrapper.py Tue Mar 08 08:10:52 2016 -0500 +++ b/fimo_wrapper.py Fri Jun 17 13:15:48 2016 -0400 @@ -12,6 +12,19 @@ DNA_COMPLEMENT = string.maketrans("ACGTRYKMBDHVacgtrykmbdhv", "TGCAYRMKVHDBtgcayrmkvhdb") +def get_stderr(tmp_stderr): + tmp_stderr.seek(0) + stderr = '' + try: + while True: + stderr += tmp_stderr.read(BUFFSIZE) + if not stderr or len(stderr) % BUFFSIZE != 0: + break + except OverflowError: + pass + return stderr + + def reverse(sequence): # Reverse sequence string. return sequence[::-1] @@ -43,11 +56,13 @@ parser.add_argument('--max_strand', action='store_true', help='If matches on both strands at a given position satisfy the output threshold, only report the match for the strand with the higher score') parser.add_argument('--max_stored_scores', dest='max_stored_scores', type=int, help='Maximum score count to store') parser.add_argument('--motif', dest='motifs', action='append', default=[], help='Specify motif by id') +parser.add_argument('--output_separate_motifs', default="no", help='Output one dataset per motif') parser.add_argument('--motif_pseudo', dest='motif_pseudo', type=float, default=0.1, help='Pseudocount to add to counts in motif matrix') parser.add_argument('--no_qvalue', action='store_true', help='Do not compute a q-value for each p-value') parser.add_argument('--norc', action='store_true', help='Do not score the reverse complement DNA strand') parser.add_argument('--output_path', dest='output_path', help='Output files directory') -parser.add_argument('--parse_genomic_coord', action='store_true', help='Check each sequence header for UCSC style genomic coordinates') +parser.add_argument('--parse_genomic_coord', default='no', help='Check each sequence header for UCSC style genomic coordinates') +parser.add_argument('--remove_duplicate_coords', default='no', help='Remove duplicate entries in unique GFF coordinates') parser.add_argument('--qv_thresh', action='store_true', help='Use q-values for the output threshold') parser.add_argument('--thresh', dest='thresh', type=float, help='p-value threshold') parser.add_argument('--gff_output', dest='gff_output', help='Gff output file') @@ -73,7 +88,7 @@ fimo_cmd_list.append('--no-qvalue') if args.norc: fimo_cmd_list.append('--norc') - if args.parse_genomic_coord: + if args.parse_genomic_coord == 'yes': fimo_cmd_list.append('--parse-genomic-coord') if args.qv_thresh: fimo_cmd_list.append('--qv-thresh') @@ -93,22 +108,66 @@ tmp_stderr = tempfile.NamedTemporaryFile() proc = subprocess.Popen(args=fimo_cmd, shell=True, stderr=tmp_stderr) returncode = proc.wait() - tmp_stderr.seek(0) - stderr = '' - try: - while True: - stderr += tmp_stderr.read(BUFFSIZE) - if not stderr or len(stderr) % BUFFSIZE != 0: - break - except OverflowError: - pass if returncode != 0: + stderr = get_stderr(tmp_stderr) stop_err(stderr) except Exception, e: stop_err('Error running FIMO:\n%s' % str(e)) shutil.move(os.path.join(args.output_path, 'fimo.txt'), args.txt_output) -shutil.move(os.path.join(args.output_path, 'fimo.gff'), args.gff_output) + +gff_file = os.path.join(args.output_path, 'fimo.gff') +if args.remove_duplicate_coords == 'yes': + tmp_stderr = tempfile.NamedTemporaryFile() + # Identify and eliminating identical motif occurrences. These + # are identical if the combination of chrom, start, end and + # motif id are identical. + cmd = 'sort -k1,1 -k4,4n -k5,5n -k9.1,9.6 -u -o %s %s' % (gff_file, gff_file) + proc = subprocess.Popen(args=cmd, stderr=tmp_stderr, shell=True) + returncode = proc.wait() + if returncode != 0: + stderr = get_stderr(tmp_stderr) + stop_err(stderr) + # Sort GFF output by a combination of chrom, score, start. + cmd = 'sort -k1,1 -k4,4n -k6,6n -o %s %s' % (gff_file, gff_file) + proc = subprocess.Popen(args=cmd, stderr=tmp_stderr, shell=True) + returncode = proc.wait() + if returncode != 0: + stderr = get_stderr(tmp_stderr) + stop_err(stderr) +if args.output_separate_motifs == 'yes': + # Create the collection output directory. + collection_path = (os.path.join(os.getcwd(), 'output')) + # Keep track of motif occurrences. + header_line = None + motif_ids = [] + file_handles = [] + for line in open(gff_file, 'r'): + if line.startswith('#'): + if header_line is None: + header_line = line + continue + items = line.split('\t') + attribute = items[8] + attributes = attribute.split(';') + name = attributes[0] + motif_id = name.split('=')[1] + file_name = os.path.join(collection_path, 'MOTIF%s.gff' % motif_id) + if motif_id in motif_ids: + i = motif_ids.index(motif_id) + fh = file_handles[i] + fh.write(line) + else: + fh = open(file_name, 'wb') + if header_line is not None: + fh.write(header_line) + fh.write(line) + motif_ids.append(motif_id) + file_handles.append(fh) + for file_handle in file_handles: + file_handle.close() +else: + shutil.move(gff_file, args.gff_output) shutil.move(os.path.join(args.output_path, 'fimo.xml'), args.xml_output) shutil.move(os.path.join(args.output_path, 'fimo.html'), args.html_output)
