# HG changeset patch
# User iuc
# Date 1450695813 18000
# Node ID e416c7c26977edd320f09eb03b9895788201c3ea
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme commit 71ac7e12419b8541746ebf8d4ba704cbbd603db1
diff -r 000000000000 -r e416c7c26977 meme.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/meme.xml Mon Dec 21 06:03:33 2015 -0500
@@ -0,0 +1,333 @@
+
+ - Multiple Em for Motif Elicitation
+
+ meme
+
+
+ &1 || echo "Error running MEME."
+ && mv ${html_outfile.files_path}/meme.html ${html_outfile}
+ && mv ${html_outfile.files_path}/meme.txt ${txt_outfile}
+ && mv ${html_outfile.files_path}/meme.xml ${xml_outfile}
+ ]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ value == True
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: warningmark
+
+**WARNING: This tool is only available for non-commercial use. Use for educational, research and non-profit purposes is permitted.
+Before using, be sure to review, agree, and comply with the license.**
+
+If you want to specify sequence weights, you must include them at the top of your input FASTA file.
+
+MEME discovers novel, ungapped motifs (recurring, fixed-length patterns) in your sequences (sample output from sequences).
+MEME splits variable-length patterns into two or more separate motifs. A motif is a sequence pattern that occurs repeatedly
+in a group of related sequences. MEME represents motifs as position-dependent letter-probability matrices which describe the
+probability of each possible letter at each position in the pattern. Individual MEME motifs do not contain gaps. Patterns
+with variable-length gaps are split by MEME into two or more separate motifs. MEME takes as input a group of sequences and
+outputs as many motifs as requested. MEME uses statistical modeling techniques to automatically choose the best width, number
+of occurrences, and description for each motif.
+
+.. class:: infomark
+
+For detailed information on MEME, click here_, or view the license_.
+
+.. _here: http://meme-suite.org/doc/meme.html?man_type=web
+.. _license: http://meme-suite.org/doc/copyright.html?man_type=web
+
+
+
+
+ @published{Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California,
+ author = {Bailey,Timothy L. and Elkan, Charles},
+ title = {Fitting a mixture model by expectation maximization to discover motifs in biopolymers},
+ year = {1994},
+ eprint = {None},
+ url = {http://www.sdsc.edu/~tbailey/papers/ismb94.pdf}
+ }
+
+
diff -r 000000000000 -r e416c7c26977 test-data/meme_input_1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme_input_1.fasta Mon Dec 21 06:03:33 2015 -0500
@@ -0,0 +1,66 @@
+>chr21_19617074_19617124_+
+AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA
+>chr21_26934381_26934431_+
+GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT
+>chr21_28217753_28217803_-
+CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA
+>chr21_31710037_31710087_-
+AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT
+>chr21_31744582_31744632_-
+CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA
+>chr21_31768316_31768366_+
+AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT
+>chr21_31914206_31914256_-
+TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC
+>chr21_31933633_31933683_-
+TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT
+>chr21_31962741_31962791_-
+ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA
+>chr21_31964683_31964733_+
+TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC
+>chr21_31973364_31973414_+
+aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC
+>chr21_31992870_31992920_+
+CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT
+>chr21_32185595_32185645_-
+TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA
+>chr21_32202076_32202126_-
+TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT
+>chr21_32253899_32253949_-
+AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC
+>chr21_32410820_32410870_-
+TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG
+>chr21_36411748_36411798_-
+ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt
+>chr21_37838750_37838800_-
+gatggttttataaggggcctcaccctcggctcagccctcattcttctcct
+>chr21_45705687_45705737_+
+CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC
+>chr21_45971413_45971463_-
+CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca
+>chr21_45978668_45978718_-
+CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca
+>chr21_45993530_45993580_+
+CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC
+>chr21_46020421_46020471_+
+GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc
+>chr21_46031920_46031970_+
+GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC
+>chr21_46046964_46047014_+
+ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca
+>chr21_46057197_46057247_+
+ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC
+>chr21_46086869_46086919_-
+GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC
+>chr21_46102103_46102153_-
+AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT
+>chr21_47517957_47518007_+
+CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
+>chr21_47517957_47518007_+
+CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
+>chr21_47517957_47518007_+
+CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
+>chr21_47575506_47575556_-
+TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
+>chr21_47575506_47575556_-
+TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
diff -r 000000000000 -r e416c7c26977 test-data/meme_output_html_1.html
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme_output_html_1.html Mon Dec 21 06:03:33 2015 -0500
@@ -0,0 +1,100 @@
+
+
+
+
+ MEME
+