--- a/test-data/fimo_output_html_1.html Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/fimo_output_html_1.html Fri Jun 17 13:15:48 2016 -0400 @@ -41,12 +41,10 @@ <hr> <div style="padding-left: 0.75in; line-height: 1em; font-family: monospace;"> <p> - DATABASE /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat <br /> Database contains 1 sequences, 5386 residues </p> <p> - MOTIFS /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat (Protein) <table> <thead> <tr> @@ -98,3 +96,5 @@ probability of a random sequence of the same length as the motif matching that position of the sequence with as good or better a score. </li> +<li> +The score for the match of a position in a sequence to a motif
--- a/test-data/fimo_output_html_2.html Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/fimo_output_html_2.html Fri Jun 17 13:15:48 2016 -0400 @@ -41,12 +41,10 @@ <hr> <div style="padding-left: 0.75in; line-height: 1em; font-family: monospace;"> <p> - DATABASE /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat <br /> Database contains 1 sequences, 5386 residues </p> <p> - MOTIFS /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat (Protein) <table> <thead> <tr> @@ -98,3 +96,5 @@ probability of a random sequence of the same length as the motif matching that position of the sequence with as good or better a score. </li> +<li> +The score for the match of a position in a sequence to a motif
--- a/test-data/fimo_output_xml_1.xml Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/fimo_output_xml_1.xml Fri Jun 17 13:15:48 2016 -0400 @@ -4,11 +4,7 @@ xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation= xmlns:fimo="http://noble.gs.washington.edu/schema/fimo" > -<command-line>fimo --o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1973/dataset_2713_files --verbosity 1 /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</command-line> <settings> -<setting name="output directory">/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1973/dataset_2713_files</setting> -<setting name="MEME file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat</setting> -<setting name="sequence file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</setting> <setting name="allow clobber">false</setting> <setting name="compute q-values">true</setting> <setting name="parse genomic coord.">false</setting>
--- a/test-data/fimo_output_xml_2.xml Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/fimo_output_xml_2.xml Fri Jun 17 13:15:48 2016 -0400 @@ -4,14 +4,9 @@ xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation= xmlns:fimo="http://noble.gs.washington.edu/schema/fimo" > -<command-line>fimo --alpha 1.000000 --max-stored-scores 100000 --motif-pseudo 0.100000 --no-qvalue --thresh 0.000100 --o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1978/dataset_2738_files --verbosity 1 /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</command-line> <settings> -<setting name="output directory">/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1978/dataset_2738_files</setting> -<setting name="MEME file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat</setting> -<setting name="sequence file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</setting> <setting name="allow clobber">false</setting> <setting name="compute q-values">false</setting> -<setting name="parse genomic coord.">false</setting> <setting name="text only">false</setting> <setting name="scan both strands">false</setting> <setting name="output threshold">0.0001</setting>
--- a/test-data/meme_input_1.fasta Tue Mar 08 08:10:52 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,66 +0,0 @@ ->chr21_19617074_19617124_+ -AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA ->chr21_26934381_26934431_+ -GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT ->chr21_28217753_28217803_- -CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA ->chr21_31710037_31710087_- -AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT ->chr21_31744582_31744632_- -CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA ->chr21_31768316_31768366_+ -AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT ->chr21_31914206_31914256_- -TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC ->chr21_31933633_31933683_- -TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT ->chr21_31962741_31962791_- -ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA ->chr21_31964683_31964733_+ -TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC ->chr21_31973364_31973414_+ -aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC ->chr21_31992870_31992920_+ -CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT ->chr21_32185595_32185645_- -TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA ->chr21_32202076_32202126_- -TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT ->chr21_32253899_32253949_- -AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC ->chr21_32410820_32410870_- -TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG ->chr21_36411748_36411798_- -ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt ->chr21_37838750_37838800_- -gatggttttataaggggcctcaccctcggctcagccctcattcttctcct ->chr21_45705687_45705737_+ -CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC ->chr21_45971413_45971463_- -CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca ->chr21_45978668_45978718_- -CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca ->chr21_45993530_45993580_+ -CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC ->chr21_46020421_46020471_+ -GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc ->chr21_46031920_46031970_+ -GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC ->chr21_46046964_46047014_+ -ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca ->chr21_46057197_46057247_+ -ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC ->chr21_46086869_46086919_- -GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC ->chr21_46102103_46102153_- -AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT ->chr21_47517957_47518007_+ -CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG ->chr21_47517957_47518007_+ -CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG ->chr21_47517957_47518007_+ -CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG ->chr21_47575506_47575556_- -TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG ->chr21_47575506_47575556_- -TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
--- a/test-data/meme_output_html_1.html Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/meme_output_html_1.html Fri Jun 17 13:15:48 2016 -0400 @@ -12,9 +12,6 @@ "stop_reason": "Stopped because requested number of motifs (1) found.", "cmd": [ "meme", - "/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat", - "-o", - "/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1912/dataset_2530_files", "-nostatus" ], "options": {
--- a/test-data/meme_output_html_2.html Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/meme_output_html_2.html Fri Jun 17 13:15:48 2016 -0400 @@ -12,15 +12,6 @@ "stop_reason": "Stopped because requested number of motifs (1) found.", "cmd": [ "meme", - "/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat", - "-o", - "/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1929/dataset_2578_files", - "-nostatus", "-sf", "Galaxy_FASTA_Input", "-dna", "-mod", "zoops", - "-nmotifs", "1", "-wnsites", "0.8", "-minw", "8", "-maxw", "50", - "-wg", "11", "-ws", "1", "-maxiter", "50", "-distance", "0.001", - "-prior", "dirichlet", "-b", "0.01", "-plib", - "/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2577.dat", - "-spmap", "uni", "-spfuzz", "0.5" ], "options": { "mod": "zoops",
--- a/test-data/meme_output_txt_1.txt Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/meme_output_txt_1.txt Fri Jun 17 13:15:48 2016 -0400 @@ -28,7 +28,7 @@ ******************************************************************************** TRAINING SET ******************************************************************************** -DATAFILE= /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat +DATAFILE= ALPHABET= ACDEFGHIKLMNPQRSTVWY Sequence name Weight Length Sequence name Weight Length ------------- ------ ------ ------------- ------ ------ @@ -55,7 +55,7 @@ This information can also be useful in the event you wish to report a problem with the MEME software. -command: meme /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat -o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1912/dataset_2530_files -nostatus +command: meme model: mod= zoops nmotifs= 1 evt= inf object function= E-value of product of p-values @@ -267,7 +267,7 @@ -Time 0.53 secs. +Time ******************************************************************************** @@ -320,6 +320,6 @@ Stopped because requested number of motifs (1) found. ******************************************************************************** -CPU: MacBook-Pro-2.local +CPU: ********************************************************************************
--- a/test-data/meme_output_txt_2.txt Tue Mar 08 08:10:52 2016 -0500 +++ b/test-data/meme_output_txt_2.txt Fri Jun 17 13:15:48 2016 -0400 @@ -55,7 +55,7 @@ This information can also be useful in the event you wish to report a problem with the MEME software. -command: meme /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat -o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1929/dataset_2578_files -nostatus -sf Galaxy_FASTA_Input -dna -mod zoops -nmotifs 1 -wnsites 0.8 -minw 8 -maxw 50 -wg 11 -ws 1 -maxiter 50 -distance 0.001 -prior dirichlet -b 0.01 -plib /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2577.dat -spmap uni -spfuzz 0.5 +command: meme model: mod= zoops nmotifs= 1 evt= inf object function= E-value of product of p-values @@ -69,7 +69,7 @@ data: n= 1500 N= 30 shuffle= -1 strands: + sample: seed= 0 ctfrac= -1 maxwords= -1 -Dirichlet mixture priors file: dataset_2577.dat +Dirichlet mixture priors file: Letter frequencies in dataset: A 0.294 C 0.231 G 0.257 T 0.217 Background letter frequencies (from dataset with add-one prior applied): @@ -261,7 +261,7 @@ -Time 0.17 secs. +Time ******************************************************************************** @@ -314,6 +314,6 @@ Stopped because requested number of motifs (1) found. ******************************************************************************** -CPU: dot1x-cb-51.aset.psu.edu +CPU: ********************************************************************************
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/motif1.gff Fri Jun 17 13:15:48 2016 -0400 @@ -0,0 +1,100 @@ +##gff-version 3 +phiX174 fimo polypeptide_motif 1 11 78.3 + . Name=1;ID=1-57-phiX174;pvalue=1.46e-08;sequence=GAGTTTTATCG; +phiX174 fimo polypeptide_motif 3 13 57.5 + . Name=1;ID=1-471-phiX174;pvalue=1.79e-06;sequence=GTTTTATCGCT; +phiX174 fimo polypeptide_motif 7 17 45 + . Name=1;ID=1-1378-phiX174;pvalue=3.18e-05;sequence=TATCGCTTCCA; +phiX174 fimo polypeptide_motif 10 20 53.9 + . Name=1;ID=1-605-phiX174;pvalue=4.1e-06;sequence=CGCTTCCATGA; +phiX174 fimo polypeptide_motif 17 27 40.2 + . Name=1;ID=1-1887-phiX174;pvalue=9.55e-05;sequence=ATGACGCAGAA; +phiX174 fimo polypeptide_motif 18 28 45.3 + . Name=1;ID=1-1349-phiX174;pvalue=2.98e-05;sequence=TGACGCAGAAG; +phiX174 fimo polypeptide_motif 19 29 55.8 + . Name=1;ID=1-527-phiX174;pvalue=2.6e-06;sequence=GACGCAGAAGT; +phiX174 fimo polypeptide_motif 21 31 41.5 + . Name=1;ID=1-1705-phiX174;pvalue=7.07e-05;sequence=CGCAGAAGTTA; +phiX174 fimo polypeptide_motif 22 32 44.6 + . Name=1;ID=1-1404-phiX174;pvalue=3.44e-05;sequence=GCAGAAGTTAA; +phiX174 fimo polypeptide_motif 24 34 79.1 + . Name=1;ID=1-53-phiX174;pvalue=1.23e-08;sequence=AGAAGTTAACA; +phiX174 fimo polypeptide_motif 25 35 45.3 + . Name=1;ID=1-1347-phiX174;pvalue=2.97e-05;sequence=GAAGTTAACAC; +phiX174 fimo polypeptide_motif 26 36 59.2 + . Name=1;ID=1-417-phiX174;pvalue=1.19e-06;sequence=AAGTTAACACT; +phiX174 fimo polypeptide_motif 30 40 44.7 + . Name=1;ID=1-1399-phiX174;pvalue=3.4e-05;sequence=TAACACTTTCG; +phiX174 fimo polypeptide_motif 37 47 72.4 + . Name=1;ID=1-98-phiX174;pvalue=5.79e-08;sequence=TTCGGATATTT; +phiX174 fimo polypeptide_motif 39 49 65.3 + . Name=1;ID=1-213-phiX174;pvalue=2.92e-07;sequence=CGGATATTTCT; +phiX174 fimo polypeptide_motif 41 51 55.3 + . Name=1;ID=1-548-phiX174;pvalue=2.97e-06;sequence=GATATTTCTGA; +phiX174 fimo polypeptide_motif 43 53 58.4 + . Name=1;ID=1-442-phiX174;pvalue=1.43e-06;sequence=TATTTCTGATG; +phiX174 fimo polypeptide_motif 46 56 53.7 + . Name=1;ID=1-617-phiX174;pvalue=4.23e-06;sequence=TTCTGATGAGT; +phiX174 fimo polypeptide_motif 50 60 45.4 + . Name=1;ID=1-1333-phiX174;pvalue=2.86e-05;sequence=GATGAGTCGAA; +phiX174 fimo polypeptide_motif 51 61 48.4 + . Name=1;ID=1-1094-phiX174;pvalue=1.44e-05;sequence=ATGAGTCGAAA; +phiX174 fimo polypeptide_motif 52 62 83.9 + . Name=1;ID=1-22-phiX174;pvalue=4.06e-09;sequence=TGAGTCGAAAA; +phiX174 fimo polypeptide_motif 53 63 53.9 + . Name=1;ID=1-601-phiX174;pvalue=4.03e-06;sequence=GAGTCGAAAAA; +phiX174 fimo polypeptide_motif 54 64 62.9 + . Name=1;ID=1-297-phiX174;pvalue=5.16e-07;sequence=AGTCGAAAAAT; +phiX174 fimo polypeptide_motif 55 65 52.8 + . Name=1;ID=1-675-phiX174;pvalue=5.26e-06;sequence=GTCGAAAAATT; +phiX174 fimo polypeptide_motif 56 66 41.4 + . Name=1;ID=1-1713-phiX174;pvalue=7.2e-05;sequence=TCGAAAAATTA; +phiX174 fimo polypeptide_motif 58 68 43.4 + . Name=1;ID=1-1500-phiX174;pvalue=4.56e-05;sequence=GAAAAATTATC; +phiX174 fimo polypeptide_motif 59 69 59.6 + . Name=1;ID=1-409-phiX174;pvalue=1.1e-06;sequence=AAAAATTATCT; +phiX174 fimo polypeptide_motif 61 71 61.8 + . Name=1;ID=1-329-phiX174;pvalue=6.52e-07;sequence=AAATTATCTTG; +phiX174 fimo polypeptide_motif 63 73 59.2 + . Name=1;ID=1-419-phiX174;pvalue=1.2e-06;sequence=ATTATCTTGAT; +phiX174 fimo polypeptide_motif 65 75 53.3 + . Name=1;ID=1-643-phiX174;pvalue=4.66e-06;sequence=TATCTTGATAA; +phiX174 fimo polypeptide_motif 66 76 51.8 + . Name=1;ID=1-737-phiX174;pvalue=6.54e-06;sequence=ATCTTGATAAA; +phiX174 fimo polypeptide_motif 67 77 73.2 + . Name=1;ID=1-89-phiX174;pvalue=4.78e-08;sequence=TCTTGATAAAG; +phiX174 fimo polypeptide_motif 69 79 63.8 + . Name=1;ID=1-268-phiX174;pvalue=4.15e-07;sequence=TTGATAAAGCA; +phiX174 fimo polypeptide_motif 71 81 40.2 + . Name=1;ID=1-1882-phiX174;pvalue=9.49e-05;sequence=GATAAAGCAGG; +phiX174 fimo polypeptide_motif 73 83 45.4 + . Name=1;ID=1-1334-phiX174;pvalue=2.87e-05;sequence=TAAAGCAGGAA; +phiX174 fimo polypeptide_motif 74 84 50.9 + . Name=1;ID=1-832-phiX174;pvalue=8.05e-06;sequence=AAAGCAGGAAT; +phiX174 fimo polypeptide_motif 76 86 52.2 + . Name=1;ID=1-710-phiX174;pvalue=5.96e-06;sequence=AGCAGGAATTA; +phiX174 fimo polypeptide_motif 78 88 51.8 + . Name=1;ID=1-741-phiX174;pvalue=6.65e-06;sequence=CAGGAATTACT; +phiX174 fimo polypeptide_motif 79 89 45 + . Name=1;ID=1-1369-phiX174;pvalue=3.16e-05;sequence=AGGAATTACTA; +phiX174 fimo polypeptide_motif 80 90 43.3 + . Name=1;ID=1-1511-phiX174;pvalue=4.63e-05;sequence=GGAATTACTAC; +phiX174 fimo polypeptide_motif 81 91 59.8 + . Name=1;ID=1-402-phiX174;pvalue=1.05e-06;sequence=GAATTACTACT; +phiX174 fimo polypeptide_motif 82 92 46.9 + . Name=1;ID=1-1205-phiX174;pvalue=2.03e-05;sequence=AATTACTACTG; +phiX174 fimo polypeptide_motif 88 98 41.2 + . Name=1;ID=1-1744-phiX174;pvalue=7.51e-05;sequence=TACTGCTTGTT; +phiX174 fimo polypeptide_motif 91 101 53.6 + . Name=1;ID=1-621-phiX174;pvalue=4.33e-06;sequence=TGCTTGTTTAC; +phiX174 fimo polypeptide_motif 92 102 44.8 + . Name=1;ID=1-1388-phiX174;pvalue=3.31e-05;sequence=GCTTGTTTACG; +phiX174 fimo polypeptide_motif 93 103 43.2 + . Name=1;ID=1-1525-phiX174;pvalue=4.82e-05;sequence=CTTGTTTACGA; +phiX174 fimo polypeptide_motif 95 105 61.9 + . Name=1;ID=1-327-phiX174;pvalue=6.5e-07;sequence=TGTTTACGAAT; +phiX174 fimo polypeptide_motif 96 106 42.9 + . Name=1;ID=1-1553-phiX174;pvalue=5.08e-05;sequence=GTTTACGAATT; +phiX174 fimo polypeptide_motif 98 108 45.4 + . Name=1;ID=1-1340-phiX174;pvalue=2.9e-05;sequence=TTACGAATTAA; +phiX174 fimo polypeptide_motif 99 109 73.5 + . Name=1;ID=1-88-phiX174;pvalue=4.48e-08;sequence=TACGAATTAAA; +phiX174 fimo polypeptide_motif 100 110 53 + . Name=1;ID=1-661-phiX174;pvalue=4.99e-06;sequence=ACGAATTAAAT; +phiX174 fimo polypeptide_motif 102 112 75.6 + . Name=1;ID=1-72-phiX174;pvalue=2.75e-08;sequence=GAATTAAATCG; +phiX174 fimo polypeptide_motif 104 114 52.2 + . Name=1;ID=1-713-phiX174;pvalue=6.05e-06;sequence=ATTAAATCGAA; +phiX174 fimo polypeptide_motif 106 116 59.6 + . Name=1;ID=1-407-phiX174;pvalue=1.09e-06;sequence=TAAATCGAAGT; +phiX174 fimo polypeptide_motif 112 122 41.6 + . Name=1;ID=1-1683-phiX174;pvalue=6.85e-05;sequence=GAAGTGGACTG; +phiX174 fimo polypeptide_motif 114 124 45.3 + . Name=1;ID=1-1342-phiX174;pvalue=2.92e-05;sequence=AGTGGACTGCT; +phiX174 fimo polypeptide_motif 118 128 56.2 + . Name=1;ID=1-512-phiX174;pvalue=2.38e-06;sequence=GACTGCTGGCG; +phiX174 fimo polypeptide_motif 122 132 51.4 + . Name=1;ID=1-774-phiX174;pvalue=7.15e-06;sequence=GCTGGCGGAAA; +phiX174 fimo polypeptide_motif 123 133 43.1 + . Name=1;ID=1-1533-phiX174;pvalue=4.93e-05;sequence=CTGGCGGAAAA; +phiX174 fimo polypeptide_motif 124 134 48.6 + . Name=1;ID=1-1085-phiX174;pvalue=1.38e-05;sequence=TGGCGGAAAAT; +phiX174 fimo polypeptide_motif 125 135 68.3 + . Name=1;ID=1-146-phiX174;pvalue=1.49e-07;sequence=GGCGGAAAATG; +phiX174 fimo polypeptide_motif 126 136 46.4 + . Name=1;ID=1-1243-phiX174;pvalue=2.27e-05;sequence=GCGGAAAATGA; +phiX174 fimo polypeptide_motif 128 138 58.3 + . Name=1;ID=1-446-phiX174;pvalue=1.48e-06;sequence=GGAAAATGAGA; +phiX174 fimo polypeptide_motif 129 139 43.2 + . Name=1;ID=1-1522-phiX174;pvalue=4.78e-05;sequence=GAAAATGAGAA; +phiX174 fimo polypeptide_motif 130 140 54.1 + . Name=1;ID=1-595-phiX174;pvalue=3.92e-06;sequence=AAAATGAGAAA; +phiX174 fimo polypeptide_motif 131 141 76 + . Name=1;ID=1-68-phiX174;pvalue=2.49e-08;sequence=AAATGAGAAAA; +phiX174 fimo polypeptide_motif 132 142 51.2 + . Name=1;ID=1-800-phiX174;pvalue=7.57e-06;sequence=AATGAGAAAAT; +phiX174 fimo polypeptide_motif 133 143 56.2 + . Name=1;ID=1-513-phiX174;pvalue=2.41e-06;sequence=ATGAGAAAATT; +phiX174 fimo polypeptide_motif 134 144 41.1 + . Name=1;ID=1-1761-phiX174;pvalue=7.83e-05;sequence=TGAGAAAATTC; +phiX174 fimo polypeptide_motif 135 145 50.3 + . Name=1;ID=1-910-phiX174;pvalue=9.39e-06;sequence=GAGAAAATTCG; +phiX174 fimo polypeptide_motif 136 146 43.3 + . Name=1;ID=1-1517-phiX174;pvalue=4.66e-05;sequence=AGAAAATTCGA; +phiX174 fimo polypeptide_motif 139 149 54.2 + . Name=1;ID=1-588-phiX174;pvalue=3.75e-06;sequence=AAATTCGACCT; +phiX174 fimo polypeptide_motif 141 151 42.2 + . Name=1;ID=1-1625-phiX174;pvalue=6.01e-05;sequence=ATTCGACCTAT; +phiX174 fimo polypeptide_motif 143 153 50 + . Name=1;ID=1-938-phiX174;pvalue=9.94e-06;sequence=TCGACCTATCC; +phiX174 fimo polypeptide_motif 145 155 44.6 + . Name=1;ID=1-1403-phiX174;pvalue=3.42e-05;sequence=GACCTATCCTT; +phiX174 fimo polypeptide_motif 155 165 51.3 + . Name=1;ID=1-787-phiX174;pvalue=7.35e-06;sequence=TGCGCAGCTCG; +phiX174 fimo polypeptide_motif 157 167 51.1 + . Name=1;ID=1-807-phiX174;pvalue=7.68e-06;sequence=CGCAGCTCGAG; +phiX174 fimo polypeptide_motif 159 169 44.5 + . Name=1;ID=1-1420-phiX174;pvalue=3.56e-05;sequence=CAGCTCGAGAA; +phiX174 fimo polypeptide_motif 160 170 40 + . Name=1;ID=1-1921-phiX174;pvalue=9.89e-05;sequence=AGCTCGAGAAG; +phiX174 fimo polypeptide_motif 166 176 60.9 + . Name=1;ID=1-365-phiX174;pvalue=8.02e-07;sequence=AGAAGCTCTTA; +phiX174 fimo polypeptide_motif 168 178 62.3 + . Name=1;ID=1-311-phiX174;pvalue=5.87e-07;sequence=AAGCTCTTACT; +phiX174 fimo polypeptide_motif 181 191 49.9 + . Name=1;ID=1-946-phiX174;pvalue=1.01e-05;sequence=GCGACCTTTCG; +phiX174 fimo polypeptide_motif 187 197 52.5 + . Name=1;ID=1-694-phiX174;pvalue=5.64e-06;sequence=TTTCGCCATCA; +phiX174 fimo polypeptide_motif 191 201 46.6 + . Name=1;ID=1-1232-phiX174;pvalue=2.2e-05;sequence=GCCATCAACTA; +phiX174 fimo polypeptide_motif 194 204 76.4 + . Name=1;ID=1-67-phiX174;pvalue=2.29e-08;sequence=ATCAACTAACG; +phiX174 fimo polypeptide_motif 201 211 40.1 + . Name=1;ID=1-1908-phiX174;pvalue=9.77e-05;sequence=AACGATTCTGT; +phiX174 fimo polypeptide_motif 203 213 63 + . Name=1;ID=1-291-phiX174;pvalue=5e-07;sequence=CGATTCTGTCA; +phiX174 fimo polypeptide_motif 205 215 53.8 + . Name=1;ID=1-610-phiX174;pvalue=4.16e-06;sequence=ATTCTGTCAAA; +phiX174 fimo polypeptide_motif 206 216 59.1 + . Name=1;ID=1-421-phiX174;pvalue=1.23e-06;sequence=TTCTGTCAAAA; +phiX174 fimo polypeptide_motif 207 217 68 + . Name=1;ID=1-153-phiX174;pvalue=1.58e-07;sequence=TCTGTCAAAAA; +phiX174 fimo polypeptide_motif 209 219 49.6 + . Name=1;ID=1-988-phiX174;pvalue=1.09e-05;sequence=TGTCAAAAACT; +phiX174 fimo polypeptide_motif 210 220 40.8 + . Name=1;ID=1-1810-phiX174;pvalue=8.33e-05;sequence=GTCAAAAACTG; +phiX174 fimo polypeptide_motif 213 223 59.7 + . Name=1;ID=1-404-phiX174;pvalue=1.06e-06;sequence=AAAAACTGACG; +phiX174 fimo polypeptide_motif 223 233 42 + . Name=1;ID=1-1654-phiX174;pvalue=6.36e-05;sequence=GCGTTGGATGA; +phiX174 fimo polypeptide_motif 225 235 61.4 + . Name=1;ID=1-349-phiX174;pvalue=7.16e-07;sequence=GTTGGATGAGG; +phiX174 fimo polypeptide_motif 227 237 40.3 + . Name=1;ID=1-1874-phiX174;pvalue=9.32e-05;sequence=TGGATGAGGAG; +phiX174 fimo polypeptide_motif 228 238 49.9 + . Name=1;ID=1-947-phiX174;pvalue=1.01e-05;sequence=GGATGAGGAGA; +phiX174 fimo polypeptide_motif 229 239 45 + . Name=1;ID=1-1370-phiX174;pvalue=3.16e-05;sequence=GATGAGGAGAA; +phiX174 fimo polypeptide_motif 230 240 44.8 + . Name=1;ID=1-1395-phiX174;pvalue=3.33e-05;sequence=ATGAGGAGAAG;
--- a/test-data/prior30.plib Tue Mar 08 08:10:52 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,275 +0,0 @@ -Alphabet= ACDEFGHIKLMNPQRSTVWY -NumDistr= 30 -Number= 0 -Mixture= 0.055795 -B= 5.623820 -Alpha= 0.0855491 0.0221831 0.0111063 0.0209959 0.0505726 0.025437 0.0155389 0.132951 0.0247865 0.150287 0.0577239 0.0209317 0.0166629 0.0220905 0.0244295 0.0497608 0.070277 0.157532 0.0102219 0.0309633 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= HMM9.4 reestimated in henikoff29.2 - -Number= 1 -Mixture= 0.198333 -B= 0.097240 -Alpha= 0.0562629 0.0329597 0.0692513 0.0385232 0.0400041 0.143573 0.0428939 0.0226244 0.0442102 0.0665467 0.0117853 0.0447655 0.0833299 0.0395825 0.0611271 0.0588852 0.0513472 0.0317153 0.0237865 0.0368161 -FullUpdate= 1 -QUpdate= 1 -StructID= 24 -Comment= Outside - -Number= 2 -Mixture= 0.043566 -B= 1.648336 -Alpha= 0.0144564 0.00845337 0.00785519 0.00864933 0.255959 0.0110815 0.0509526 0.0234533 0.0120443 0.0561967 0.015111 0.0190974 0.00857653 0.0167812 0.0164918 0.0197108 0.0151013 0.0252782 0.050139 0.364613 -FullUpdate= 1 -QUpdate= 1 -StructID= 26 -Comment= Inside - -Number= 3 -Mixture= 0.060170 -B= 2.595432 -Alpha= 0.0452144 0.00587917 0.169731 0.0751478 0.00749471 0.0845832 0.0369819 0.00610072 0.0548186 0.011029 0.00382749 0.212785 0.0206532 0.0416705 0.0280716 0.117267 0.0533742 0.00943157 0.00216149 0.0137784 -FullUpdate= 1 -QUpdate= 1 -StructID= 19 -Comment= Outside Alpha - -Number= 4 -Mixture= 0.065466 -B= 3.112271 -Alpha= 0.0361167 0.0049157 0.0134924 0.0461325 0.00557631 0.0209043 0.0302551 0.016425 0.307554 0.0338255 0.0139435 0.0360733 0.0127659 0.0873761 0.222668 0.0369042 0.0354442 0.0228891 0.00434827 0.0123906 -FullUpdate= 1 -QUpdate= 1 -StructID= 21 -Comment= Outside Beta - -Number= 5 -Mixture= 0.067614 -B= 2.053644 -Alpha= 0.0194362 0.00765176 0.00188738 0.00372898 0.0849894 0.00421787 0.00400459 0.152735 0.00407958 0.4568 0.106051 0.00304386 0.00545956 0.00900935 0.00605071 0.00519029 0.016255 0.0861045 0.00787965 0.0154248 -FullUpdate= 1 -QUpdate= 1 -StructID= 22 -Comment= Inside alpha - -Number= 6 -Mixture= 0.080724 -B= 2.138987 -Alpha= 0.0423172 0.0153891 0.00409306 0.00565735 0.0197117 0.00590607 0.00139926 0.307863 0.00544884 0.115721 0.0285808 0.00522771 0.00474851 0.00328193 0.00351054 0.00892385 0.0348922 0.380003 0.00117673 0.00614917 -FullUpdate= 1 -QUpdate= 1 -StructID= 23 -Comment= Inside beta - -Number= 7 -Mixture= 0.051030 -B= 3.878926 -Alpha= 0.0548123 0.000759746 0.144127 0.46019 0.00249502 0.0192754 0.0106535 0.00938765 0.0562429 0.0163148 0.00717389 0.0245612 0.0177482 0.0744802 0.0199233 0.0323535 0.0257651 0.018574 0.00087086 0.00429088 -FullUpdate= 1 -QUpdate= 1 -StructID= 23 -Comment= Alpha helix - -Number= 8 -Mixture= 0.103529 -B= 1.486325 -Alpha= 0.315754 0.0384546 0.0116388 0.0133665 0.0111126 0.107921 0.00752325 0.0154885 0.0111281 0.0231087 0.011626 0.0228375 0.0304785 0.0166632 0.0156345 0.186379 0.0954421 0.0546691 0.00351538 0.00725682 -FullUpdate= 1 -QUpdate= 1 -StructID= 23 -Comment= Beta strand - -Number= 9 -Mixture= 0.062940 -B= 8.221215 -Alpha= 0.0869919 0.00672577 0.0600995 0.10763 0.0153489 0.0378086 0.0325335 0.023388 0.113765 0.041623 0.0196906 0.0625344 0.0262599 0.0788667 0.0707399 0.0886634 0.0666777 0.0361472 0.00484308 0.0196629 -FullUpdate= 1 -QUpdate= 1 -StructID= 23 -Comment= Other - -Number= 10 -Mixture= 0.012518 -B= 38.955631 -Alpha= 0.732922 0.0145131 0.00623235 0.00951423 0.00717778 0.0289521 0.00351664 0.0125081 0.00886593 0.0183651 0.00832812 0.00670968 0.00364556 0.00622169 0.00812899 0.0582399 0.0205067 0.0394327 0.00207485 0.00414489 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= A - -Number= 11 -Mixture= 0.004953 -B= 381.562195 -Alpha= 0.00563239 0.959814 0.00144129 0.00213042 0.00158645 0.00168393 0.000989765 0.00325263 0.00148501 0.00343924 0.00168673 0.00159054 0.00121534 0.00129942 0.00195209 0.00296106 0.0039912 0.00266944 0.000327808 0.000851203 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= C - -Number= 12 -Mixture= 0.013849 -B= 90.727570 -Alpha= 0.00897115 0.00169015 0.859473 0.0360829 0.00269485 0.00606504 0.00469816 0.00400134 0.0047981 0.00514968 0.00208395 0.029754 0.00241276 0.0045506 0.00433816 0.0088208 0.00511143 0.00527448 0.00104469 0.00298475 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= D - -Number= 13 -Mixture= 0.008388 -B= 404.591034 -Alpha= 0.00241514 0.000413991 0.0122981 0.96369 0.000665578 0.00187461 0.00106904 0.00149214 0.00121548 0.00129791 0.000554145 0.00253496 0.000624495 0.00316839 0.00115045 0.00171781 0.001468 0.0014564 0.000278652 0.000614791 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= E - -Number= 14 -Mixture= 0.008064 -B= 83.323669 -Alpha= 0.00839779 0.00428348 0.00298116 0.00358128 0.850936 0.00329382 0.00196832 0.0130534 0.00320345 0.0351883 0.00729724 0.00287304 0.00358482 0.00218728 0.00264753 0.00833798 0.00418729 0.0120684 0.00448366 0.025446 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= F - -Number= 15 -Mixture= 0.032205 -B= 32.644871 -Alpha= 0.0234448 0.00236512 0.0112957 0.00811395 0.00248143 0.868718 0.00345598 0.00342985 0.00859682 0.0040966 0.00239339 0.012342 0.00423123 0.00440054 0.00795347 0.0165095 0.0065024 0.00550512 0.00140604 0.00275817 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= G - -Number= 16 -Mixture= 0.005033 -B= 35.520824 -Alpha= 0.0100058 0.00386024 0.0131498 0.0108984 0.0122851 0.00738691 0.722249 0.00521193 0.00686054 0.0150103 0.00673014 0.0367074 0.00625526 0.0429912 0.0234127 0.0187246 0.0128445 0.00837399 0.00390723 0.0331349 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= H - -Number= 17 -Mixture= 0.007454 -B= 101.265472 -Alpha= 0.0106938 0.00267663 0.00404166 0.00466637 0.00838963 0.00372808 0.00182575 0.681615 0.0059102 0.0770333 0.0184335 0.004676 0.0027124 0.00372663 0.00418165 0.00773357 0.0109237 0.140679 0.00140417 0.00494911 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= I - -Number= 18 -Mixture= 0.009400 -B= 150.415985 -Alpha= 0.00688657 0.00169711 0.00222738 0.00346887 0.00115861 0.00302866 0.00209171 0.00400905 0.903944 0.0037747 0.00186061 0.00449531 0.00249618 0.00324487 0.041775 0.00392196 0.00461714 0.00296607 0.000893256 0.00144282 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= K - -Number= 19 -Mixture= 0.017057 -B= 31.896633 -Alpha= 0.0114646 0.00367926 0.00296188 0.00596126 0.0190009 0.00382486 0.00338381 0.0401936 0.00650072 0.790038 0.031659 0.00392791 0.0050046 0.00753591 0.00771818 0.00748621 0.0101555 0.0312597 0.00242405 0.00581952 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= L - -Number= 20 -Mixture= 0.002761 -B= 201.346268 -Alpha= 0.00353933 0.00165628 0.0014931 0.00161065 0.00279831 0.00194259 0.00101868 0.00969101 0.00211316 0.0217036 0.928022 0.00162899 0.0015681 0.0015629 0.00138977 0.00294601 0.00311476 0.00723178 0.00156295 0.00340569 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= M - -Number= 21 -Mixture= 0.005734 -B= 108.343185 -Alpha= 0.0067512 0.00239062 0.0140378 0.0043452 0.00365788 0.00689345 0.0148828 0.00715373 0.00789036 0.00614036 0.00289697 0.858995 0.00399721 0.00770961 0.00570515 0.0238176 0.011602 0.00591549 0.00167893 0.00353897 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= N - -Number= 22 -Mixture= 0.022818 -B= 15.153304 -Alpha= 0.0417987 0.00360232 0.0113792 0.0152366 0.00564775 0.0123795 0.00606957 0.0091353 0.0165122 0.0167265 0.00490487 0.00915437 0.755604 0.0131375 0.012587 0.0283392 0.0189623 0.0140029 0.0012848 0.00353553 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= P - -Number= 23 -Mixture= 0.005931 -B= 79.417511 -Alpha= 0.0142993 0.00266984 0.0053289 0.0321605 0.0028715 0.00426743 0.0257509 0.00565307 0.0106106 0.0161186 0.00955753 0.0104696 0.00638107 0.807311 0.0149106 0.0111968 0.00889459 0.00681482 0.00206658 0.00266624 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= Q - -Number= 24 -Mixture= 0.011491 -B= 93.103897 -Alpha= 0.00756896 0.00314197 0.00296652 0.00327634 0.00194604 0.00467894 0.00721049 0.00406061 0.0277257 0.00663852 0.00217868 0.00577047 0.00473306 0.00953551 0.889701 0.00650859 0.00506022 0.00294281 0.00205549 0.00230062 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= R - -Number= 25 -Mixture= 0.008219 -B= 47.504795 -Alpha= 0.0284818 0.00697155 0.00749796 0.00604665 0.00515171 0.00954817 0.00380684 0.00637929 0.0104463 0.00908885 0.00471437 0.0194592 0.00711823 0.00611827 0.00979722 0.707416 0.139256 0.00656298 0.0015377 0.00460086 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= S - -Number= 26 -Mixture= 0.019050 -B= 14.027470 -Alpha= 0.0247201 0.00718027 0.00845584 0.0076239 0.00600101 0.0073401 0.00492149 0.0173757 0.0129878 0.0125773 0.0100452 0.0230424 0.00659406 0.0110314 0.0112037 0.107763 0.690341 0.0249364 0.00193884 0.00392074 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= T - -Number= 27 -Mixture= 0.007047 -B= 76.958153 -Alpha= 0.0447488 0.00734525 0.00576457 0.00805666 0.00714188 0.00593389 0.0041663 0.0688592 0.00714299 0.0255115 0.00800708 0.00501678 0.00632646 0.00492002 0.00812967 0.0100074 0.0240134 0.745035 0.00126243 0.00261056 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= V - -Number= 28 -Mixture= 0.003957 -B= 150.973328 -Alpha= 0.00517343 0.00213336 0.00350645 0.00390297 0.018439 0.0041919 0.0023655 0.00404231 0.00420998 0.0171406 0.00379068 0.00363696 0.00245861 0.00387467 0.00502035 0.00465674 0.00417283 0.00620977 0.888513 0.012561 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= W - -Number= 29 -Mixture= 0.004904 -B= 30.653225 -Alpha= 0.0342049 0.00809912 0.0126852 0.0174701 0.156033 0.0118268 0.0431342 0.0204751 0.0164439 0.0363664 0.0129811 0.0131986 0.0103037 0.0116235 0.0159032 0.0287792 0.0176143 0.024986 0.0131845 0.494687 -FullUpdate= 1 -QUpdate= 1 -StructID= 0 -Comment= Y - -/* $Header$ */ -/* $Header$ */ -/* $Header$ */
--- a/tool_dependencies.xml Tue Mar 08 08:10:52 2016 -0500 +++ b/tool_dependencies.xml Fri Jun 17 13:15:48 2016 -0400 @@ -4,6 +4,6 @@ <repository changeset_revision="942ae5bafee3" name="package_imagemagick_6_9_3" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> <package name="meme" version="4.11.0"> - <repository changeset_revision="738dc831aeac" name="package_meme_4_11_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="5774a0e96d6f" name="package_meme_4_11_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency>