Mercurial > repos > iuc > meme_meme
changeset 12:5585f04eb317 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme commit 42fa6e319cf1a97330818dc8c869871a32f0e7aa
| author | iuc |
|---|---|
| date | Wed, 25 Apr 2018 12:12:22 -0400 |
| parents | 7a5164f99316 |
| children | 57e5d9382f36 |
| files | test-data/dreme1.html test-data/dreme1.txt test-data/dreme1.xml test-data/dreme2.html test-data/dreme2.txt test-data/dreme_test_sites.fa |
| diffstat | 6 files changed, 14519 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/dreme1.html Wed Apr 25 12:12:22 2018 -0400 @@ -0,0 +1,6199 @@ +<!DOCTYPE HTML> +<html> + <head> + <meta charset="UTF-8"> + <title>DREME</title> + <script> + // @JSON_VAR data + var data = { + "program": "dreme", + "version": "4.11.2", + "release": "Thu May 05 14:58:55 2016 -0700", + "cmd": [ + "dreme", "-o", "./output", "-p", + "/tmp/tmpijN1y0/files/000/dataset_1.dat", "-norc", "-rna", "-s", + "1" + ], + "options": { + "revcomp": false, + "ngen": 100, + "add_pv_thresh": 0.01, + "seed": 1, + "stop": { + "evalue": "0.05" + } + }, + "alphabet": { + "name": "RNA", + "like": "rna", + "ncore": 4, + "symbols": [ + { + "symbol": "A", + "name": "Adenine", + "colour": "CC0000" + }, { + "symbol": "C", + "name": "Cytosine", + "colour": "0000CC" + }, { + "symbol": "G", + "name": "Guanine", + "colour": "FFB300" + }, { + "symbol": "U", + "aliases": "T", + "name": "Uracil", + "colour": "008000" + }, { + "symbol": "N", + "aliases": "X.", + "name": "Any base", + "equals": "ACGU" + }, { + "symbol": "V", + "name": "Not U", + "equals": "ACG" + }, { + "symbol": "H", + "name": "Not G", + "equals": "ACU" + }, { + "symbol": "D", + "name": "Not C", + "equals": "AGU" + }, { + "symbol": "B", + "name": "Not A", + "equals": "CGU" + }, { + "symbol": "M", + "name": "Amino", + "equals": "AC" + }, { + "symbol": "R", + "name": "Purine", + "equals": "AG" + }, { + "symbol": "W", + "name": "Weak", + "equals": "AU" + }, { + "symbol": "S", + "name": "Strong", + "equals": "CG" + }, { + "symbol": "Y", + "name": "Pyrimidine", + "equals": "CU" + }, { + "symbol": "K", + "name": "Keto", + "equals": "GU" + } + ] + }, + "background": { + "freqs": [0.221, 0.245, 0.221, 0.312] + }, + "sequence_db": { + "name": "dataset 1", + "file": "/tmp/tmpijN1y0/files/000/dataset_1.dat", + "lmod": "Tue Apr 24 13:55:48 CEST 2018", + "count": 1000 + }, + "control_db": { + "name": "shuffled positive sequences", + "from": "shuffled", + "count": 1000, + "freqs": [0.221, 0.245, 0.221, 0.312] + }, + "motifs": [ + { + "db": 0, + "id": "UUYUCY", + "alt": "MEME", + "len": 6, + "nsites": 459, + "evalue": "1.2e-013", + "p": 387, + "n": 210, + "pvalue": "2.6e-018", + "unerased_evalue": "1.2e-013", + "pwm": [ + [0.000000, 0.000000, 0.000000, 1.000000], + [0.000000, 0.000000, 0.000000, 1.000000], + [0.000000, 0.294118, 0.000000, 0.705882], + [0.000000, 0.000000, 0.000000, 1.000000], + [0.000000, 1.000000, 0.000000, 0.000000], + [0.000000, 0.474946, 0.000000, 0.525054] + ], + "matches": [ + { + "seq": "UUUUCC", + "p": 147, + "n": 75, + "pvalue": "1.8e-007", + "evalue": "8.1e-003" + }, { + "seq": "UUUUCU", + "p": 155, + "n": 94, + "pvalue": "2.2e-005", + "evalue": "1.0e+000" + }, { + "seq": "UUCUCU", + "p": 94, + "n": 51, + "pvalue": "1.3e-004", + "evalue": "6.1e+000" + }, { + "seq": "UUCUCC", + "p": 75, + "n": 42, + "pvalue": "1.1e-003", + "evalue": "5.0e+001" + } + ] + }, { + "db": 0, + "id": "YAGG", + "alt": "MEME", + "len": 4, + "nsites": 793, + "evalue": "5.1e-012", + "p": 600, + "n": 416, + "pvalue": "1.1e-016", + "unerased_evalue": "2.4e-012", + "pwm": [ + [0.000000, 0.692308, 0.000000, 0.307692], + [1.000000, 0.000000, 0.000000, 0.000000], + [0.000000, 0.000000, 1.000000, 0.000000], + [0.000000, 0.000000, 1.000000, 0.000000] + ], + "matches": [ + { + "seq": "CAGG", + "p": 441, + "n": 304, + "pvalue": "1.5e-010", + "evalue": "6.6e-006" + }, { + "seq": "UAGG", + "p": 232, + "n": 165, + "pvalue": "1.1e-004", + "evalue": "4.7e+000" + } + ] + }, { + "db": 0, + "id": "GAAGAW", + "alt": "MEME", + "len": 6, + "nsites": 89, + "evalue": "3.4e-005", + "p": 81, + "n": 22, + "pvalue": "8.2e-010", + "unerased_evalue": "3.5e-004", + "pwm": [ + [0.000000, 0.000000, 1.000000, 0.000000], + [1.000000, 0.000000, 0.000000, 0.000000], + [1.000000, 0.000000, 0.000000, 0.000000], + [0.000000, 0.000000, 1.000000, 0.000000], + [1.000000, 0.000000, 0.000000, 0.000000], + [0.494382, 0.000000, 0.000000, 0.505618] + ], + "matches": [ + { + "seq": "GAAGAU", + "p": 45, + "n": 7, + "pvalue": "2.4e-008", + "evalue": "9.9e-004" + }, { + "seq": "GAAGAA", + "p": 40, + "n": 16, + "pvalue": "7.9e-004", + "evalue": "3.3e+001" + } + ] + }, { + "db": 0, + "id": "SMUGGA", + "alt": "MEME", + "len": 6, + "nsites": 119, + "evalue": "3.7e-003", + "p": 110, + "n": 47, + "pvalue": "9.1e-008", + "unerased_evalue": "2.6e-005", + "pwm": [ + [0.000000, 0.529412, 0.470588, 0.000000], + [0.428571, 0.571429, 0.000000, 0.000000], + [0.000000, 0.000000, 0.000000, 1.000000], + [0.000000, 0.000000, 1.000000, 0.000000], + [0.000000, 0.000000, 1.000000, 0.000000], + [1.000000, 0.000000, 0.000000, 0.000000] + ], + "matches": [ + { + "seq": "GAUGGA", + "p": 22, + "n": 6, + "pvalue": "1.7e-003", + "evalue": "7.1e+001" + }, { + "seq": "GCUGGA", + "p": 33, + "n": 14, + "pvalue": "3.6e-003", + "evalue": "1.5e+002" + }, { + "seq": "CCUGGA", + "p": 32, + "n": 15, + "pvalue": "8.6e-003", + "evalue": "3.5e+002" + }, { + "seq": "CAUGGA", + "p": 29, + "n": 13, + "pvalue": "9.1e-003", + "evalue": "3.7e+002" + } + ] + } + ], + "runtime": { + "host": "ThinkPad-T450s", + "when": "Tue Apr 24 13:55:53 CEST 2018", + "cpu": 16.65, + "real": 16.65, + "stop": "evalue" + } + }; + </script> + <script> +var site_url = ""; +</script> + <script> + +/* + * $ + * + * Shorthand function for getElementById + */ +function $(el) { + return document.getElementById(el); +} + + +/* + * See http://stackoverflow.com/a/5450113/66387 + * Does string multiplication like the perl x operator. + */ +function string_mult(pattern, count) { + if (count < 1) return ''; + var result = ''; + while (count > 1) { + if (count & 1) result += pattern; + count >>= 1, pattern += pattern; + } + return result + pattern; +} + +/* + * See http://stackoverflow.com/questions/814613/how-to-read-get-data-from-a-url-using-javascript + * Slightly modified with information from + * https://developer.mozilla.org/en/DOM/window.location + */ +function parse_params() { + "use strict"; + var search, queryStart, queryEnd, query, params, nvPairs, i, nv, n, v; + search = window.location.search; + queryStart = search.indexOf("?") + 1; + queryEnd = search.indexOf("#") + 1 || search.length + 1; + query = search.slice(queryStart, queryEnd - 1); + + if (query === search || query === "") return {}; + + params = {}; + nvPairs = query.replace(/\+/g, " ").split("&"); + + for (i = 0; i < nvPairs.length; i++) { + nv = nvPairs[i].split("="); + n = decodeURIComponent(nv[0]); + v = decodeURIComponent(nv[1]); + // allow a name to be used multiple times + // storing each value in the array + if (!(n in params)) { + params[n] = []; + } + params[n].push(nv.length === 2 ? v : null); + } + return params; +} + +/* + * coords + * + * Calculates the x and y offset of an element. + * From http://www.quirksmode.org/js/findpos.html + * with alterations to take into account scrolling regions + */ +function coords(elem) { + var myX = myY = 0; + if (elem.getBoundingClientRect) { + var rect; + rect = elem.getBoundingClientRect(); + myX = rect.left + ((typeof window.pageXOffset !== "undefined") ? + window.pageXOffset : document.body.scrollLeft); + myY = rect.top + ((typeof window.pageYOffset !== "undefined") ? + window.pageYOffset : document.body.scrollTop); + } else { + // this fall back doesn't properly handle absolutely positioned elements + // inside a scrollable box + var node; + if (elem.offsetParent) { + // subtract all scrolling + node = elem; + do { + myX -= node.scrollLeft ? node.scrollLeft : 0; + myY -= node.scrollTop ? node.scrollTop : 0; + } while (node = node.parentNode); + // this will include the page scrolling (which is unwanted) so add it back on + myX += (typeof window.pageXOffset !== "undefined") ? window.pageXOffset : document.body.scrollLeft; + myY += (typeof window.pageYOffset !== "undefined") ? window.pageYOffset : document.body.scrollTop; + // sum up offsets + node = elem; + do { + myX += node.offsetLeft; + myY += node.offsetTop; + } while (node = node.offsetParent); + } + } + return [myX, myY]; +} + +/* + * position_popup + * + * Positions a popup relative to an anchor element. + * + * The avaliable positions are: + * 0 - Centered below the anchor. + */ +function position_popup(anchor, popup, position) { + "use strict"; + var a_x, a_y, a_w, a_h, p_x, p_y, p_w, p_h; + var a_xy, spacer, margin, scrollbar, page_w; + // define constants + spacer = 5; + margin = 15; + scrollbar = 15; + // define the positions and widths + a_xy = coords(anchor); + a_x = a_xy[0]; + a_y = a_xy[1]; + a_w = anchor.offsetWidth; + a_h = anchor.offsetHeight; + p_w = popup.offsetWidth; + p_h = popup.offsetHeight; + page_w = null; + if (window.innerWidth) { + page_w = window.innerWidth; + } else if (document.body) { + page_w = document.body.clientWidth; + } + // check the position type is defined + if (typeof position !== "number") { + position = 0; + } + // calculate the popup position + switch (position) { + case 1: + p_x = a_x + a_w + spacer; + p_y = a_y + (a_h / 2) - (p_h / 2); + break; + case 0: + default: + p_x = a_x + (a_w / 2) - (p_w / 2); + p_y = a_y + a_h + spacer; + break; + } + // constrain the popup position + if (p_x < margin) { + p_x = margin; + } else if (page_w != null && (p_x + p_w) > (page_w - margin - scrollbar)) { + p_x = page_w - margin - scrollbar - p_w; + } + if (p_y < margin) { + p_y = margin; + } + // position the popup + popup.style.left = p_x + "px"; + popup.style.top = p_y + "px"; +} + +function lookup_help_popup(popup_id) { + var _body, pop, info; + pop = document.getElementById(popup_id); + if (pop == null) { + _body = document.getElementsByTagName("body")[0]; + pop = document.createElement("div"); + pop.className = "pop_content"; + pop.id = popup_id; + pop.style.backgroundColor = "#FFC"; + pop.style.borderColor = "black"; + info = document.createElement("p"); + info.style.fontWeight = "bold"; + info.appendChild(document.createTextNode("Error: No popup for topic \"" + popup_id + "\".")); + pop.appendChild(info); + // this might cause problems with the menu, but as this only happens + // when something is already wrong I don't think that's too much of a problem + _body.insertBefore(pop, _body.firstChild); + } + if (document.getElementsByTagName('body')[0].hasAttribute("data-autobtns")) { + if (!/\bauto_buttons\b/.test(pop.className)) { + pop.className += " auto_buttons"; + var back_btn_sec = document.createElement("div"); + back_btn_sec.className = "nested_only pop_back_sec"; + var back_btn = document.createElement("span"); + back_btn.className = "pop_back"; + back_btn.appendChild(document.createTextNode("<< back")); + back_btn.addEventListener("click", function(e) { + help_return(); + }, false); + back_btn_sec.appendChild(back_btn); + pop.insertBefore(back_btn_sec, pop.firstChild); + var close_btn_sec = document.createElement("div"); + close_btn_sec.className = "pop_close_sec"; + var close_btn = document.createElement("span"); + close_btn.className = "pop_close"; + close_btn.appendChild(document.createTextNode("close")); + close_btn.addEventListener("click", function(e) { + help_popup(); + }, false); + close_btn_sec.appendChild(close_btn); + pop.appendChild(close_btn_sec); + } + } + return pop; +} + +/* + * help_popup + * + * Moves around help pop-ups so they appear + * below an activator. + */ +function help_popup(activator, popup_id) { + "use strict"; + var pop; + // set default values + if (typeof help_popup.popup === "undefined") { + help_popup.popup = []; + } + if (typeof help_popup.activator === "undefined") { + help_popup.activator = null; + } + var last_pop = (help_popup.popup.length > 0 ? help_popup.popup[help_popup.popup.length - 1] : null); + if (typeof(activator) == "undefined") { // no activator so hide + if (last_pop != null) { + last_pop.style.display = 'none'; + help_popup.popup = []; + } + return; + } + pop = lookup_help_popup(popup_id); + if (pop == last_pop) { + if (activator == help_popup.activator) { + //hide popup (as we've already shown it for the current help button) + last_pop.style.display = 'none'; + help_popup.popup = []; + return; // toggling complete! + } + } else if (last_pop != null) { + //activating different popup so hide current one + last_pop.style.display = 'none'; + } + help_popup.popup = [pop]; + help_popup.activator = activator; + toggle_class(pop, "nested", false); + //must make the popup visible to measure it or it has zero width + pop.style.display = 'block'; + position_popup(activator, pop); +} + +/* + * help_refine + * + * Intended for links within a help popup. Stores a stack of state so + * you can go back. + */ +function help_refine(popup_id) { + if (help_popup.popup == null || help_popup.popup.length == 0 || help_popup.activator == null) { + throw new Error("Can not refine a help popup when one is not shown!"); + } + var pop = lookup_help_popup(popup_id); + var last_pop = help_popup.popup[help_popup.popup.length - 1]; + if (pop == last_pop) return; // slightly odd, but no real cause for alarm + help_popup.popup.push(pop); + toggle_class(pop, "nested", true); + last_pop.style.display = "none"; + //must make the popup visible to measure it or it has zero width + pop.style.display = "block"; + position_popup(help_popup.activator, pop); +} + +/* + * help_return + * + * Intended for links within a help popup. Stores a stack of state so + * you can go back. + */ +function help_return() { + if (help_popup.popup == null || help_popup.popup.length == 0 || help_popup.activator == null) { + throw new Error("Can not return to a earlier help popup when one is not shown!"); + } + var last_pop = help_popup.popup.pop(); + last_pop.style.display = "none"; + var pop = (help_popup.popup.length > 0 ? help_popup.popup[help_popup.popup.length - 1] : null); + if (pop != null) { + toggle_class(pop, "nested", help_popup.popup.length > 1); + pop.style.display = "block"; + position_popup(help_popup.activator, pop); + } else { + help_popup.activator = null; + } +} + +/* + * update_scroll_pad + * + * Creates padding at the bottom of the page to allow + * scrolling of anything into view. + */ +function update_scroll_pad() { + var page, pad; + page = (document.compatMode === "CSS1Compat") ? document.documentElement : document.body; + pad = $("scrollpad"); + if (pad === null) { + pad = document.createElement("div"); + pad.id = 'scrollpad'; + document.getElementsByTagName('body')[0].appendChild(pad); + } + pad.style.height = Math.abs(page.clientHeight - 100) + "px"; +} + +function substitute_classes(node, remove, add) { + "use strict"; + var list, all, i, cls, classes; + list = node.className.split(/\s+/); + all = {}; + for (i = 0; i < list.length; i++) { + if (list[i].length > 0) all[list[i]] = true; + } + for (i = 0; i < remove.length; i++) { + if (all.hasOwnProperty(remove[i])) { + delete all[remove[i]]; + } + } + for (i = 0; i < add.length; i++) { + all[add[i]] = true; + } + classes = ""; + for (cls in all) { + classes += cls + " "; + } + node.className = classes; +} + +/* + * toggle_class + * + * Adds or removes a class from the node. If the parameter 'enabled' is not + * passed then the existence of the class will be toggled, otherwise it will be + * included if enabled is true. + */ +function toggle_class(node, cls, enabled) { + var classes = node.className; + var list = classes.replace(/^\s+/, '').replace(/\s+$/, '').split(/\s+/); + var found = false; + for (var i = 0; i < list.length; i++) { + if (list[i] == cls) { + list.splice(i, 1); + i--; + found = true; + } + } + if (typeof enabled == "undefined") { + if (!found) list.push(cls); + } else { + if (enabled) list.push(cls); + } + node.className = list.join(" "); +} + +/* + * find_child + * + * Searches child nodes in depth first order and returns the first it finds + * with the className specified. + * TODO replace with querySelector + */ +function find_child(node, className) { + var pattern; + if (node == null || typeof node !== "object") { + return null; + } + if (typeof className === "string") { + pattern = new RegExp("\\b" + className + "\\b"); + } else { + pattern = className; + } + if (node.nodeType == Node.ELEMENT_NODE && + pattern.test(node.className)) { + return node; + } else { + var result = null; + for (var i = 0; i < node.childNodes.length; i++) { + result = find_child(node.childNodes[i], pattern); + if (result != null) break; + } + return result; + } +} + +/* + * find_parent + * + * Searches parent nodes outwards from the node and returns the first it finds + * with the className specified. + */ +function find_parent(node, className) { + var pattern; + pattern = new RegExp("\\b" + className + "\\b"); + do { + if (node.nodeType == Node.ELEMENT_NODE && + pattern.test(node.className)) { + return node; + } + } while (node = node.parentNode); + return null; +} + +/* + * find_parent_tag + * + * Searches parent nodes outwards from the node and returns the first it finds + * with the tag name specified. HTML tags should be specified in upper case. + */ +function find_parent_tag(node, tag_name) { + do { + if (node.nodeType == Node.ELEMENT_NODE && node.tagName == tag_name) { + return node; + } + } while (node = node.parentNode); + return null; +} + +/* + * __toggle_help + * + * Uses the 'topic' property of the this object to + * toggle display of a help topic. + * + * This function is not intended to be called directly. + */ +function __toggle_help(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + + help_popup(this, this.getAttribute("data-topic")); +} + +function setup_help_button(button) { + "use strict"; + var topic; + if (button.hasAttribute("data-topic")) { + topic = button.getAttribute("data-topic"); + if (document.getElementById(topic) != null) { + button.tabIndex = "0"; // make keyboard selectable + button.addEventListener("click", function() { + help_popup(button, topic); + }, false); + button.addEventListener("keydown", function(e) { + // toggle only on Enter or Spacebar, let other keys do their thing + if (e.keyCode !== 13 && e.keyCode !== 32) return; + // stop a submit or something like that + e.preventDefault(); + help_popup(button, topic); + }, false); + } else { + button.style.visibility = "hidden"; + } + } + button.className += " active"; +} + +/* + * help_button + * + * Makes a help button for the passed topic. + */ +function help_button(topic) { + var btn = document.createElement("div"); + btn.className = "help"; + btn.setAttribute("data-topic", topic); + setup_help_button(btn); + return btn; +} + +/* + * prepare_download + * + * Sets the attributes of a link to setup a file download using the given content. + * If no link is provided then create one and click it. + */ +function prepare_download(content, mimetype, filename, link) { + "use strict"; + // if no link is provided then create one and click it + var click_link = false; + if (!link) { + link = document.createElement("a"); + click_link = true; + } + try { + // Use a BLOB to convert the text into a data URL. + // We could do this manually with a base 64 conversion. + // This will only be supported on modern browsers, + // hence the try block. + var blob = new Blob([content], {type: mimetype}); + var reader = new FileReader(); + reader.onloadend = function() { + // If we're lucky the browser will also support the download + // attribute which will let us suggest a file name to save the link. + // Otherwise it is likely that the filename will be unintelligible. + link.setAttribute("download", filename); + link.href = reader.result; + if (click_link) { + // must add the link to click it + document.body.appendChild(link); + link.click(); + document.body.removeChild(link); + } + } + reader.readAsDataURL(blob); + } catch (error) { + if (console && console.log) console.log(error); + // probably an old browser + link.href = ""; + link.visible = false; + } +} + +/* + * add_cell + * + * Add a cell to the table row. + */ +function add_cell(row, node, cls, click_action) { + var cell = row.insertCell(row.cells.length); + if (node) cell.appendChild(node); + if (cls && cls !== "") cell.className = cls; + if (click_action) cell.addEventListener("click", click_action, false); +} + +/* + * add_header_cell + * + * Add a header cell to the table row. + */ +function add_header_cell(row, node, help_topic, cls, colspan) { + var th = document.createElement("th"); + if (node) th.appendChild(node); + if (help_topic && help_topic !== "") th.appendChild(help_button(help_topic)); + if (cls && cls !== "") th.className = cls; + if (typeof colspan == "number" && colspan > 1) th.colSpan = colspan; + row.appendChild(th); +} + +/* + * add_text_cell + * + * Add a text cell to the table row. + */ +function add_text_cell(row, text, cls, action) { + var node = null; + if (typeof(text) != 'undefined') node = document.createTextNode(text); + add_cell(row, node, cls, action); +} + +/* + * add_text_header_cell + * + * Add a text header cell to the table row. + */ +function add_text_header_cell(row, text, help_topic, cls, action, colspan) { + var node = null; + if (typeof(text) != 'undefined') { + var nbsp = (help_topic ? "\u00A0" : ""); + var str = "" + text; + var parts = str.split(/\n/); + if (parts.length === 1) { + if (action) { + node = document.createElement("span"); + node.appendChild(document.createTextNode(str + nbsp)); + } else { + node = document.createTextNode(str + nbsp); + } + } else { + node = document.createElement("span"); + for (var i = 0; i < parts.length; i++) { + if (i !== 0) { + node.appendChild(document.createElement("br")); + } + node.appendChild(document.createTextNode(parts[i])); + } + } + if (action) { + node.addEventListener("click", action, false); + node.style.cursor = "pointer"; + } + } + add_header_cell(row, node, help_topic, cls, colspan); +} + +function setup_help() { + "use strict"; + var help_buttons, i; + help_buttons = document.querySelectorAll(".help:not(.active)"); + for (i = 0; i < help_buttons.length; i++) { + setup_help_button(help_buttons[i]); + } +} + +function setup_scrollpad() { + "use strict"; + if (document.getElementsByTagName('body')[0].hasAttribute("data-scrollpad") && document.getElementById("scrollpad") == null) { + window.addEventListener("resize", update_scroll_pad, false); + update_scroll_pad(); + } +} + +// anon function to avoid polluting global scope +(function() { + "use strict"; + window.addEventListener("load", function load(evt) { + window.removeEventListener("load", load, false); + setup_help(); + setup_scrollpad(); + }, false); +})(); + +/* + * make_link + * + * Creates a text node and if a URL is specified it surrounds it with a link. + * If the URL doesn't begin with "http://" it automatically adds it, as + * relative links don't make much sense in this context. + */ +function make_link(text, url) { + var textNode = null; + var link = null; + if (typeof text !== "undefined" && text !== null) textNode = document.createTextNode(text); + if (typeof url === "string") { + if (url.indexOf("//") == -1) { + url = "http://" + url; + } + link = document.createElement('a'); + link.href = url; + if (textNode) link.appendChild(textNode); + return link; + } + return textNode; +} +</script> + <script> +function motif_logo_template(inputs) { + function _input(name) { + if (typeof inputs[name] === "undefined") { + throw new Error("Missing template variable: " + name); + } + return inputs[name]; + } + return ( +"%!PS-Adobe-3.0 EPSF-3.0\n" + +"%%Title: Sequence Logo : " + _input("TITLE") + "\n" + +"%%Creator: " + _input("CREATOR") + "\n" + +"%%CreationDate: " + _input("CREATIONDATE") + "\n" + +"%%BoundingBox: 0 0 " + _input("BOUNDINGWIDTH") + " " + _input("BOUNDINGHEIGHT") + " \n" + +"%%Pages: 0\n" + +"%%DocumentFonts: \n" + +"%%EndComments\n" + +"\n" + +"% ---- CONSTANTS ----\n" + +"\/cmfactor 72 2.54 div def % defines points -> cm conversion\n" + +"\/cm {cmfactor mul} bind def % defines centimeters\n" + +"\n" + +"% ---- VARIABLES ----\n" + +"\n" + +"% NA = Nucleic Acid, AA = Amino Acid\n" + +"\/logoType (" + _input("LOGOTYPE") + ") def \n" + +"\n" + +"\/logoTitle (" + _input("TITLE") + ") def\n" + +"\n" + +"% Dimensions in cm\n" + +"\/logoWidth " + _input("LOGOWIDTH") + " cm def\n" + +"\/logoHeight " + _input("LOGOLINEHEIGHT") + " cm def\n" + +"\/totalHeight " + _input("LOGOHEIGHT") + " cm def\n" + +"\n" + +"\/yaxis " + _input("YAXIS") + " def\n" + +"\/yaxisLabel (" + _input("YAXISLABEL") + ") def\n" + +"\/yaxisBits " + _input("BARBITS") + " def % bits\n" + +"\/yaxisTicBits " + _input("TICBITS") + " def\n" + +"\n" + +"\/xaxis " + _input("NUMBERING") + " def\n" + +"\/xaxisLabel (" + _input("XAXISLABEL") + ") def\n" + +"\/showEnds (" + _input("SHOWENDS") + ") def \n" + +"\n" + +"\/showFineprint true def\n" + +"\/fineprint (" + _input("FINEPRINT") + ") def\n" + +"\n" + +"\/charsPerLine " + _input("CHARSPERLINE") + " def\n" + +"\n" + +"\/showingBox " + _input("SHOWINGBOX") + " def \n" + +"\/shrinking false def % true falses\n" + +"\/shrink 1.0 def\n" + +"\/outline " + _input("OUTLINE") + " def\n" + +"\n" + +"\/IbeamFraction " + _input("ERRORBARFRACTION") + " def\n" + +"\/IbeamGray 0.50 def\n" + +"\/IbeamLineWidth 0.5 def\n" + +"\n" + +"\/fontsize " + _input("FONTSIZE") + " def\n" + +"\/titleFontsize " + _input("TITLEFONTSIZE") + " def\n" + +"\/smallFontsize " + _input("SMALLFONTSIZE") + " def\n" + +"\n" + +"\/topMargin " + _input("TOPMARGIN") + " cm def\n" + +"\/bottomMargin " + _input("BOTTOMMARGIN") + " cm def\n" + +"\n" + +"\/defaultColor [0 0 0] def \n" + +"\n" + +_input("COLORDICT") + "\n" + +"\n" + +"\/colorDict fullColourDict def\n" + +"\n" + +"% ---- DERIVED PARAMETERS ----\n" + +"\n" + +"\/leftMargin\n" + +" fontsize 3.5 mul\n" + +"\n" + +"def \n" + +"\n" + +"\/rightMargin \n" + +" %Add extra room if showing ends\n" + +" showEnds (false) eq { fontsize}{fontsize 1.5 mul} ifelse\n" + +"def\n" + +"\n" + +"\/yaxisHeight \n" + +" logoHeight \n" + +" bottomMargin sub \n" + +" topMargin sub\n" + +"def\n" + +"\n" + +"\/ticWidth fontsize 2 div def\n" + +"\n" + +"\/pointsPerBit yaxisHeight yaxisBits div def\n" + +"\n" + +"\/stackMargin 1 def\n" + +"\n" + +"% Do not add space aroung characters if characters are boxed\n" + +"\/charRightMargin \n" + +" showingBox { 0.0 } {stackMargin} ifelse\n" + +"def\n" + +"\n" + +"\/charTopMargin \n" + +" showingBox { 0.0 } {stackMargin} ifelse\n" + +"def\n" + +"\n" + +"\/charWidth\n" + +" logoWidth\n" + +" leftMargin sub\n" + +" rightMargin sub\n" + +" charsPerLine div\n" + +" charRightMargin sub\n" + +"def\n" + +"\n" + +"\/charWidth4 charWidth 4 div def\n" + +"\/charWidth2 charWidth 2 div def\n" + +"\n" + +"\/stackWidth \n" + +" charWidth charRightMargin add\n" + +"def\n" + +" \n" + +"\/numberFontsize \n" + +" fontsize charWidth lt {fontsize}{charWidth} ifelse\n" + +"def\n" + +"\n" + +"% movements to place 5'\/N and 3'\/C symbols\n" + +"\/leftEndDeltaX fontsize neg def\n" + +"\/leftEndDeltaY fontsize 1.5 mul neg def\n" + +"\/rightEndDeltaX fontsize 0.25 mul def\n" + +"\/rightEndDeltaY leftEndDeltaY def\n" + +"\n" + +"% Outline width is proporional to charWidth, \n" + +"% but no less that 1 point\n" + +"\/outlinewidth \n" + +" charWidth 32 div dup 1 gt {}{pop 1} ifelse\n" + +"def\n" + +"\n" + +"\n" + +"% ---- PROCEDURES ----\n" + +"\n" + +"\/StartLogo { \n" + +" % Save state\n" + +" save \n" + +" gsave \n" + +"\n" + +" % Print Logo Title, top center \n" + +" gsave \n" + +" SetStringFont\n" + +"\n" + +" logoWidth 2 div\n" + +" logoTitle\n" + +" stringwidth pop 2 div sub\n" + +" totalHeight\n" + +" titleFontsize sub\n" + +" moveto\n" + +"\n" + +" logoTitle\n" + +" show\n" + +" grestore\n" + +"\n" + +" % Print X-axis label, bottom center\n" + +" gsave\n" + +" SetStringFont\n" + +"\n" + +" logoWidth 2 div\n" + +" xaxisLabel\n" + +" stringwidth pop 2 div sub\n" + +" 0\n" + +" titleFontsize 3 div\n" + +" add\n" + +" moveto\n" + +"\n" + +" xaxisLabel\n" + +" show\n" + +" grestore\n" + +"\n" + +" % Show Fine Print\n" + +" showFineprint {\n" + +" gsave\n" + +" SetSmallFont\n" + +" logoWidth\n" + +" fineprint stringwidth pop sub\n" + +" smallFontsize sub\n" + +" smallFontsize 3 div\n" + +" moveto\n" + +" \n" + +" fineprint show\n" + +" grestore\n" + +" } if\n" + +"\n" + +" % Move to lower left corner of last line, first stack\n" + +" leftMargin bottomMargin translate\n" + +"\n" + +" % Move above first line ready for StartLine \n" + +" 0 totalHeight translate\n" + +"\n" + +" SetLogoFont\n" + +"} bind def\n" + +"\n" + +"\/EndLogo { \n" + +" grestore \n" + +" showpage \n" + +" restore \n" + +"} bind def\n" + +"\n" + +"\n" + +"\/StartLine { \n" + +" % move down to the bottom of the line:\n" + +" 0 logoHeight neg translate\n" + +" \n" + +" gsave \n" + +" yaxis { MakeYaxis } if\n" + +" xaxis { showEnds (true) eq {ShowLeftEnd} if } if\n" + +"} bind def\n" + +"\n" + +"\/EndLine{ \n" + +" xaxis { showEnds (true) eq {ShowRightEnd} if } if\n" + +" grestore \n" + +"} bind def\n" + +"\n" + +"\n" + +"\/MakeYaxis {\n" + +" gsave \n" + +" stackMargin neg 0 translate\n" + +" ShowYaxisBar\n" + +" ShowYaxisLabel\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowYaxisBar { \n" + +" gsave \n" + +" SetStringFont\n" + +"\n" + +" \/str 10 string def % string to hold number \n" + +" \/smallgap stackMargin 2 div def\n" + +"\n" + +" % Draw first tic and bar\n" + +" gsave \n" + +" ticWidth neg 0 moveto \n" + +" ticWidth 0 rlineto \n" + +" 0 yaxisHeight rlineto\n" + +" stroke\n" + +" grestore\n" + +"\n" + +" \n" + +" % Draw the tics\n" + +" % initial increment limit proc for\n" + +" 0 yaxisTicBits yaxisBits abs %cvi\n" + +" {\/loopnumber exch def\n" + +"\n" + +" % convert the number coming from the loop to a string\n" + +" % and find its width\n" + +" loopnumber 10 str cvrs\n" + +" \/stringnumber exch def % string representing the number\n" + +"\n" + +" stringnumber stringwidth pop\n" + +" \/numberwidth exch def % width of number to show\n" + +"\n" + +" \/halfnumberheight\n" + +" stringnumber CharBoxHeight 2 div\n" + +" def\n" + +"\n" + +" numberwidth % move back width of number\n" + +" neg loopnumber pointsPerBit mul % shift on y axis\n" + +" halfnumberheight sub % down half the digit\n" + +"\n" + +" moveto % move back the width of the string\n" + +"\n" + +" ticWidth neg smallgap sub % Move back a bit more \n" + +" 0 rmoveto % move back the width of the tic \n" + +"\n" + +" stringnumber show\n" + +" smallgap 0 rmoveto % Make a small gap \n" + +"\n" + +" % now show the tic mark\n" + +" 0 halfnumberheight rmoveto % shift up again\n" + +" ticWidth 0 rlineto\n" + +" stroke\n" + +" } for\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\/ShowYaxisLabel {\n" + +" gsave\n" + +" SetStringFont\n" + +"\n" + +" % How far we move left depends on the size of\n" + +" % the tic labels.\n" + +" \/str 10 string def % string to hold number \n" + +" yaxisBits yaxisTicBits div cvi yaxisTicBits mul \n" + +" str cvs stringwidth pop\n" + +" ticWidth 1.5 mul add neg \n" + +"\n" + +"\n" + +" yaxisHeight\n" + +" yaxisLabel stringwidth pop\n" + +" sub 2 div\n" + +"\n" + +" translate\n" + +" 90 rotate\n" + +" 0 0 moveto\n" + +" yaxisLabel show\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/StartStack { % <stackNumber> startstack\n" + +" xaxis {MakeNumber}{pop} ifelse\n" + +" gsave\n" + +"} bind def\n" + +"\n" + +"\/EndStack {\n" + +" grestore\n" + +" stackWidth 0 translate\n" + +"} bind def\n" + +"\n" + +"\n" + +"% Draw a character whose height is proportional to symbol bits\n" + +"\/MakeSymbol{ % charbits character MakeSymbol\n" + +" gsave\n" + +" \/char exch def\n" + +" \/bits exch def\n" + +"\n" + +" \/bitsHeight \n" + +" bits pointsPerBit mul \n" + +" def\n" + +"\n" + +" \/charHeight \n" + +" bitsHeight charTopMargin sub\n" + +" dup \n" + +" 0.0 gt {}{pop 0.0} ifelse % if neg replace with zero \n" + +" def \n" + +" \n" + +" charHeight 0.0 gt {\n" + +" char SetColor\n" + +" charWidth charHeight char ShowChar\n" + +"\n" + +" showingBox { % Unfilled box\n" + +" 0 0 charWidth charHeight false ShowBox\n" + +" } if\n" + +"\n" + +"\n" + +" } if\n" + +"\n" + +" grestore\n" + +"\n" + +" 0 bitsHeight translate \n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowChar { % <width> <height> <char> ShowChar\n" + +" gsave\n" + +" \/tc exch def % The character\n" + +" \/ysize exch def % the y size of the character\n" + +" \/xsize exch def % the x size of the character\n" + +"\n" + +" \/xmulfactor 1 def \n" + +" \/ymulfactor 1 def\n" + +" \/limmulfactor 0.01 def\n" + +" \/drawable true def\n" + +"\n" + +" \n" + +" % if ysize is negative, make everything upside down!\n" + +" ysize 0 lt {\n" + +" % put ysize normal in this orientation\n" + +" \/ysize ysize abs def\n" + +" xsize ysize translate\n" + +" 180 rotate\n" + +" } if\n" + +"\n" + +" shrinking {\n" + +" xsize 1 shrink sub 2 div mul\n" + +" ysize 1 shrink sub 2 div mul translate \n" + +"\n" + +" shrink shrink scale\n" + +" } if\n" + +"\n" + +" % Calculate the font scaling factors\n" + +" % Loop twice to catch small correction due to first scaling\n" + +" 2 {\n" + +" gsave\n" + +" xmulfactor ymulfactor scale\n" + +" \n" + +" ysize % desired size of character in points\n" + +" tc CharBoxHeight \n" + +" dup 0.0 ne {\n" + +" div % factor by which to scale up the character\n" + +" \/ymulfactor exch def\n" + +" } % end if\n" + +" {pop pop}\n" + +" ifelse\n" + +"\n" + +" xsize % desired size of character in points\n" + +" tc CharBoxWidth \n" + +" dup 0.0 ne {\n" + +" div % factor by which to scale up the character\n" + +" \/xmulfactor exch def\n" + +" } % end if\n" + +" {pop pop}\n" + +" ifelse\n" + +" grestore\n" + +" % if the multiplication factors get too small we need to avoid a crash\n" + +" xmulfactor limmulfactor lt {\n" + +" \/xmulfactor 1 def\n" + +" \/drawable false def\n" + +" } if\n" + +" ymulfactor limmulfactor lt {\n" + +" \/ymulfactor 1 def\n" + +" \/drawable false def\n" + +" } if\n" + +" } repeat\n" + +"\n" + +" % Adjust horizontal position if the symbol is an I\n" + +" tc (I) eq {\n" + +" charWidth 2 div % half of requested character width\n" + +" tc CharBoxWidth 2 div % half of the actual character\n" + +" sub 0 translate\n" + +" % Avoid x scaling for I \n" + +" \/xmulfactor 1 def \n" + +" } if\n" + +"\n" + +"\n" + +" % ---- Finally, draw the character\n" + +" drawable { \n" + +" newpath\n" + +" xmulfactor ymulfactor scale\n" + +"\n" + +" % Move lower left corner of character to start point\n" + +" tc CharBox pop pop % llx lly : Lower left corner\n" + +" exch neg exch neg\n" + +" moveto\n" + +"\n" + +" outline { % outline characters:\n" + +" outlinewidth setlinewidth\n" + +" tc true charpath\n" + +" gsave 1 setgray fill grestore\n" + +" clip stroke\n" + +" } { % regular characters\n" + +" tc show\n" + +" } ifelse\n" + +" } if\n" + +"\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowBox { % x1 y1 x2 y2 filled ShowBox\n" + +" gsave\n" + +" \/filled exch def \n" + +" \/y2 exch def\n" + +" \/x2 exch def\n" + +" \/y1 exch def\n" + +" \/x1 exch def\n" + +" newpath\n" + +" x1 y1 moveto\n" + +" x2 y1 lineto\n" + +" x2 y2 lineto\n" + +" x1 y2 lineto\n" + +" closepath\n" + +"\n" + +" clip\n" + +" \n" + +" filled {\n" + +" fill\n" + +" }{ \n" + +" 0 setgray stroke \n" + +" } ifelse\n" + +"\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/MakeNumber { % number MakeNumber\n" + +" gsave\n" + +" SetNumberFont\n" + +" stackWidth 0 translate\n" + +" 90 rotate % rotate so the number fits\n" + +" dup stringwidth pop % find the length of the number\n" + +" neg % prepare for move\n" + +" stackMargin sub % Move back a bit\n" + +" charWidth (0) CharBoxHeight % height of numbers\n" + +" sub 2 div %\n" + +" moveto % move back to provide space\n" + +" show\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/Ibeam{ % heightInBits Ibeam\n" + +" gsave\n" + +" % Make an Ibeam of twice the given height in bits\n" + +" \/height exch pointsPerBit mul def \n" + +" \/heightDRAW height IbeamFraction mul def\n" + +"\n" + +" IbeamLineWidth setlinewidth\n" + +" IbeamGray setgray \n" + +"\n" + +" charWidth2 height neg translate\n" + +" ShowIbar\n" + +" newpath\n" + +" 0 0 moveto\n" + +" 0 heightDRAW rlineto\n" + +" stroke\n" + +" newpath\n" + +" 0 height moveto\n" + +" 0 height rmoveto\n" + +" currentpoint translate\n" + +" ShowIbar\n" + +" newpath\n" + +" 0 0 moveto\n" + +" 0 heightDRAW neg rlineto\n" + +" currentpoint translate\n" + +" stroke\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowIbar { % make a horizontal bar\n" + +" gsave\n" + +" newpath\n" + +" charWidth4 neg 0 moveto\n" + +" charWidth4 0 lineto\n" + +" stroke\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowLeftEnd {\n" + +" gsave\n" + +" SetStringFont\n" + +" leftEndDeltaX leftEndDeltaY moveto\n" + +" logoType (NA) eq {(5) show ShowPrime} if\n" + +" logoType (AA) eq {(N) show} if\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowRightEnd { \n" + +" gsave\n" + +" SetStringFont\n" + +" rightEndDeltaX rightEndDeltaY moveto\n" + +" logoType (NA) eq {(3) show ShowPrime} if\n" + +" logoType (AA) eq {(C) show} if\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowPrime {\n" + +" gsave\n" + +" SetPrimeFont\n" + +" (\\242) show \n" + +" grestore\n" + +"} bind def\n" + +"\n" + +" \n" + +"\/SetColor{ % <char> SetColor\n" + +" dup colorDict exch known {\n" + +" colorDict exch get aload pop setrgbcolor\n" + +" } {\n" + +" pop\n" + +" defaultColor aload pop setrgbcolor\n" + +" } ifelse \n" + +"} bind def\n" + +"\n" + +"% define fonts\n" + +"\/SetTitleFont {\/Times-Bold findfont titleFontsize scalefont setfont} bind def\n" + +"\/SetLogoFont {\/Helvetica-Bold findfont charWidth scalefont setfont} bind def\n" + +"\/SetStringFont{\/Helvetica-Bold findfont fontsize scalefont setfont} bind def\n" + +"\/SetPrimeFont {\/Symbol findfont fontsize scalefont setfont} bind def\n" + +"\/SetSmallFont {\/Helvetica findfont smallFontsize scalefont setfont} bind def\n" + +"\n" + +"\/SetNumberFont {\n" + +" \/Helvetica-Bold findfont \n" + +" numberFontsize\n" + +" scalefont\n" + +" setfont\n" + +"} bind def\n" + +"\n" + +"%Take a single character and return the bounding box\n" + +"\/CharBox { % <char> CharBox <lx> <ly> <ux> <uy>\n" + +" gsave\n" + +" newpath\n" + +" 0 0 moveto\n" + +" % take the character off the stack and use it here:\n" + +" true charpath \n" + +" flattenpath \n" + +" pathbbox % compute bounding box of 1 pt. char => lx ly ux uy\n" + +" % the path is here, but toss it away ...\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"% The height of a characters bounding box\n" + +"\/CharBoxHeight { % <char> CharBoxHeight <num>\n" + +" CharBox\n" + +" exch pop sub neg exch pop\n" + +"} bind def\n" + +"\n" + +"\n" + +"% The width of a characters bounding box\n" + +"\/CharBoxWidth { % <char> CharBoxHeight <num>\n" + +" CharBox\n" + +" pop exch pop sub neg \n" + +"} bind def\n" + +"\n" + +"% Set the colour scheme to be faded to indicate trimming\n" + +"\/MuteColour {\n" + +" \/colorDict mutedColourDict def\n" + +"} def\n" + +"\n" + +"% Restore the colour scheme to the normal colours\n" + +"\/RestoreColour {\n" + +" \/colorDict fullColourDict def\n" + +"} def\n" + +"\n" + +"% Draw the background for a trimmed section\n" + +"% takes the number of columns as a parameter\n" + +"\/DrawTrimBg { % <num> DrawTrimBox\n" + +" \/col exch def\n" + +" \n" + +" \/boxwidth \n" + +" col stackWidth mul \n" + +" def\n" + +" \n" + +" gsave\n" + +" 0.97 setgray\n" + +"\n" + +" newpath\n" + +" 0 0 moveto\n" + +" boxwidth 0 rlineto\n" + +" 0 yaxisHeight rlineto\n" + +" 0 yaxisHeight lineto\n" + +" closepath\n" + +" \n" + +" fill\n" + +" grestore\n" + +"} def\n" + +"\n" + +"\/DrawTrimEdge {\n" + +" gsave\n" + +" 0.2 setgray\n" + +" [2] 0 setdash\n" + +"\n" + +" newpath\n" + +" 0 0 moveto\n" + +" 0 yaxisHeight lineto\n" + +" \n" + +" stroke\n" + +"\n" + +"} def\n" + +"\n" + +"\n" + +"% Deprecated names\n" + +"\/startstack {StartStack} bind def\n" + +"\/endstack {EndStack} bind def\n" + +"\/makenumber {MakeNumber} bind def\n" + +"\/numchar { MakeSymbol } bind def\n" + +"\n" + +"%%EndProlog\n" + +"\n" + +"%%Page: 1 1\n" + +"StartLogo\n" + +"\n" + +_input("DATA") + "\n" + +"\n" + +"EndLogo\n" + +"\n" + +"%%EOF\n" + ); +}</script> + <script> +//====================================================================== +// start Alphabet object +//====================================================================== +var Alphabet = function(alphabet, background) { + "use strict"; + var i, j, sym, aliases, complement, comp_e_sym, ambigs, generate_background; + generate_background = (background == null); + if (generate_background) { + background = []; + for (i = 0; i < alphabet.ncore; i++) background[i] = 1.0 / alphabet.ncore; + } else if (alphabet.ncore != background.length) { + throw new Error("The background length does not match the alphabet length."); + } + this.name = alphabet.name; + this.like = (alphabet.like != null ? alphabet.like.toUpperCase() : null); + this.ncore = alphabet.ncore; + this.symbols = alphabet.symbols; + this.background = background; + this.genbg = generate_background; + this.encode = {}; + this.encode2core = {}; + this.complement = {}; + // check if all symbols are same case + var seen_uc = false; + var seen_lc = false; + var check_case = function (syms) { + var s, sym; + if (typeof syms === "string") { + for (s = 0; s < syms.length; s++) { + sym = syms.charAt(s); + if (sym >= 'a' && sym <= 'z') seen_lc = true; + else if (sym >= 'A' && sym <= 'Z') seen_uc = true; + } + } + }; + for (i = 0; i < this.symbols.length; i++) { + check_case(this.symbols[i].symbol); + check_case(this.symbols[i].aliases); + } + // now map symbols to indexes + var update_array = function(array, syms, index) { + var s, sym; + if (typeof syms === "string") { + for (s = 0; s < syms.length; s++) { + sym = syms.charAt(s); + array[sym] = index; + // when only a single case is used, then encode as case insensitive + if (seen_uc != seen_lc) { + if (sym >= 'a' && sym <= 'z') { + array[sym.toUpperCase()] = index; + } else if (sym >= 'A' && sym <= 'Z') { + array[sym.toLowerCase()] = index; + } + } + } + } + } + // map core symbols to index + for (i = 0; i < this.ncore; i++) { + update_array(this.encode2core, this.symbols[i].symbol, i); + update_array(this.encode, this.symbols[i].symbol, i); + update_array(this.encode2core, this.symbols[i].aliases, i); + update_array(this.encode, this.symbols[i].aliases, i); + } + // map ambigous symbols to index + ambigs = {}; + for (i = this.ncore; i < this.symbols.length; i++) { + update_array(this.encode, this.symbols[i].symbol, i); + update_array(this.encode, this.symbols[i].aliases, i); + ambigs[this.symbols[i].equals] = i; + } + // determine complements + for (i = 0; i < this.ncore; i++) { + complement = this.symbols[i].complement; + if (typeof complement === "string") { + this.complement[i] = this.encode2core[complement]; + } + } + next_symbol: + for (i = this.ncore; i < this.symbols.length; i++) { + complement = ""; + for (j = 0; j < this.symbols[i].equals.length; j++) { + comp_e_sym = this.complement[this.encode2core[this.symbols[i].equals.charAt(j)]]; + if (typeof comp_e_sym !== "number") continue next_symbol; + complement += this.symbols[comp_e_sym].symbol; + } + complement = complement.split("").sort().join(""); + if (typeof ambigs[complement] === "number") { + this.complement[i] = ambigs[complement]; + } + } + // determine case insensitivity + this.case_insensitive = true; + if (seen_uc == seen_lc) { + // when there is a mixture of cases it probably won't + // be case insensitive but we still need to check + loop: + for (i = 0; i < this.symbols.length; i++) { + sym = this.symbols[i].symbol; + if (sym >= 'A' && sym <= 'Z') { + if (this.encode[sym.toLowerCase()] != i) { + this.case_insensitive = false; + break loop; + } + } else if (sym >= 'a' && sym <= 'z') { + if (this.encode[sym.toUpperCase()] != i) { + this.case_insensitive = false; + break loop; + } + } + aliases = this.symbols[i].aliases; + if (aliases != null) { + for (j = 0; j < aliases.length; j++) { + sym = aliases.charAt(j); + if (sym >= 'A' && sym <= 'Z') { + if (this.encode[sym.toLowerCase()] != i) { + this.case_insensitive = false; + break loop; + } + } else if (sym >= 'a' && sym <= 'z') { + if (this.encode[sym.toUpperCase()] != i) { + this.case_insensitive = false; + break loop; + } + } + } + } + } + } + // normalise aliases to remove the prime symbol and eliminate + // the alternate cases when the alphabet is case insensitive + var seen, out; + for (i = 0; i < this.symbols.length; i++) { + sym = this.symbols[i].symbol; + aliases = this.symbols[i].aliases; + if (typeof aliases != "string") aliases = ""; + seen = {}; + out = []; + if (this.case_insensitive) { + sym = sym.toUpperCase(); + aliases = aliases.toUpperCase(); + } + seen[sym] = true; + for (j = 0; j < aliases.length; j++) { + if (!seen[aliases.charAt(j)]) { + seen[aliases.charAt(j)] = true; + out.push(aliases.charAt(j)); + } + } + this.symbols[i].aliases = out.sort().join(""); + } +}; +// return the name of the alphabet +Alphabet.prototype.get_alphabet_name = function() { + return this.name; +}; +// return if the alphabet can be complemented +Alphabet.prototype.has_complement = function() { + return (typeof this.symbols[0].complement === "string"); +}; +// return true if an uppercase letter has the same meaning as the lowercase form +Alphabet.prototype.is_case_insensitive = function() { + return this.case_insensitive; +}; +// return the information content of an alphabet letter +Alphabet.prototype.get_ic = function() { + return Math.log(this.ncore) / Math.LN2; +}; +// return the count of the core alphabet symbols +Alphabet.prototype.get_size_core = function() { + return this.ncore; +}; +// return the count of all alphabet symbols +Alphabet.prototype.get_size_full = function() { + return this.symbols.length; +}; +// return the symbol for the given alphabet index +Alphabet.prototype.get_symbol = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("Alphabet index out of bounds"); + } + return this.symbols[alph_index].symbol; +}; +// return the aliases for the given alphabet index +Alphabet.prototype.get_aliases = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("Alphabet index out of bounds"); + } + var sym_obj = this.symbols[alph_index]; + return (sym_obj.aliases != null ? sym_obj.aliases : ""); +}; +// return the name for the given alphabet index +Alphabet.prototype.get_name = function(alph_index) { + "use strict"; + var sym; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("Alphabet index out of bounds"); + } + sym = this.symbols[alph_index]; + return (typeof sym.name === "string" ? sym.name : sym.symbol); +}; +// return the alphabet it is like or null +Alphabet.prototype.get_like = function() { + "use strict"; + return this.like; +}; +// return the index of the complement for the given alphabet index +Alphabet.prototype.get_complement = function(alph_index) { + var comp_e_sym = this.complement[alph_index]; + if (typeof comp_e_sym === "number") { + return comp_e_sym; + } else { + return -1; + } +}; +// return a string containing the core symbols +Alphabet.prototype.get_symbols = function() { + "use strict"; + var i, core_symbols; + core_symbols = ""; + for (i = 0; i < this.ncore; i++) { + core_symbols += this.symbols[i].symbol; + } + return core_symbols; +}; +// return if the background was not a uniform generated background +Alphabet.prototype.has_bg = function() { + "use strict"; + return !this.genbg; +}; +// get the background frequency for the index +Alphabet.prototype.get_bg_freq = function(alph_index) { + "use strict"; + var freq, i, symbols; + if (alph_index >= 0) { + if (alph_index < this.ncore) { + return this.background[alph_index]; + } else if (alph_index < this.symbols.length) { + freq = 0; + symbols = this.symbols[alph_index].equals; + for (i = 0; i < symbols.length; i++) { + freq += this.background[this.encode2core[symbols.charAt(i)]]; + } + return freq; + } + } + throw new Error("The alphabet index is out of range."); +}; +// get the colour of the index +Alphabet.prototype.get_colour = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("BAD_ALPHABET_INDEX"); + } + if (typeof this.symbols[alph_index].colour != "string") { + return "black"; + } + return "#" + this.symbols[alph_index].colour; +}; +// get the rgb componets of the colour at the index +Alphabet.prototype.get_rgb = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("BAD_ALPHABET_INDEX"); + } + if (typeof this.symbols[alph_index].colour != "string") { + return {"red": 0, "green": 0, "blue": 0}; + } + var colour = this.symbols[alph_index].colour; + var red = parseInt(colour.substr(0, 2), 16) / 255; + var green = parseInt(colour.substr(2, 2), 16) / 255; + var blue = parseInt(colour.substr(4, 2), 16) / 255; + return {"red": red, "green": green, "blue": blue}; +}; +// convert a symbol into the index +Alphabet.prototype.get_index = function(letter) { + "use strict"; + var alph_index; + alph_index = this.encode[letter]; + if (typeof alph_index === "undefined") { + return -1; + } + return alph_index; +}; +// convert a symbol into the list of core indexes that it equals +Alphabet.prototype.get_indexes = function(letter) { + "use strict"; + var alph_index, comprise_str, i, comprise_list; + alph_index = this.encode[letter]; + if (typeof alph_index === "undefined") { + throw new Error("Unknown letter"); + } + comprise_str = this.symbols[alph_index].equals; + comprise_list = []; + if (typeof comprise_str == "string") { + for (i = 0; i < comprise_str.length; i++) { + comprise_list.push(this.encode2core[comprise_str.charAt(i)]); + } + } else { + comprise_list.push(alph_index); + } + return comprise_list; +}; +// check if a symbol is the primary way of representing the symbol in the alphabet +Alphabet.prototype.is_prime_symbol = function(letter) { + var alph_index; + alph_index = this.encode[letter]; + if (alph_index == null) return false; + if (this.is_case_insensitive()) { + return (this.symbols[alph_index].symbol.toUpperCase() == letter.toUpperCase()); + } else { + return (this.symbols[alph_index].symbol == letter); + } +}; +// compare 2 alphabets +Alphabet.prototype.equals = function(other) { + "use strict"; + var i, sym1, sym2; + // first check that it's actually an alphabet object + if (!(typeof other === "object" && other != null && other instanceof Alphabet)) { + return false; + } + // second shortcircuit if it's the same object + if (this === other) return true; + // compare + if (this.name !== other.name) return false; + if (this.ncore !== other.ncore) return false; + if (this.symbols.length !== other.symbols.length) return false; + for (i = 0; i < this.symbols.length; i++) { + sym1 = this.symbols[i]; + sym2 = other.symbols[i]; + if (sym1.symbol !== sym2.symbol) return false; + if (sym1.aliases !== sym2.aliases) return false; + if (sym1.name !== sym2.name) return false; + if (typeof sym1.colour !== typeof sym2.colour || + (typeof sym1.colour === "string" && typeof sym2.colour === "string" && + parseInt(sym1.colour, 16) != parseInt(sym2.colour, 16))) { + return false; + } + if (sym1.complement !== sym2.complement) return false; + if (sym1.equals !== sym2.equals) return false; + } + return true; +}; +Alphabet.prototype.check_core_subset = function(super_alph) { + var complement_same = true; + var seen_set = {}; + var sub_i, sub_symbol, super_i, super_symbol; + for (sub_i = 0; sub_i < this.ncore; sub_i++) { + sub_symbol = this.symbols[sub_i]; + super_i = super_alph.encode[sub_symbol.symbol]; + if (super_i == null) return 0; + super_symbol = super_alph.symbols[super_i]; + if (seen_set[super_i]) return 0; + seen_set[super_i] = true; + // check complement + if (sub_symbol.complement != null && super_symbol.complement != null) { + if (super_alph.encode[sub_symbol.complement] != super_alph.encode[super_symbol.complement]) { + complement_same = false; + } + } else if (sub_symbol.complement != null || super_symbol.complement != null) { + complement_same = false; + } + } + return (complement_same ? 1 : -1); +}; +// convert a sequence to its reverse complement +Alphabet.prototype.invcomp_seq = function(seq) { + "use strict"; + var syms, i, e_sym, comp_e_sym; + if (!this.has_complement()) throw new Error("Alphabet must be complementable"); + syms = seq.split(""); + for (i = 0; i < syms.length; i++) { + e_sym = this.encode[syms[i]]; + if (typeof e_sym === "undefined") { + e_sym = this.ncore; // wildcard + } + comp_e_sym = this.complement[e_sym]; + if (typeof comp_e_sym === "undefined") { + comp_e_sym = e_sym; // not complementable + } + syms[i] = this.symbols[comp_e_sym].symbol; + } + return syms.reverse().join(""); +}; +// convert the alphabet to the text version +Alphabet.prototype.as_text = function() { + "use strict"; + function name_as_text(name) { + var i, c, out; + out = "\""; + for (i = 0; i < name.length; i++) { + c = name.charAt(i); + if (c == "\"") { + out += "\\\""; + } else if (c == "/") { + out += "\\/"; + } else if (c == "\\") { + out += "\\\\"; + } else { + out += c; + } + } + out += "\""; + return out; + } + function symbol_as_text(sym) { + var out; + out = sym.symbol; + if (typeof sym.name === "string" && sym.name != sym.symbol) { + out += " " + name_as_text(sym.name); + } + if (typeof sym.colour === "string") { + out += " " + sym.colour; + } + return out; + } + var out, i, j, c, sym; + out = ""; + // output core symbols with 2 way complements + for (i = 0; i < this.ncore; i++) { + c = this.complement[i]; + if (typeof c === "number" && i < c && this.complement[c] === i) { + out += symbol_as_text(this.symbols[i]) + " ~ " + symbol_as_text(this.symbols[c]) + "\n"; + } + } + // output core symbols with no complement + for (i = 0; i < this.ncore; i++) { + if (typeof this.complement[i] === "undefined") { + out += symbol_as_text(this.symbols[i]) + "\n"; + } + } + // output ambiguous symbols that have comprising characters + for (i = this.ncore; i < this.symbols.length; i++) { + if (this.symbols[i].equals.length == 0) break; + out += symbol_as_text(this.symbols[i]) + " = " + this.symbols[i].equals + "\n"; + if (typeof this.symbols[i].aliases === "string") { + for (j = 0; j < this.symbols[i].aliases.length; j++) { + if (this.symbols[i].aliases.charAt(j) == this.symbols[i].symbol) continue; + out += this.symbols[i].aliases.charAt(j) + " = " + this.symbols[i].equals + "\n"; + } + } + } + // output aliases of core symbols + for (i = 0; i < this.ncore; i++) { + if (typeof this.symbols[i].aliases === "string") { + for (j = 0; j < this.symbols[i].aliases.length; j++) { + if (this.symbols[i].aliases.charAt(j) == this.symbols[i].symbol) continue; + out += this.symbols[i].aliases.charAt(j) + " = " + this.symbols[i].symbol + "\n"; + } + } + } + // output gap symbols + i = this.symbols.length - 1; + if (this.symbols[i].equals.length == 0) { + out += symbol_as_text(this.symbols[i]) + " =\n"; + if (typeof this.symbols[i].aliases === "string") { + for (j = 0; j < this.symbols[i].aliases.length; j++) { + if (this.symbols[i].aliases.charAt(j) == this.symbols[i].symbol) continue; + out += this.symbols[i].aliases.charAt(j) + " =\n"; + } + } + } + return out; +}; +// output the alphabet as it appears in minimal MEME format +Alphabet.prototype.as_meme = function() { + "use strict"; + function name_as_text(name) { + var i, c, out; + out = "\""; + for (i = 0; i < name.length; i++) { + c = name.charAt(i); + if (c == "\"") { + out += "\\\""; + } else if (c == "/") { + out += "\\/"; + } else if (c == "\\") { + out += "\\\\"; + } else { + out += c; + } + } + out += "\""; + return out; + } + if (this.equals(AlphStd.DNA)) { + return "ALPHABET= ACGT\n"; + } else if (this.equals(AlphStd.PROTEIN)) { + return "ALPHABET= ACDEFGHIKLMNPQRSTVWY\n"; + } else { + return "ALPHABET" + + (this.name != null ? " " + name_as_text(this.name) : "") + + (this.like != null ? " " + this.like + "-LIKE" : "") + "\n" + + this.as_text() + "END ALPHABET\n"; + } +}; + +// Returns a table showing all the letters in the alphabet +Alphabet.prototype.as_table = function() { + "use strict"; + var i, j, row, th, td, aliases, equals, sym; + var table = document.createElement("table"); + // create the core symbol header + row = table.insertRow(table.rows.length); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Symbol(s)")); + row.appendChild(th); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Name")); + row.appendChild(th); + th = document.createElement("th"); + if (this.has_complement()) { + th.appendChild(document.createTextNode("Complement")); + } + row.appendChild(th); + // list the core symbols + for (i = 0; i < this.ncore; i++) { + row = table.insertRow(table.rows.length); + td = document.createElement("td"); + if (this.symbols[i].colour != null) { + td.style.color = '#' + this.symbols[i].colour; + } + td.appendChild(document.createTextNode(this.symbols[i].symbol)); + aliases = this.get_aliases(i); + if (aliases.length > 0) { + td.appendChild(document.createTextNode(' ' + aliases.split('').join(' '))); + } + row.appendChild(td); + td = document.createElement("td"); + if (this.symbols[i].name != null) { + td.appendChild(document.createTextNode(this.symbols[i].name)); + } + row.appendChild(td); + td = document.createElement("td"); + if (this.symbols[i].complement != null) { + td.style.color = this.get_colour(this.get_index(this.symbols[i].complement)); + td.appendChild(document.createTextNode(this.symbols[i].complement)); + } + row.appendChild(td); + } + // create the ambiguous symbol header + row = table.insertRow(table.rows.length); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Symbol(s)")); + row.appendChild(th); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Name")); + row.appendChild(th); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Matches")); + row.appendChild(th); + // list the ambiguous symbols + for (i = this.ncore; i < this.symbols.length; i++) { + row = table.insertRow(table.rows.length); + td = document.createElement("td"); + if (this.symbols[i].colour != null) { + td.style.color = '#' + this.symbols[i].colour; + } + td.appendChild(document.createTextNode(this.symbols[i].symbol)); + aliases = this.get_aliases(i); + if (aliases.length > 0) { + td.appendChild(document.createTextNode(' ' + aliases.split('').join(' '))); + } + row.appendChild(td); + td = document.createElement("td"); + if (this.symbols[i].name != null) { + td.appendChild(document.createTextNode(this.symbols[i].name)); + } + row.appendChild(td); + td = document.createElement("td"); + equals = this.symbols[i].equals.split(''); + for (j = 0; j < equals.length; j++) { + if (j != 0) td.appendChild(document.createTextNode(' ')); + sym = document.createElement("span"); + sym.style.color = this.get_colour(this.get_index(equals[j])); + sym.appendChild(document.createTextNode(equals[j])); + td.appendChild(sym); + } + row.appendChild(td); + } + return table; +}; + +// returns a dictionary of the colours for EPS +Alphabet.prototype._as_eps_dict = function() { + "use strict"; + var i, sym, rgb; + var out = "/fullColourDict <<\n"; + for (i = 0; i < this.ncore; i++) { + sym = this.get_symbol(i); + sym = sym.replace(/\\/g, "\\\\"); + sym = sym.replace(/\(/g, "\\("); + sym = sym.replace(/\)/g, "\\)"); + rgb = this.get_rgb(i); + out += " (" + sym + ") [" + rgb.red.toFixed(4) + " " + rgb.green.toFixed(4) + " " + rgb.blue.toFixed(4) + "]\n"; + } + out += ">> def\n"; + out += "/mutedColourDict <<\n"; + for (i = 0; i < this.ncore; i++) { + sym = this.get_symbol(i); + sym = sym.replace(/\\/g, "\\\\"); + sym = sym.replace(/\(/g, "\\("); + sym = sym.replace(/\)/g, "\\)"); + rgb = Alphabet.lighten_colour(this.get_rgb(i)); + out += " (" + sym + ") [" + rgb.red.toFixed(4) + " " + rgb.green.toFixed(4) + " " + rgb.blue.toFixed(4) + "]\n"; + } + out += ">> def\n"; + return out; +}; + +// return the alphabet name or a list of primary symbols +Alphabet.prototype.toString = function() { + "use strict"; + if (this.name != null) { + return this.name; + } else { + return this.get_symbols(); + } +}; + +//~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +// Helper functions +//~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +// Convert a colour specified in RGB colourspace values into LAB colourspace +Alphabet.rgb2lab = function(rgb) { + "use strict"; + var xyzHelper, labHelper; + // XYZ helper + xyzHelper = function(value) { + if (value > 0.0445) { + value = (value + 0.055) / 1.055; + value = Math.pow(value, 2.4); + } else { + value /= 12.92; + } + value *= 100; + return value; + }; + // lab helper + labHelper = function(value) { + if (value > 0.008856) { + value = Math.pow(value, 1.0 / 3.0); + } else { + value = (7.787 * value) + (16.0 / 116.0); + } + return value; + }; + // convert into XYZ colourspace + var c1, c2, c3; + if (typeof rgb == "number") { + c1 = xyzHelper(((rgb >> 16) & 0xFF) / 255.0); + c2 = xyzHelper(((rgb >> 8) & 0xFF) / 255.0); + c3 = xyzHelper((rgb & 0xFF) / 255.0); + } else { + c1 = xyzHelper(rgb.red); + c2 = xyzHelper(rgb.green); + c3 = xyzHelper(rgb.blue); + } + var x = (c1 * 0.4124) + (c2 * 0.3576) + (c3 * 0.1805); + var y = (c1 * 0.2126) + (c2 * 0.7152) + (c3 * 0.0722); + var z = (c1 * 0.0193) + (c2 * 0.1192) + (c3 * 0.9505); + // convert into Lab colourspace + c1 = labHelper(x / 95.047); + c2 = labHelper(y / 100.0); + c3 = labHelper(z / 108.883); + var l = (116.0 * c2) - 16; + var a = 500.0 * (c1 - c2); + var b = 200.0 * (c2 - c3); + return {"l": l, "a": a, "b": b}; +}; + +// Convert a colour specified in HSV colourspace into RGB colourspace +Alphabet.hsv2rgb = function(hue, sat, value, output_object) { + // achromatic (grey) + var r = value; + var g = value; + var b = value; + if (sat != 0) { + var h = hue / 60.0; + var i = Math.floor(h); + var f = h - i; + var p = value * (1.0 - sat); + var q = value * (1.0 - (sat * f)); + var t = value * (1.0 - (sat * (1.0 - f))); + if (i == 0) { + r = value; + g = t; + b = p; + } else if (i == 1) { + r = q; + g = value; + b = p; + } else if (i == 2) { + r = p; + g = value; + b = t; + } else if (i == 3) { + r = p; + g = q; + b = value; + } else if (i == 4) { + r = t; + g = p; + b = value; + } else { + r = value; + g = p; + b = q; + } + } + if (output_object) { + return {"red": r, "green": g, "blue": b}; + } else { + return (Math.floor(r * 255) << 15) | (Math.floor(g * 255) << 8) | (Math.floor(b * 255)); + } +}; + +// Calculate a distance score between two colours in LAB colourspace +Alphabet.lab_dist = function(lab1, lab2) { + var c1 = Math.sqrt((lab1.l * lab1.l) + (lab1.a * lab1.a)); + var c2 = Math.sqrt((lab2.l * lab2.l) + (lab2.a * lab2.a)); + var dc = c1 - c2; + var dl = lab1.l - lab2.l; + var da = lab1.a - lab2.a; + var db = lab1.b - lab2.b; + // we don't want NaN due to rounding errors so fudge things a bit... + var dh = 0; + var dh_squared = (da * da) + (db * db) - (dc * dc); + if (dh_squared > 0) { + dh = Math.sqrt(dh_squared); + } + var first = dl; + var second = dc / (1.0 + (0.045 * c1)); + var third = dh / (1.0 + (0.015 * c1)); + return Math.sqrt((first * first) + (second * second) + (third * third)); +}; + +// convert an RGB value into a HSL value +Alphabet.rgb2hsl = function(rgb) { + "use strict"; + var min, max, delta, h, s, l, r, g, b; + if (typeof rgb == "number") { + r = ((rgb >> 16) & 0xFF) / 255.0; + g = ((rgb >> 8) & 0xFF) / 255.0; + b = (rgb & 0xFF) / 255.0; + } else { + r = rgb.red; + g = rgb.green; + b = rgb.blue; + } + min = Math.min(r, g, b); + max = Math.max(r, g, b); + delta = max - min; + l = min + (delta / 2); + if (max == min) { + h = 0; // achromatic (grayscale) + s = 0; + } else { + if (l > 0.5) { + s = delta / (2 - max - min); + } else { + s = delta / (max + min); + } + if (max == r) { + h = (g - b) / delta; + if (g < b) h += 6; + } else if (max == g) { + h = ((b - r) / delta) + 2; + } else { + h = ((r - g) / delta) + 4; + } + h /= 6; + } + return {"h": h, "s": s, "l": l}; +}; + +// convert a HSL value into an RGB value +Alphabet.hsl2rgb = function(hsl, output_object) { + "use strict"; + function _hue(p, q, t) { + "use strict"; + if (t < 0) t += 1; + else if (t > 1) t -= 1; + if (t < (1.0 / 6.0)) { + return p + ((q - p) * 6.0 * t); + } else if (t < 0.5) { + return q; + } else if (t < (2.0 / 3.0)) { + return p + ((q - p) * ((2.0 / 3.0) - t) * 6.0); + } else { + return p; + } + } + var r, g, b, p, q; + if (hsl.s == 0) { + // achromatic (grayscale) + r = hsl.l; + g = hsl.l; + b = hsl.l; + } else { + if (hsl.l < 0.5) { + q = hsl.l * (1 + hsl.s); + } else { + q = hsl.l + hsl.s - (hsl.l * hsl.s); + } + p = (2 * hsl.l) - q; + r = _hue(p, q, hsl.h + (1.0 / 3.0)); + g = _hue(p, q, hsl.h); + b = _hue(p, q, hsl.h - (1.0 / 3.0)); + } + if (output_object) { + return {"red": r, "green": g, "blue": b}; + } else { + return (Math.floor(r * 255) << 15) | (Math.floor(g * 255) << 8) | (Math.floor(b * 255)); + } +}; + +Alphabet.lighten_colour = function(rgb) { + "use strict"; + var hsl = Alphabet.rgb2hsl(rgb); + hsl.l += (1.0 - hsl.l) * 2 / 3; + return Alphabet.hsl2rgb(hsl, typeof rgb != "number"); +}; + +//====================================================================== +// end Alphabet object +//====================================================================== + +//====================================================================== +// start StandardAlphabet object +//====================================================================== + +// an extension of the alphabet object to support some additional fields +// only present in standard alphabets. +var StandardAlphabet = function(enum_code, enum_name, alphabet_data) { + Alphabet.apply(this, [alphabet_data]); + this.enum_code = enum_code; + this.enum_name = enum_name; +}; +StandardAlphabet.prototype = Alphabet.prototype; +StandardAlphabet.prototype.constructor = StandardAlphabet; + +// A unique code for this standard alphabet. +// This code will be a power of 2 to enable creation of bitsets for +// a selection of standard alphabets. +StandardAlphabet.prototype.get_code = function() { + return this.enum_code; +}; + +// A unique name for this standard alphabet. +// this name will be all upper case and the same as the property that +// refers to this alphabet in the AlphStd collection. +StandardAlphabet.prototype.get_enum = function() { + return this.enum_name; +}; + +//====================================================================== +// end StandardAlphabet object +//====================================================================== + +// A collection of standard alphabets. +var AlphStd = { + RNA: new StandardAlphabet(1, "RNA", { + "name": "RNA", + "like": "RNA", + "ncore": 4, + "symbols": [ + {"symbol": "A", "name": "Adenine", "colour": "CC0000"}, + {"symbol": "C", "name": "Cytosine", "colour": "0000CC"}, + {"symbol": "G", "name": "Guanine", "colour": "FFB300"}, + {"symbol": "U", "name": "Uracil", "colour": "008000", + "aliases": "T"}, + {"symbol": "N", "name": "Any base", "equals": "ACGU", "aliases": "X."}, + {"symbol": "V", "name": "Not U", "equals": "ACG"}, + {"symbol": "H", "name": "Not G", "equals": "ACU"}, + {"symbol": "D", "name": "Not C", "equals": "AGU"}, + {"symbol": "B", "name": "Not A", "equals": "CGU"}, + {"symbol": "M", "name": "Amino", "equals": "AC"}, + {"symbol": "R", "name": "Purine", "equals": "AG"}, + {"symbol": "W", "name": "Weak", "equals": "AU"}, + {"symbol": "S", "name": "Strong", "equals": "CG"}, + {"symbol": "Y", "name": "Pyrimidine", "equals": "CU"}, + {"symbol": "K", "name": "Keto", "equals": "GU"} + ] + }), + DNA: new StandardAlphabet(2, "DNA", { + "name": "DNA", + "like": "DNA", + "ncore": 4, + "symbols": [ + {"symbol": "A", "name": "Adenine", "colour": "CC0000", "complement": "T"}, + {"symbol": "C", "name": "Cytosine", "colour": "0000CC", "complement": "G"}, + {"symbol": "G", "name": "Guanine", "colour": "FFB300", "complement": "C"}, + {"symbol": "T", "name": "Thymine", "colour": "008000", "complement": "A", + "aliases": "U"}, + {"symbol": "N", "name": "Any base", "equals": "ACGT", "aliases": "X."}, + {"symbol": "V", "name": "Not T", "equals": "ACG"}, + {"symbol": "H", "name": "Not G", "equals": "ACT"}, + {"symbol": "D", "name": "Not C", "equals": "AGT"}, + {"symbol": "B", "name": "Not A", "equals": "CGT"}, + {"symbol": "M", "name": "Amino", "equals": "AC"}, + {"symbol": "R", "name": "Purine", "equals": "AG"}, + {"symbol": "W", "name": "Weak", "equals": "AT"}, + {"symbol": "S", "name": "Strong", "equals": "CG"}, + {"symbol": "Y", "name": "Pyrimidine", "equals": "CT"}, + {"symbol": "K", "name": "Keto", "equals": "GT"} + ] + }), + PROTEIN: new StandardAlphabet(4, "PROTEIN", { + "name": "Protein", + "like": "PROTEIN", + "ncore": 20, + "symbols": [ + {"symbol": "A", "name": "Alanine", "colour": "0000CC"}, + {"symbol": "C", "name": "Cysteine", "colour": "0000CC"}, + {"symbol": "D", "name": "Aspartic acid", "colour": "FF00FF"}, + {"symbol": "E", "name": "Glutamic acid", "colour": "FF00FF"}, + {"symbol": "F", "name": "Phenylalanine", "colour": "0000CC"}, + {"symbol": "G", "name": "Glycine", "colour": "FFB300"}, + {"symbol": "H", "name": "Histidine", "colour": "FFCCCC"}, + {"symbol": "I", "name": "Isoleucine", "colour": "0000CC"}, + {"symbol": "K", "name": "Lysine", "colour": "CC0000"}, + {"symbol": "L", "name": "Leucine", "colour": "0000CC"}, + {"symbol": "M", "name": "Methionine", "colour": "0000CC"}, + {"symbol": "N", "name": "Asparagine", "colour": "008000"}, + {"symbol": "P", "name": "Proline", "colour": "FFFF00"}, + {"symbol": "Q", "name": "Glutamine", "colour": "008000"}, + {"symbol": "R", "name": "Arginine", "colour": "CC0000"}, + {"symbol": "S", "name": "Serine", "colour": "008000"}, + {"symbol": "T", "name": "Threonine", "colour": "008000"}, + {"symbol": "V", "name": "Valine", "colour": "0000CC"}, + {"symbol": "W", "name": "Tryptophan", "colour": "0000CC"}, + {"symbol": "Y", "name": "Tyrosine", "colour": "33E6CC"}, + {"symbol": "X", "name": "Any amino acid", "equals": "ACDEFGHIKLMNPQRSTVWY", "aliases": "*."}, + {"symbol": "B", "name": "Asparagine or Aspartic acid", "equals": "DN"}, + {"symbol": "Z", "name": "Glutamine or Glutamic acid", "equals": "EQ"}, + {"symbol": "J", "name": "Leucine or Isoleucine", "equals": "IL"} + ] + }) +}; + +//====================================================================== +// start Symbol object +//====================================================================== +var Symbol = function(alph_index, scale, alphabet) { + "use strict"; + //variable prototype + this.symbol = alphabet.get_symbol(alph_index); + this.scale = scale; + this.colour = alphabet.get_colour(alph_index); +}; + +Symbol.prototype.get_symbol = function() { + "use strict"; + return this.symbol; +}; + +Symbol.prototype.get_scale = function() { + "use strict"; + return this.scale; +}; + +Symbol.prototype.get_colour = function() { + "use strict"; + return this.colour; +}; + +Symbol.prototype.toString = function() { + "use strict"; + return this.symbol + " " + (Math.round(this.scale*1000)/10) + "%"; +}; + +function compare_symbol(sym1, sym2) { + "use strict"; + if (sym1.get_scale() < sym2.get_scale()) { + return -1; + } else if (sym1.get_scale() > sym2.get_scale()) { + return 1; + } else { + return 0; + } +} +//====================================================================== +// end Symbol object +//====================================================================== + +//====================================================================== +// start Pspm object +//====================================================================== +var Pspm = function(matrix, name, ltrim, rtrim, nsites, evalue, pssm, alt) { + "use strict"; + var row, col, data, row_sum, delta, evalue_re; + if (typeof name !== "string") { + name = ""; + } + this.name = name; + //construct + if (matrix instanceof Pspm) { + // copy constructor + this.alph_length = matrix.alph_length; + this.motif_length = matrix.motif_length; + this.name = matrix.name; + this.alt = matrix.alt; + this.nsites = matrix.nsites; + this.evalue = matrix.evalue; + this.ltrim = matrix.ltrim; + this.rtrim = matrix.rtrim; + this.pspm = []; + for (row = 0; row < matrix.motif_length; row++) { + this.pspm[row] = []; + for (col = 0; col < matrix.alph_length; col++) { + this.pspm[row][col] = matrix.pspm[row][col]; + } + } + if (matrix.pssm != null) { + this.pssm = []; + for (row = 0; row < matrix.motif_length; row++) { + this.pspm[row] = []; + for (col = 0; col < matrix.alph_length; col++) { + this.pssm[row][col] = matrix.pssm[row][col]; + } + } + } + } else { + // check parameters + if (ltrim == null) { + ltrim = 0; + } else if (typeof ltrim !== "number" || ltrim % 1 !== 0 || ltrim < 0) { + throw new Error("ltrim must be a non-negative integer, got: " + ltrim); + } + if (rtrim == null) { + rtrim = 0; + } else if (typeof rtrim !== "number" || rtrim % 1 !== 0 || rtrim < 0) { + throw new Error("rtrim must be a non-negative integer, got: " + rtrim); + } + if (nsites != null) { + if (typeof nsites !== "number" || nsites < 0) { + throw new Error("nsites must be a positive number, got: " + nsites); + } else if (nsites == 0) { + nsites = null; + } + } + if (evalue != null) { + if (typeof evalue === "number") { + if (evalue < 0) { + throw new Error("evalue must be a non-negative number, got: " + evalue); + } + } else if (typeof evalue === "string") { + evalue_re = /^((?:[+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)|inf)$/; + if (!evalue_re.test(evalue)) { + throw new Error("evalue must be a non-negative number, got: " + evalue); + } + } else { + throw new Error("evalue must be a non-negative number, got: " + evalue); + } + } + // set properties + this.name = name; + this.alt = alt; + this.nsites = nsites; + this.evalue = evalue; + this.ltrim = ltrim; + this.rtrim = rtrim; + if (typeof matrix === "string") { + // string constructor + data = parse_pspm_string(matrix); + this.alph_length = data["alph_length"]; + this.motif_length = data["motif_length"]; + this.pspm = data["pspm"]; + if (this.evalue == null) { + if (data["evalue"] != null) { + this.evalue = data["evalue"]; + } else { + this.evalue = 0; + } + } + if (this.nsites == null) { + if (typeof data["nsites"] === "number") { + this.nsites = data["nsites"]; + } else { + this.nsites = 20; + } + } + } else { + // assume pspm is a nested array + this.motif_length = matrix.length; + this.alph_length = (matrix.length > 0 ? matrix[0].length : 0); + if (this.nsites == null) { + this.nsites = 20; + } + if (this.evalue == null) { + this.evalue = 0; + } + this.pspm = []; + // copy pspm and check + for (row = 0; row < this.motif_length; row++) { + if (this.alph_length != matrix[row].length) { + throw new Error("COLUMN_MISMATCH"); + } + this.pspm[row] = []; + row_sum = 0; + for (col = 0; col < this.alph_length; col++) { + this.pspm[row][col] = matrix[row][col]; + row_sum += this.pspm[row][col]; + } + delta = 0.1; + if (isNaN(row_sum) || (row_sum > 1 && (row_sum - 1) > delta) || + (row_sum < 1 && (1 - row_sum) > delta)) { + throw new Error("INVALID_SUM"); + } + } + // copy pssm + if (pssm != null) { + this.pssm = []; + for (row = 0; row < this.motif_length; row++) { + this.pssm[row] = []; + for (col = 0; col < this.alph_length; col++) { + this.pssm[row][col] = pssm[row][col]; + } + } + } + } + } +}; + +Pspm.prototype.copy = function() { + "use strict"; + return new Pspm(this); +}; + +Pspm.prototype.reverse = function() { + "use strict"; + var x, y, temp, temp_trim; + //reverse + x = 0; + y = this.motif_length-1; + while (x < y) { + temp = this.pspm[x]; + this.pspm[x] = this.pspm[y]; + this.pspm[y] = temp; + x++; + y--; + } + // reverse pssm (if defined) + if (typeof this.pssm !== "undefined") { + //reverse + x = 0; + y = this.motif_length-1; + while (x < y) { + temp = this.pssm[x]; + this.pspm[x] = this.pssm[y]; + this.pssm[y] = temp; + x++; + y--; + } + } + //swap triming + temp_trim = this.ltrim; + this.ltrim = this.rtrim; + this.rtrim = temp_trim; + return this; //allow function chaining... +}; + +Pspm.prototype.reverse_complement = function(alphabet) { + "use strict"; + var x, y, temp, i, row, c, temp_trim; + if (this.alph_length != alphabet.get_size_core()) { + throw new Error("The alphabet size does not match the size of the pspm."); + } + if (!alphabet.has_complement()) { + throw new Error("The specified alphabet can not be complemented."); + } + // reverse motif + this.reverse(); + //complement + for (x = 0; x < this.motif_length; x++) { + row = this.pspm[x]; + for (i = 0; i < row.length; i++) { + c = alphabet.get_complement(i); + if (c < i) continue; + temp = row[i]; + row[i] = row[c]; + row[c] = temp; + } + } + // complement pssm (if defined) + if (typeof this.pssm !== "undefined") { + //complement + for (x = 0; x < this.motif_length; x++) { + row = this.pssm[x]; + for (i = 0; i < row.length; i++) { + c = alphabet.get_complement(i); + if (c < i) continue; + temp = row[i]; + row[i] = row[c]; + row[c] = temp; + } + } + } + return this; //allow function chaining... +}; + +Pspm.prototype.get_stack = function(position, alphabet, ssc) { + "use strict"; + var row, stack_ic, alphabet_ic, stack, i, sym; + if (this.alph_length != alphabet.get_size_core()) { + throw new Error("The alphabet size does not match the size of the pspm."); + } + row = this.pspm[position]; + stack_ic = this.get_stack_ic(position, alphabet); + if (ssc) stack_ic -= this.get_error(alphabet); + alphabet_ic = alphabet.get_ic(); + stack = []; + for (i = 0; i < this.alph_length; i++) { + sym = new Symbol(i, row[i]*stack_ic/alphabet_ic, alphabet); + if (sym.get_scale() <= 0) { + continue; + } + stack.push(sym); + } + stack.sort(compare_symbol); + return stack; +}; + +Pspm.prototype.get_stack_ic = function(position, alphabet) { + "use strict"; + var row, H, i; + if (this.alph_length != alphabet.get_size_core()) { + throw new Error("The alphabet size does not match the size fo the pspm."); + } + row = this.pspm[position]; + H = 0; + for (i = 0; i < this.alph_length; i++) { + if (row[i] === 0) { + continue; + } + H -= (row[i] * (Math.log(row[i]) / Math.LN2)); + } + return alphabet.get_ic() - H; +}; + +Pspm.prototype.get_error = function(alphabet) { + "use strict"; + if (this.nsites === 0) { + return 0; + } + return (alphabet.get_size_core()-1) / (2 * Math.LN2 * this.nsites); +}; + +Pspm.prototype.get_motif_length = function() { + "use strict"; + return this.motif_length; +}; + +Pspm.prototype.get_alph_length = function() { + "use strict"; + return this.alph_length; +}; + +Pspm.prototype.get_left_trim = function() { + "use strict"; + return this.ltrim; +}; + +Pspm.prototype.get_right_trim = function() { + "use strict"; + return this.rtrim; +}; + +Pspm.prototype.as_best_match = function(alphabet) { + "use strict"; + var match, odds, best_odds, best_index; + var i, j; + match = ""; + for (i = 0; i < this.motif_length; i++) { + best_index = 0; + best_odds = this.pspm[i][0] / alphabet.get_bg_freq(0); + for (j = 1; j < this.alph_length; j++) { + odds = this.pspm[i][j] / alphabet.get_bg_freq(j); + if (odds > best_odds) { + best_odds = odds; + best_index = j; + } + } + match += alphabet.get_symbol(best_index); + } + return match; +}; + +Pspm.prototype.as_count_matrix = function() { + "use strict"; + var count, count_text, text; + var i, j; + text = ""; + for (i = 0; i < this.motif_length; i++) { + if (i !== 0) { + text += "\n"; + } + for (j = 0; j < this.alph_length; j++) { + if (j !== 0) { + text += " "; + } + count = Math.round(this.nsites * this.pspm[i][j]); + count_text = "" + count; + // pad up to length of 4 + if (count_text.length < 4) { + text += (new Array(5 - count_text.length)).join(" ") + count_text; + } else { + text += count_text; + } + } + } + return text; +}; + +Pspm.prototype.as_probability_matrix = function() { + "use strict"; + var text; + var i, j; + text = ""; + for (i = 0; i < this.motif_length; i++) { + if (i !== 0) { + text += "\n"; + } + for (j = 0; j < this.alph_length; j++) { + if (j !== 0) { + text += " "; + } + text += this.pspm[i][j].toFixed(6); + } + } + return text; +}; + +Pspm.prototype.as_score_matrix = function(alphabet, pseudo) { + "use strict"; + var me, score, out, row, col, score_text; + me = this; + if (typeof this.pssm === "undefined") { + if (!(typeof alphabet === "object" && alphabet != null && alphabet instanceof Alphabet)) { + throw new Error("The alphabet is required to generate the pssm."); + } + if (typeof pseudo === "undefined") { + pseudo = 0.01; + } else if (typeof pseudo !== "number" || pseudo < 0) { + throw new Error("Expected positive number for pseudocount"); + } + score = function(row, col) { + "use strict"; + var p, bg, p2; + p = me.pspm[row][col]; + bg = alphabet.get_bg_freq(col); + p2 = (p * me.nsites + bg * pseudo) / (me.nsites + pseudo); + return (p2 > 0 ? Math.round((Math.log(p2 / bg) / Math.LN2) * 100) : -10000); + }; + } else { + score = function(row, col) { + "use strict"; + return me.pssm[row][col]; + }; + } + out = ""; + for (row = 0; row < this.motif_length; row++) { + for (col = 0; col < this.alph_length; col++) { + if (col !== 0) { + out += " "; + } + score_text = "" + score(row, col); + // pad out to 6 characters + if (score_text.length < 6) { + out += (new Array(7 - score_text.length)).join(" ") + score_text; + } else { + out += score_text; + } + } + out += "\n"; + } + return out; +} + +Pspm.prototype.as_pspm = function() { + "use strict"; + return "letter-probability matrix: alength= " + this.alph_length + + " w= " + this.motif_length + " nsites= " + this.nsites + + " E= " + (typeof this.evalue === "number" ? + this.evalue.toExponential() : this.evalue) + "\n" + + this.as_probability_matrix(); +}; + +Pspm.prototype.as_pssm = function(alphabet, pseudo) { + "use strict"; + return "log-odds matrix: alength= " + this.alph_length + + " w= " + this.motif_length + + " E= " + (typeof this.evalue == "number" ? + this.evalue.toExponential() : this.evalue) + "\n" + + this.as_score_matrix(alphabet, pseudo); +}; + +Pspm.prototype.as_meme = function(options) { + var with_header, with_pspm, with_pssm, version, alphabet, bg_source, pseudocount, strands; + var out, alen, i; + // get the options + if (typeof options !== "object" || options === null) { + options = {}; + } + with_header = (typeof options["with_header"] === "boolean" ? options["with_header"] : false); + with_pspm = (typeof options["with_pspm"] === "boolean" ? options["with_pspm"] : false); + with_pssm = (typeof options["with_pssm"] === "boolean" ? options["with_pssm"] : false); + if (!with_pspm && !with_pssm) with_pspm = true; + if (with_header) { + if (typeof options["version"] === "string" && /^\d+(?:\.\d+){0,2}$/.test(options["version"])) { + version = options["version"]; + } else if (typeof options["version"] === "number") { + version = options["version"].toFixed(0); + } else { + version = "4"; + } + if (typeof options["strands"] === "number" && options["strands"] === 1) { + strands = 1; + } else { + strands = 2; + } + if (typeof options["bg_source"] === "string") { + bg_source = options["bg_source"]; + } else { + bg_source = "unknown source"; + } + if (typeof options["alphabet"] === "object" && options["alphabet"] != null + && options["alphabet"] instanceof Alphabet) { + alphabet = options["alphabet"]; + } else { + throw new Error("The alphabet is required to generate the header."); + } + } + // now create the output + out = ""; + if (with_header) { + out = "MEME version " + version + "\n\n"; + out += alphabet.as_meme() + "\n"; + if (alphabet.has_complement()) { // assume DNA has both strands unless otherwise specified + out += "strands: " + (strands === 1 ? "+" : "+ -") + "\n\n"; + } + out += "Background letter frequencies (from " + bg_source + "):\n"; + alen = alphabet.get_size_core(); + for (i = 0; i < alen; i++) { + if (i !== 0) { + if (i % 9 === 0) { // maximum of nine entries per line + out += "\n"; + } else { + out += " "; + } + } + out += alphabet.get_symbol(i) + " " + alphabet.get_bg_freq(i).toFixed(3); + } + } + out += "\n\n"; + out += "MOTIF " + this.name + (this.alt == null ? "" : " " + this.alt); + if (with_pssm) { + out += "\n\n"; + out += this.as_pssm(options["alphabet"], options["pseudocount"]); + } + if (with_pspm) { + out += "\n\n"; + out += this.as_pspm(); + } + return out; +} + +Pspm.prototype.toString = function() { + "use strict"; + var str, i, row; + str = ""; + for (i = 0; i < this.pspm.length; i++) { + row = this.pspm[i]; + str += row.join("\t") + "\n"; + } + return str; +}; + +function parse_pspm_properties(str) { + "use strict"; + var parts, i, eqpos, before, after, properties, prop, num, num_re; + num_re = /^((?:[+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)|inf)$/; + parts = trim(str).split(/\s+/); + // split up words containing = + for (i = 0; i < parts.length;) { + eqpos = parts[i].indexOf("="); + if (eqpos != -1) { + before = parts[i].substr(0, eqpos); + after = parts[i].substr(eqpos+1); + if (before.length > 0 && after.length > 0) { + parts.splice(i, 1, before, "=", after); + i += 3; + } else if (before.length > 0) { + parts.splice(i, 1, before, "="); + i += 2; + } else if (after.length > 0) { + parts.splice(i, 1, "=", after); + i += 2; + } else { + parts.splice(i, 1, "="); + i++; + } + } else { + i++; + } + } + properties = {}; + for (i = 0; i < parts.length; i += 3) { + if (parts.length - i < 3) { + throw new Error("Expected PSPM property was incomplete. "+ + "Remaing parts are: " + parts.slice(i).join(" ")); + } + if (parts[i+1] !== "=") { + throw new Error("Expected '=' in PSPM property between key and " + + "value but got " + parts[i+1]); + } + prop = parts[i].toLowerCase(); + num = parts[i+2]; + if (!num_re.test(num)) { + throw new Error("Expected numeric value for PSPM property '" + + prop + "' but got '" + num + "'"); + } + properties[prop] = num; + } + return properties; +} + +function parse_pspm_string(pspm_string) { + "use strict"; + var header_re, lines, first_line, line_num, col_num, alph_length, + motif_length, nsites, evalue, pspm, i, line, match, props, parts, + j, prob; + header_re = /^letter-probability\s+matrix:(.*)$/i; + lines = pspm_string.split(/\n/); + first_line = true; + line_num = 0; + col_num = 0; + alph_length; + motif_length; + nsites; + evalue; + pspm = []; + for (i = 0; i < lines.length; i++) { + line = trim(lines[i]); + if (line.length === 0) { + continue; + } + // check the first line for a header though allow matrices without it + if (first_line) { + first_line = false; + match = header_re.exec(line); + if (match !== null) { + props = parse_pspm_properties(match[1]); + if (props.hasOwnProperty("alength")) { + alph_length = parseFloat(props["alength"]); + if (alph_length != 4 && alph_length != 20) { + throw new Error("PSPM property alength should be 4 or 20" + + " but got " + alph_length); + } + } + if (props.hasOwnProperty("w")) { + motif_length = parseFloat(props["w"]); + if (motif_length % 1 !== 0 || motif_length < 1) { + throw new Error("PSPM property w should be an integer larger " + + "than zero but got " + motif_length); + } + } + if (props.hasOwnProperty("nsites")) { + nsites = parseFloat(props["nsites"]); + if (nsites <= 0) { + throw new Error("PSPM property nsites should be larger than " + + "zero but got " + nsites); + } + } + if (props.hasOwnProperty("e")) { + evalue = props["e"]; + if (evalue < 0) { + throw new Error("PSPM property evalue should be " + + "non-negative but got " + evalue); + } + } + continue; + } + } + pspm[line_num] = []; + col_num = 0; + parts = line.split(/\s+/); + for (j = 0; j < parts.length; j++) { + prob = parseFloat(parts[j]); + if (prob != parts[j] || prob < 0 || prob > 1) { + throw new Error("Expected probability but got '" + parts[j] + "'"); + } + pspm[line_num][col_num] = prob; + col_num++; + } + line_num++; + } + if (typeof motif_length === "number") { + if (pspm.length != motif_length) { + throw new Error("Expected PSPM to have a motif length of " + + motif_length + " but it was actually " + pspm.length); + } + } else { + motif_length = pspm.length; + } + if (typeof alph_length !== "number") { + alph_length = pspm[0].length; + if (alph_length != 4 && alph_length != 20) { + throw new Error("Expected length of first row in the PSPM to be " + + "either 4 or 20 but got " + alph_length); + } + } + for (i = 0; i < pspm.length; i++) { + if (pspm[i].length != alph_length) { + throw new Error("Expected PSPM row " + i + " to have a length of " + + alph_length + " but the length was " + pspm[i].length); + } + } + return {"pspm": pspm, "motif_length": motif_length, + "alph_length": alph_length, "nsites": nsites, "evalue": evalue}; +} +//====================================================================== +// end Pspm object +//====================================================================== + +//====================================================================== +// start Logo object +//====================================================================== + +var Logo = function(alphabet, options) { + "use strict"; + this.alphabet = alphabet; + this.fine_text = ""; + this.x_axis = 1; + this.y_axis = true; + this.xlate_nsyms = 1; + this.xlate_start = null; + this.xlate_end = null; + this.pspm_list = []; + this.pspm_column = []; + this.rows = 0; + this.columns = 0; + if (typeof options === "string") { + // the old method signature had fine_text here so we support that + this.fine_text = options; + } else if (typeof options === "object" && options != null) { + this.fine_text = (typeof options.fine_text === "string" ? options.fine_text : ""); + this.x_axis = (typeof options.x_axis === "boolean" ? (options.x_axis ? 1 : 0) : 1); + if (options.x_axis_hidden != null && options.x_axis_hidden) this.x_axis = -1; + this.y_axis = (typeof options.y_axis === "boolean" ? options.y_axis : true); + this.xlate_nsyms = (typeof options.xlate_nsyms === "number" ? options.xlate_nsyms : this.xlate_nsyms); + this.xlate_start = (typeof options.xlate_start === "number" ? options.xlate_start : this.xlate_start); + this.xlate_end = (typeof options.xlate_end === "number" ? options.xlate_end : this.xlate_end); + } +}; + +Logo.prototype.add_pspm = function(pspm, column) { + "use strict"; + var col; + if (typeof column === "undefined") { + column = 0; + } else if (column < 0) { + throw new Error("Column index out of bounds."); + } + this.pspm_list[this.rows] = pspm; + this.pspm_column[this.rows] = column; + this.rows++; + col = column + pspm.get_motif_length(); + if (col > this.columns) { + this.columns = col; + } +}; + +Logo.prototype.get_columns = function() { + "use strict"; + return this.columns; +}; + +Logo.prototype.get_xlate_nsyms = function() { + "use strict"; + return this.xlate_nsyms; +}; + +Logo.prototype.get_xlate_start = function() { + "use strict"; + return (this.xlate_start != null ? this.xlate_start : 0); +}; + +Logo.prototype.get_xlate_end = function() { + "use strict"; + return (this.xlate_end != null ? this.xlate_end : this.columns * this.xlate_nsyms); +}; + +Logo.prototype.get_xlate_columns = function() { + "use strict"; + return this.get_xlate_end() - this.get_xlate_start(); +}; + +Logo.prototype.get_rows = function() { + "use strict"; + return this.rows; +}; + +Logo.prototype.get_pspm = function(row_index) { + "use strict"; + if (row_index < 0 || row_index >= this.rows) { + throw new Error("INDEX_OUT_OF_BOUNDS"); + } + return this.pspm_list[row_index]; +}; + +Logo.prototype.get_offset = function(row_index) { + "use strict"; + if (row_index < 0 || row_index >= this.rows) { + throw new Error("INDEX_OUT_OF_BOUNDS"); + } + return this.pspm_column[row_index]; +}; + +Logo.prototype._as_eps_data = function(ssc, errbars) { + var i, j, pos, stack_pos, pspm, stack, sym, out; + out = ""; + for (i = 0; i < this.rows; i++) { + out += "\nStartLine\n"; + // Indent + for (j = 0; j < this.pspm_column[i]; j++) { + out += "() startstack\nendstack\n\n"; + } + pspm = this.pspm_list[i]; + if (pspm.get_left_trim() > 0) { + out += "MuteColour\nDrawTrimEdge\n" + pspm.get_left_trim() + " DrawTrimBg\n"; + } + for (pos = 0; pos < pspm.get_motif_length(); pos++) { + if (pos != 0 && pos == pspm.get_left_trim()) { // enable full colour + out += "DrawTrimEdge\nRestoreColour\n"; + } else if (pos == (pspm.get_motif_length() - pspm.get_right_trim())) { + out += "MuteColour\n" + pspm.get_right_trim() + " DrawTrimBg\n"; + } + out += "(" + (pos + 1) + ") startstack\n"; + stack = pspm.get_stack(pos, this.alphabet, ssc); + for (stack_pos = 0; stack_pos < stack.length; stack_pos++) { + sym = stack[stack_pos]; + out += " " + (sym.get_scale() * this.alphabet.get_ic()) + " (" + sym.get_symbol() + ") numchar\n"; + } + if (errbars) { + out += " " + pspm.get_error(this.alphabet) + " Ibeam\n"; + } + out += "endstack\n\n"; + } + if (pspm.get_right_trim() > 0 || pspm.get_left_trim() == pspm.get_motif_length()) { + out += "RestoreColour\n"; + } + out += "EndLine\n"; + } + return out; +}; + +Logo.prototype.as_eps = function(options) { + "use strict"; + if (this.xlate_nsyms != 1) throw new Error("Unsupported setting xlate_nsyms for EPS"); + if (this.xlate_start != null) throw new Error("Unsupported setting xlate_start for EPS"); + if (this.xlate_end != null) throw new Error("Unsupported setting xlate_end for EPS"); + + var LOGOHEIGHT = 7.5; // default height of line in cm + var cm2pts, height, width, now, ssc, errbars; + if (typeof options === "undefined") { + options = {}; + } + cm2pts = 72 / 2.54; + if (typeof options.logo_height == "number") { + height = options.logo_height; + } else { + height = LOGOHEIGHT * this.rows; + } + if (typeof options.logo_width == "number") { + width = options.logo_width; + } else { + width = this.columns + 2; + } + now = new Date(); + ssc = (typeof options.ssc == "boolean" ? options.ssc : false); + errbars = (typeof options.show_error_bar == "boolean" ? options.show_error_bar : ssc); + var values = { + "LOGOHEIGHT": height, + "LOGOWIDTH": width, + "BOUNDINGHEIGHT": Math.round(height * cm2pts), + "BOUNDINGWIDTH": Math.round(width * cm2pts), + "LOGOLINEHEIGHT": (height / this.rows), + "CHARSPERLINE": this.columns, + "BARBITS": this.alphabet.get_ic(), + "LOGOTYPE": (this.alphabet.has_complement() ? "NA" : "AA"), + "CREATIONDATE": now.getDate() + "." + (now.getMonth() + 1) + "." + now.getFullYear() + " " + now.getHours() + ":" + now.getMinutes() + ":" + now.getSeconds(), + "ERRORBARFRACTION": (typeof options.error_bar_fraction == "number" ? options.error_bar_fraction : 1.0), + "TICBITS": (typeof options.ticbits == "number" ? options.ticbits : 1.0), + "TITLE": (typeof options.title == "string" ? options.title : ""), + "FINEPRINT": (typeof options.fineprint == "string" ? options.fineprint : this.fine_text), + "XAXISLABEL": (typeof options.xaxislabel == "string" ? options.xaxislabel : ""), + "YAXISLABEL": (typeof options.yaxislabel == "string" ? options.yaxislabel : "bits"), + "SSC": ssc, + "YAXIS": (typeof options.show_y_axis == "boolean" ? options.show_y_axis : this.y_axis), + "SHOWENDS": (typeof options.show_ends == "boolean" ? options.show_ends : false), + "ERRBAR": errbars, + "OUTLINE": (typeof options.show_outline == "boolean" ? options.show_outline : false), + "NUMBERING": (typeof options.show_numbering == "boolean" ? options.show_numbering : this.x_axis != 0), + "SHOWINGBOX": (typeof options.show_box == "boolean" ? options.show_box : false), + "CREATOR": (typeof options.creator == "string" ? options.creator : "motif_logo.js"), + "FONTSIZE": (typeof options.label_font_size == "number" ? options.label_font_size : 12), + "TITLEFONTSIZE": (typeof options.title_font_size == "number" ? options.title_font_size : 12), + "SMALLFONTSIZE": (typeof options.small_font_size == "number" ? options.small_font_size : 6), + "TOPMARGIN" : (typeof options.top_margin == "number" ? options.top_margin : 0.9), + "BOTTOMMARGIN": (typeof options.bottom_margin == "number" ? options.bottom_margin : 0.9), + "COLORDICT": this.alphabet._as_eps_dict(), + "DATA": this._as_eps_data(ssc, errbars) + }; + // now this requires that the script containing the template has been imported! + return motif_logo_template(values); +}; + +//====================================================================== +// end Logo object +//====================================================================== + +// calculate the exact size (in pixels) of an object drawn on the +// canvas assuming that the background of the canvas is transparent. +function canvas_bounds(ctx, cwidth, cheight) { + "use strict"; + var data, r, c, top_line, bottom_line, left_line, right_line, + txt_width, txt_height; + + // extract the image data + data = ctx.getImageData(0, 0, cwidth, cheight).data; + + // set initial values + top_line = -1; bottom_line = -1; left_line = -1; right_line = -1; + txt_width = 0; txt_height = 0; + + // Find the top-most line with a non-transparent pixel + for (r = 0; r < cheight; r++) { + for (c = 0; c < cwidth; c++) { + if (data[r * cwidth * 4 + c * 4 + 3]) { + top_line = r; + break; + } + } + if (top_line != -1) { + break; + } + } + + // Only bother looking if we found at least one set pixel... + if (top_line != -1) { + + //find the last line with a non-transparent pixel + for (r = cheight-1; r >= top_line; r--) { + for(c = 0; c < cwidth; c++) { + if(data[r * cwidth * 4 + c * 4 + 3]) { + bottom_line = r; + break; + } + } + if (bottom_line != -1) { + break; + } + } + // calculate height + txt_height = bottom_line - top_line + 1; + + // Find the left-most line with a non-transparent pixel + for (c = 0; c < cwidth; c++) { + for (r = top_line; r <= bottom_line; r++) { + if (data[r * cwidth * 4 + c * 4 + 3]) { + left_line = c; + break; + } + } + if (left_line != -1) { + break; + } + } + + //find the right most line with a non-transparent pixel + for (c = cwidth-1; c >= left_line; c--) { + for(r = top_line; r <= bottom_line; r++) { + if(data[r * cwidth * 4 + c * 4 + 3]) { + right_line = c; + break; + } + } + if (right_line != -1) { + break; + } + } + txt_width = right_line - left_line + 1; + } + + //return the bounds + return {bound_top: top_line, bound_bottom: bottom_line, + bound_left: left_line, bound_right: right_line, width: txt_width, + height: txt_height}; +} + +//====================================================================== +// start RasterizedAlphabet +//====================================================================== + +// Rasterize Alphabet +// 1) Measure width of text at default font for all symbols in alphabet +// 2) sort in width ascending +// 3) Drop the top and bottom 10% (designed to ignore outliers like 'W' and 'I') +// 4) Calculate the average as the maximum scaling factor (designed to stop I becoming a rectangular blob). +// 5) Assume scale of zero would result in width of zero, interpolate scale required to make perfect width font +// 6) Draw text onto temp canvas at calculated scale +// 7) Find bounds of drawn text +// 8) Paint on to another canvas at the desired height (but only scaling width to fit if larger). +var RasterizedAlphabet = function(alphabet, logo_scale, font, width) { + "use strict"; + var default_size, safety_pad, canvas, ctx, middle, baseline, widths, sizes, + i, sym, size, tenpercent, avg_width, scale, + target_width, target_height; + //variable prototypes + this.alphabet = alphabet; + this.scale = logo_scale; + this.sym_cache = {}; + this.stack_num_cache = []; + this.scale_num_cache = []; + // size of canvas + default_size = 60; // size of measuring canvas + safety_pad = 20; // pixels to pad around so we don't miss the edges + // create a canvas to do our measuring + canvas = document.createElement("canvas"); + if (!canvas.getContext) throw new Error("No canvas support"); + canvas.width = default_size + 2 * safety_pad; + canvas.height = default_size + 2 * safety_pad; + middle = Math.round(canvas.width / 2); + baseline = Math.round(canvas.height - safety_pad); + ctx = canvas.getContext('2d'); + if (!supports_text(ctx)) throw new Error("Canvas does not support text"); + ctx.font = font; + ctx.textAlign = "center"; + ctx.translate(middle, baseline); + // list of widths + widths = []; + sizes = []; + //now measure each letter in the alphabet + for (i = 0; i < alphabet.get_size_core(); ++i) { + // reset the canvas + ctx.clearRect(0, 0, canvas.width, canvas.height); + ctx.fillStyle = alphabet.get_colour(i); + // draw the test text + ctx.fillText(alphabet.get_symbol(i), 0, 0); + //measure + size = canvas_bounds(ctx, canvas.width, canvas.height); + if (size.width === 0) throw new Error("Invisible symbol!"); + widths.push(size.width); + sizes[i] = size; + } + //sort the widths + widths.sort(function(a,b) {return a - b;}); + //drop 10% of the items off each end + tenpercent = Math.floor(widths.length / 10); + for (i = 0; i < tenpercent; ++i) { + widths.pop(); + widths.shift(); + } + //calculate average width + avg_width = 0; + for (i = 0; i < widths.length; ++i) { + avg_width += widths[i]; + } + avg_width /= widths.length; + // calculate the target width + target_width = width * this.scale * 2; + // calculate scales + for (i = 0; i < alphabet.get_size_core(); ++i) { + sym = alphabet.get_symbol(i); + size = sizes[i]; + // calculate scale + scale = target_width / Math.max(avg_width, size.width); + // estimate scaled height + target_height = size.height * scale; + // create an appropriately sized canvas + canvas = document.createElement("canvas"); + canvas.width = target_width; + canvas.height = target_height + safety_pad * 2; + // calculate the middle + middle = Math.round(canvas.width / 2); + // calculate the baseline + baseline = Math.round(canvas.height - safety_pad); + // get the context and prepare to draw the rasterized text + ctx = canvas.getContext('2d'); + ctx.font = font; + ctx.fillStyle = alphabet.get_colour(i); + ctx.textAlign = "center"; + ctx.translate(middle, baseline); + ctx.save(); + ctx.scale(scale, scale); + // draw the text + ctx.fillText(sym, 0, 0); + ctx.restore(); + this.sym_cache[sym] = {"image": canvas, "size": canvas_bounds(ctx, canvas.width, canvas.height)}; + } +}; + +RasterizedAlphabet.prototype.get_alphabet = function() { + return this.alphabet; +}; + +RasterizedAlphabet.prototype.get_scale = function() { + return this.scale; +}; + +RasterizedAlphabet.prototype.draw_stack_sym = function(ctx, letter, dx, dy, dWidth, dHeight) { + "use strict"; + var entry, image, size; + entry = this.sym_cache[letter]; + image = entry.image; + size = entry.size; + ctx.drawImage(image, 0, size.bound_top -1, image.width, size.height+1, dx, dy, dWidth, dHeight); +}; + +RasterizedAlphabet.prototype.draw_stack_num = function(ctx, font, stack_width, index) { + var image, image_ctx, text_length; + if (index >= this.stack_num_cache.length) { + image = document.createElement("canvas"); + // measure the text + image_ctx = image.getContext('2d'); + image_ctx.save(); + image_ctx.font = font; + text_length = image_ctx.measureText("" + (index + 1)).width; + image_ctx.restore(); + // resize the canvas to fit + image.width = Math.ceil(stack_width); + image.height = Math.ceil(text_length); + // draw the text + image_ctx = image.getContext('2d'); + image_ctx.translate(Math.round(stack_width / 2), 0); + image_ctx.font = font; + image_ctx.textBaseline = "middle"; + image_ctx.textAlign = "right"; + image_ctx.rotate(-(Math.PI / 2)); + image_ctx.fillText("" + (index + 1), 0, 0); + this.stack_num_cache[index] = image; + } else { + image = this.stack_num_cache[index]; + } + ctx.drawImage(image, 0, 0); +} + +RasterizedAlphabet.prototype.draw_scale_num = function(ctx, font, num) { + var image, image_ctx, text_size, m_length; + if (num >= this.scale_num_cache.length) { + image = document.createElement("canvas"); + // measure the text + image_ctx = image.getContext('2d'); + image_ctx.font = font; + text_size = image_ctx.measureText("" + num); + if (text_size.actualBoundingBoxAscent && text_size.actualBoundingBoxDesent) { + // resize the canvas to fit + image.width = Math.ceil(text_size.width); + image.height = Math.ceil(text_size.actualBoundingBoxAscent + text_size.actualBoundingBoxDesent); + // draw the text + image_ctx = image.getContext('2d'); + image_ctx.font = font; + image_ctx.textAlign = "right"; + image_ctx.fillText("" + num, image.width, text_size.actualBoundingBoxAscent); + } else { + // measure width of 'm' to approximate height, we double it later anyway + m_length = image_ctx.measureText("m").width; + // resize the canvas to fit + image.width = Math.ceil(text_size.width); + image.height = Math.ceil(2 * m_length); + // draw the text + image_ctx = image.getContext('2d'); + image_ctx.font = font; + image_ctx.textAlign = "right"; + image_ctx.textBaseline = "middle"; + image_ctx.fillText("" + num, image.width, m_length); + } + this.scale_num_cache[num] = image; + } else { + image = this.scale_num_cache[num]; + } + ctx.drawImage(image, -image.width, -Math.round(image.height / 2)) +} + +//====================================================================== +// end RasterizedAlphabet +//====================================================================== + +//====================================================================== +// start LogoMetrics object +//====================================================================== + +var LogoMetrics = function(ctx, logo_columns, logo_rows, has_names, has_finetext, x_axis, y_axis) { + "use strict"; + var i, row_height; + //variable prototypes + this.pad_top = (has_names ? 5 : 0); + this.pad_left = (y_axis ? 10 : 0); + this.pad_right = (has_finetext ? 15 : 0); + this.pad_bottom = 0; + this.pad_middle = 20; + this.name_height = 14; + this.name_font = "bold " + this.name_height + "px Times, sans-serif"; + this.name_spacer = 0; + this.y_axis = y_axis; + this.y_label = "bits"; + this.y_label_height = 12; + this.y_label_font = "bold " + this.y_label_height + "px Helvetica, sans-serif"; + this.y_label_spacer = 3; + this.y_num_height = 12; + this.y_num_width = 0; + this.y_num_font = "bold " + this.y_num_height + "px Helvetica, sans-serif"; + this.y_tic_width = 5; + this.stack_pad_left = 0; + this.stack_font = "bold 25px Helvetica, sans-serif"; + this.stack_height = 90; + this.stack_width = 26; + this.stacks_pad_right = 5; + this.x_axis = x_axis; + this.x_num_above = 2; + this.x_num_height = 12; + this.x_num_width = 0; + this.x_num_font = "bold " + this.x_num_height + "px Helvetica, sans-serif"; + this.fine_txt_height = 6; + this.fine_txt_above = 2; + this.fine_txt_font = "normal " + this.fine_txt_height + "px Helvetica, sans-serif"; + this.letter_metrics = new Array(); + this.summed_width = 0; + this.summed_height = 0; + //calculate the width of the y axis numbers + ctx.font = this.y_num_font; + for (i = 0; i <= 2; i++) { + this.y_num_width = Math.max(this.y_num_width, ctx.measureText("" + i).width); + } + //calculate the width of the x axis numbers (but they are rotated so it becomes height) + if (x_axis == 1) { + ctx.font = this.x_num_font; + for (i = 1; i <= logo_columns; i++) { + this.x_num_width = Math.max(this.x_num_width, ctx.measureText("" + i).width); + } + } else if (x_axis == 0) { + this.x_num_height = 4; + this.x_num_width = 4; + } else { + this.x_num_height = 0; + this.x_num_width = 0; + } + + //calculate how much vertical space we want to draw this + //first we add the padding at the top and bottom since that's always there + this.summed_height += this.pad_top + this.pad_bottom; + //all except the last row have the same amount of space allocated to them + if (logo_rows > 1) { + row_height = this.stack_height + this.pad_middle; + if (has_names) { + row_height += this.name_height; + //the label is allowed to overlap into the spacer + row_height += Math.max(this.y_num_height/2, this.name_spacer); + //the label is allowed to overlap the space used by the other label + row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above); + } else { + row_height += this.y_num_height/2; + //the label is allowed to overlap the space used by the other label + row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above); + } + this.summed_height += row_height * (logo_rows - 1); + } + //the last row has the name and fine text below it but no padding + this.summed_height += this.stack_height + (this.y_axis ? this.y_num_height/2 : 0); + + var fine_txt_total = (has_finetext ? this.fine_txt_height + this.fine_txt_above : 0); + if (has_names) { + this.summed_height += fine_txt_total + this.name_height; + this.summed_height += Math.max((this.y_axis ? this.y_num_height/2 : 0), + this.x_num_height + this.x_num_above + this.name_spacer); + } else { + this.summed_height += Math.max((this.y_axis ? this.y_num_height/2 : 0), + this.x_num_height + this.x_num_above + fine_txt_total); + } + + //calculate how much horizontal space we want to draw this + //first add the padding at the left and right since that's always there + this.summed_width += this.pad_left + this.pad_right; + if (this.y_axis) { + //add on the space for the y-axis label + this.summed_width += this.y_label_height + this.y_label_spacer; + //add on the space for the y-axis + this.summed_width += this.y_num_width + this.y_tic_width; + } + //add on the space for the stacks + this.summed_width += (this.stack_pad_left + this.stack_width) * logo_columns; + //add on the padding after the stacks (an offset from the fine text) + this.summed_width += this.stacks_pad_right; + +}; + +//====================================================================== +// end LogoMetrics object +//====================================================================== + +//found this trick at http://talideon.com/weblog/2005/02/detecting-broken-images-js.cfm +function image_ok(img) { + "use strict"; + // During the onload event, IE correctly identifies any images that + // weren't downloaded as not complete. Others should too. Gecko-based + // browsers act like NS4 in that they report this incorrectly. + if (!img.complete) { + return false; + } + // However, they do have two very useful properties: naturalWidth and + // naturalHeight. These give the true size of the image. If it failed + // to load, either of these should be zero. + if (typeof img.naturalWidth !== "undefined" && img.naturalWidth === 0) { + return false; + } + // No other way of checking: assume it's ok. + return true; +} + +function supports_text(ctx) { + "use strict"; + if (!ctx.fillText) { + return false; + } + if (!ctx.measureText) { + return false; + } + return true; +} + +//draws the scale, returns the width +function draw_scale(ctx, metrics, alphabet_ic, raster) { + "use strict"; + var tic_height, i; + tic_height = metrics.stack_height / alphabet_ic; + ctx.save(); + ctx.translate(metrics.y_label_height, metrics.y_num_height/2); + //draw the axis label + ctx.save(); + ctx.font = metrics.y_label_font; + ctx.translate(0, metrics.stack_height/2); + ctx.rotate(-(Math.PI / 2)); + ctx.textAlign = "center"; + ctx.fillText("bits", 0, 0); + ctx.restore(); + + ctx.translate(metrics.y_label_spacer + metrics.y_num_width, 0); + + //draw the axis tics + ctx.save(); + ctx.translate(0, metrics.stack_height); + for (i = 0; i <= alphabet_ic; i++) { + //draw the number + ctx.save(); + ctx.translate(-1, 0); + raster.draw_scale_num(ctx, metrics.y_num_font, i); + ctx.restore(); + //draw the tic + ctx.fillRect(0, -1, metrics.y_tic_width, 2); + //prepare for next tic + ctx.translate(0, -tic_height); + } + ctx.restore(); + + ctx.fillRect(metrics.y_tic_width - 2, 0, 2, metrics.stack_height) + + ctx.restore(); +} + +function draw_stack_num(ctx, metrics, row_index, raster) { + "use strict"; + ctx.save(); + ctx.translate(0, Math.round(metrics.stack_height + metrics.x_num_above)); + if (metrics.x_axis == 1) { + raster.draw_stack_num(ctx, metrics.x_num_font, metrics.stack_width, row_index); + } else if (metrics.x_axis == 0) { + // draw dots instead of the numbers (good for small logos) + ctx.beginPath(); + var radius = Math.round(metrics.x_num_height / 2); + ctx.arc(Math.round(metrics.stack_width / 2), radius, radius, 0, 2 * Math.PI, false); + ctx.fill(); + } + ctx.restore(); +} + +function draw_stack(ctx, metrics, symbols, raster) { + "use strict"; + var preferred_pad, sym_min, i, sym, sym_height, pad; + preferred_pad = 0; + sym_min = 5; + + ctx.save();//1 + ctx.translate(0, metrics.stack_height); + for (i = 0; i < symbols.length; i++) { + sym = symbols[i]; + sym_height = metrics.stack_height * sym.get_scale(); + + pad = preferred_pad; + if (sym_height - pad < sym_min) { + pad = Math.min(pad, Math.max(0, sym_height - sym_min)); + } + sym_height -= pad; + + //translate to the correct position + ctx.translate(0, -(pad/2 + sym_height)); + + //draw + raster.draw_stack_sym(ctx, sym.get_symbol(), 0, 0, metrics.stack_width, sym_height); + //translate past the padding + ctx.translate(0, -(pad/2)); + } + ctx.restore();//1 +} + +function draw_dashed_line(ctx, pattern, start, x1, y1, x2, y2) { + "use strict"; + var x, y, len, i, dx, dy, tlen, theta, mulx, muly, lx, ly; + dx = x2 - x1; + dy = y2 - y1; + tlen = Math.pow(dx*dx + dy*dy, 0.5); + theta = Math.atan2(dy,dx); + mulx = Math.cos(theta); + muly = Math.sin(theta); + lx = []; + ly = []; + for (i = 0; i < pattern; ++i) { + lx.push(pattern[i] * mulx); + ly.push(pattern[i] * muly); + } + i = start; + x = x1; + y = y1; + len = 0; + ctx.beginPath(); + while (len + pattern[i] < tlen) { + ctx.moveTo(x, y); + x += lx[i]; + y += ly[i]; + ctx.lineTo(x, y); + len += pattern[i]; + i = (i + 1) % pattern.length; + x += lx[i]; + y += ly[i]; + len += pattern[i]; + i = (i + 1) % pattern.length; + } + if (len < tlen) { + ctx.moveTo(x, y); + x += mulx * (tlen - len); + y += muly * (tlen - len); + ctx.lineTo(x, y); + } + ctx.stroke(); +} + +function draw_trim_background(ctx, metrics, left_start, left_end, left_divider, right_start, right_end, right_divider) { + "use strict"; + var left_size = left_end - left_start; + var right_size = right_end - right_start; + var line_x; + + ctx.save();//s8 + ctx.fillStyle = "rgb(240, 240, 240)"; + if (left_size > 0) { + ctx.fillRect(left_start * metrics.stack_width, 0, left_size * metrics.stack_width, metrics.stack_height); + } + if (right_size > 0) { + ctx.fillRect(right_start * metrics.stack_width, 0, right_size * metrics.stack_width, metrics.stack_height); + } + ctx.fillStyle = "rgb(51, 51, 51)"; + if (left_size > 0 && left_divider) { + line_x = (left_end * metrics.stack_width) - 0.5; + draw_dashed_line(ctx, [3], 0, line_x, 0, line_x, metrics.stack_height); + } + if (right_size > 0 && right_divider) { + line_x = (right_start * metrics.stack_width) + 0.5; + draw_dashed_line(ctx, [3], 0, line_x, 0, line_x, metrics.stack_height); + } + ctx.restore();//s8 +} + +function size_logo_on_canvas(logo, canvas, show_names, scale) { + "use strict"; + var draw_name, draw_finetext, metrics; + draw_name = (typeof show_names === "boolean" ? show_names : (logo.get_rows() > 1)); + draw_finetext = (logo.fine_text.length > 0); + if (canvas.width !== 0 && canvas.height !== 0) { + return; + } + metrics = new LogoMetrics(canvas.getContext('2d'), + logo.get_xlate_columns(), logo.get_rows(), draw_name, draw_finetext, logo.x_axis, logo.y_axis); + if (typeof scale == "number") { + //resize the canvas to fit the scaled logo + canvas.width = metrics.summed_width * scale; + canvas.height = metrics.summed_height * scale; + } else { + if (canvas.width === 0 && canvas.height === 0) { + canvas.width = metrics.summed_width; + canvas.height = metrics.summed_height; + } else if (canvas.width === 0) { + canvas.width = metrics.summed_width * (canvas.height / metrics.summed_height); + } else if (canvas.height === 0) { + canvas.height = metrics.summed_height * (canvas.width / metrics.summed_width); + } + } +} + +function draw_logo_on_canvas(logo, canvas, show_names, scale) { + "use strict"; + var i, draw_name, draw_finetext, ctx, metrics, raster, pspm_i, pspm, + offset, col_index, motif_position, ssc; + ssc = false; + draw_name = (typeof show_names === "boolean" ? show_names : (logo.get_rows() > 1)); + draw_finetext = (logo.fine_text.length > 0); + ctx = canvas.getContext('2d'); + //assume that the user wants the canvas scaled equally so calculate what the best width for this image should be + metrics = new LogoMetrics(ctx, logo.get_xlate_columns(), logo.get_rows(), draw_name, draw_finetext, logo.x_axis, logo.y_axis); + if (typeof scale == "number") { + //resize the canvas to fit the scaled logo + canvas.width = metrics.summed_width * scale; + canvas.height = metrics.summed_height * scale; + } else { + if (canvas.width === 0 && canvas.height === 0) { + scale = 1; + canvas.width = metrics.summed_width; + canvas.height = metrics.summed_height; + } else if (canvas.width === 0) { + scale = canvas.height / metrics.summed_height; + canvas.width = metrics.summed_width * scale; + } else if (canvas.height === 0) { + scale = canvas.width / metrics.summed_width; + canvas.height = metrics.summed_height * scale; + } else { + scale = Math.min(canvas.width / metrics.summed_width, canvas.height / metrics.summed_height); + } + } + // cache the raster based on the assumption that we will be drawing a lot + // of logos the same size and alphabet + if (typeof draw_logo_on_canvas.raster_cache === "undefined") { + draw_logo_on_canvas.raster_cache = []; + } + for (i = 0; i < draw_logo_on_canvas.raster_cache.length; i++) { + raster = draw_logo_on_canvas.raster_cache[i]; + if (raster.get_alphabet().equals(logo.alphabet) && + Math.abs(raster.get_scale() - scale) < 0.1) break; + raster = null; + } + if (raster == null) { + raster = new RasterizedAlphabet(logo.alphabet, scale, metrics.stack_font, metrics.stack_width); + draw_logo_on_canvas.raster_cache.push(raster); + } + ctx = canvas.getContext('2d'); + ctx.save();//s1 + ctx.scale(scale, scale); + ctx.save();//s2 + ctx.save();//s7 + //create margin + ctx.translate(Math.round(metrics.pad_left), Math.round(metrics.pad_top)); + for (pspm_i = 0; pspm_i < logo.get_rows(); ++pspm_i) { + pspm = logo.get_pspm(pspm_i); + offset = logo.get_offset(pspm_i); + //optionally draw name if this isn't the last row or is the only row + if (draw_name && (logo.get_rows() == 1 || pspm_i != (logo.get_rows()-1))) { + ctx.save();//s4 + ctx.translate(Math.round(metrics.summed_width/2), Math.round(metrics.name_height)); + ctx.font = metrics.name_font; + ctx.textAlign = "center"; + ctx.fillText(pspm.name, 0, 0); + ctx.restore();//s4 + ctx.translate(0, Math.round(metrics.name_height + + Math.min(0, metrics.name_spacer - metrics.y_num_height/2))); + } + //draw scale + if (logo.y_axis) draw_scale(ctx, metrics, logo.alphabet.get_ic(), raster); + ctx.save();//s5 + //translate across past the scale + if (logo.y_axis) { + ctx.translate(Math.round(metrics.y_label_height + metrics.y_label_spacer + + metrics.y_num_width + metrics.y_tic_width), Math.round(metrics.y_num_height / 2)); + } + //draw the trimming background + if (pspm.get_left_trim() > 0 || pspm.get_right_trim() > 0) { + var left_start = offset * logo.get_xlate_nsyms(); + var left_end = (offset + pspm.get_left_trim()) * logo.get_xlate_nsyms(); + var left_divider = true; + if (left_end < logo.get_xlate_start() || left_start > logo.get_xlate_end()) { + // no overlap + left_start = 0; + left_end = 0; + left_divider = false; + } else { + if (left_start < logo.get_xlate_start()) { + left_start = logo.get_xlate_start(); + } + if (left_end > logo.get_xlate_end()) { + left_end = logo.get_xlate_end(); + left_divider = false; + } + left_start -= logo.get_xlate_start(); + left_end -= logo.get_xlate_start(); + if (left_end < left_start) { + left_start = 0; + left_end = 0; + left_divider = false; + } + } + var right_end = (offset + pspm.get_motif_length()) * logo.get_xlate_nsyms(); + //var right_start = right_end - (pspm.get_left_trim() * logo.get_xlate_nsyms()); + var right_start = right_end - (pspm.get_right_trim() * logo.get_xlate_nsyms()); + var right_divider = true; + if (right_end < logo.get_xlate_start() || right_start > logo.get_xlate_end()) { + // no overlap + right_start = 0; + right_end = 0; + right_divider = false; + } else { + if (right_start < logo.get_xlate_start()) { + right_start = logo.get_xlate_start(); + right_divider = false; + } + if (right_end > logo.get_xlate_end()) { + right_end = logo.get_xlate_end(); + } + right_start -= logo.get_xlate_start(); + right_end -= logo.get_xlate_start(); + if (right_end < right_start) { + right_start = 0; + right_end = 0; + right_divider = false; + } + } + draw_trim_background(ctx, metrics, left_start, left_end, left_divider, right_start, right_end, right_divider); + } + //draw letters + var xlate_col; + for (xlate_col = logo.get_xlate_start(); xlate_col < logo.get_xlate_end(); xlate_col++) { + ctx.translate(metrics.stack_pad_left,0); + col_index = Math.floor(xlate_col / logo.get_xlate_nsyms()); + if (xlate_col % logo.get_xlate_nsyms() == 0) { + if (col_index >= offset && col_index < (offset + pspm.get_motif_length())) { + motif_position = col_index - offset; + draw_stack_num(ctx, metrics, motif_position, raster); + draw_stack(ctx, metrics, pspm.get_stack(motif_position, logo.alphabet, ssc), raster); + } + } else { + if (col_index >= offset && col_index < (offset + pspm.get_motif_length())) { + ctx.save();// s5.1 + ctx.translate(0, Math.round(metrics.stack_height)); + // TODO draw a dot or dash or something to indicate continuity of the motif + ctx.restore(); //s5.1 + } + } + ctx.translate(Math.round(metrics.stack_width), 0); + } + ctx.restore();//s5 + ////optionally draw name if this is the last row but isn't the only row + if (draw_name && (logo.get_rows() != 1 && pspm_i == (logo.get_rows()-1))) { + //translate vertically past the stack and axis's + ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height + + Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width + metrics.name_spacer)); + + ctx.save();//s6 + ctx.translate(metrics.summed_width/2, metrics.name_height); + ctx.font = metrics.name_font; + ctx.textAlign = "center"; + ctx.fillText(pspm.name, 0, 0); + ctx.restore();//s6 + ctx.translate(0, metrics.name_height); + } else { + //translate vertically past the stack and axis's + ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height + + Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width)); + } + //if not the last row then add middle padding + if (pspm_i != (logo.get_rows() -1)) { + ctx.translate(0, metrics.pad_middle); + } + } + ctx.restore();//s7 + if (logo.fine_text.length > 0) { + ctx.translate(metrics.summed_width - metrics.pad_right, metrics.summed_height - metrics.pad_bottom); + ctx.font = metrics.fine_txt_font; + ctx.textAlign = "right"; + ctx.fillText(logo.fine_text, 0,0); + } + ctx.restore();//s2 + ctx.restore();//s1 +} + +function create_canvas(c_width, c_height, c_id, c_title, c_display) { + "use strict"; + var canvas = document.createElement("canvas"); + //check for canvas support before attempting anything + if (!canvas.getContext) { + return null; + } + var ctx = canvas.getContext('2d'); + //check for html5 text drawing support + if (!supports_text(ctx)) { + return null; + } + //size the canvas + canvas.width = c_width; + canvas.height = c_height; + canvas.id = c_id; + canvas.title = c_title; + canvas.style.display = c_display; + return canvas; +} + +function logo_1(alphabet, fine_text, pspm) { + "use strict"; + var logo = new Logo(alphabet, fine_text); + logo.add_pspm(pspm); + return logo; +} + +function logo_2(alphabet, fine_text, target, query, query_offset) { + "use strict"; + var logo = new Logo(alphabet, fine_text); + if (query_offset < 0) { + logo.add_pspm(target, -query_offset); + logo.add_pspm(query); + } else { + logo.add_pspm(target); + logo.add_pspm(query, query_offset); + } + return logo; +} + +/* + * Specifies an alternate source for an image. + * If the image with the image_id specified has + * not loaded then a generated logo will be used + * to replace it. + * + * Note that the image must either have dimensions + * or a scale must be set. + */ +function alternate_logo(logo, image_id, scale) { + "use strict"; + var image = document.getElementById(image_id); + if (!image) { + alert("Can't find specified image id (" + image_id + ")"); + return; + } + //if the image has loaded then there is no reason to use the canvas + if (image_ok(image)) { + return; + } + //the image has failed to load so replace it with a canvas if we can. + var canvas = create_canvas(image.width, image.height, image_id, image.title, image.style.display); + if (canvas === null) { + return; + } + //draw the logo on the canvas + draw_logo_on_canvas(logo, canvas, null, scale); + //replace the image with the canvas + image.parentNode.replaceChild(canvas, image); +} + +/* + * Specifes that the element with the specified id + * should be replaced with a generated logo. + */ +function replace_logo(logo, replace_id, scale, title_txt, display_style) { + "use strict"; + var element = document.getElementById(replace_id); + if (!replace_id) { + alert("Can't find specified id (" + replace_id + ")"); + return; + } + //found the element! + var canvas = create_canvas(50, 120, replace_id, title_txt, display_style); + if (canvas === null) { + return; + } + //draw the logo on the canvas + draw_logo_on_canvas(logo, canvas, null, scale); + //replace the element with the canvas + element.parentNode.replaceChild(canvas, element); +} + +/* + * Fast string trimming implementation found at + * http://blog.stevenlevithan.com/archives/faster-trim-javascript + * + * Note that regex is good at removing leading space but + * bad at removing trailing space as it has to first go through + * the whole string. + */ +function trim (str) { + "use strict"; + var ws, i; + str = str.replace(/^\s\s*/, ''); + ws = /\s/; i = str.length; + while (ws.test(str.charAt(--i))); + return str.slice(0, i + 1); +} +</script> + <script> +var current_motif = 0; +var dreme_alphabet = new Alphabet(data.alphabet, data.control_db.freqs); + +/* + * Create a pspm for the given motif data + */ +function motif_pspm(m) { + return new Pspm(m.pwm, m.id, 0, 0, m.nsites, m.evalue); +} + +/* + * Create a count matrix from the given motif data + */ +function motif_count_matrix(motif) { + return motif_pspm(motif).as_count_matrix(); +} + +/* + * Create a probablity matrix from the given motif data + */ +function motif_prob_matrix(motif) { + return motif_pspm(motif).as_probability_matrix(); +} + +/* + * Create a minimal meme format motif from the given motif data + */ +function motif_minimal_meme(motif) { + return motif_pspm(motif).as_meme({ + "with_header": true, + "with_pspm": true, + "with_pssm": false, + "version": data["version"], + "alphabet": dreme_alphabet, + "strands": (data.options.revcomp ? 2 : 1) + }); +} + +/* + * Fill in a template variable + */ +function set_tvar(template, tvar, value) { + var node; + node = find_child(template, tvar); + if (node === null) { + throw new Error("Template does not contain variable " + tvar); + } + node.innerHTML = ""; + if (typeof value !== "object") { + node.appendChild(document.createTextNode(value)); + } else { + node.appendChild(value); + } +} + +/* + * Make a canvas with the motif logo drawn on it. + */ +function make_logo(motif, height, rc) { + var pspm = new Pspm(motif["pwm"]); + if (rc) pspm = pspm.copy().reverse_complement(dreme_alphabet); + var logo = new Logo(dreme_alphabet); + logo.add_pspm(pspm, 0); + var canvas = document.createElement('canvas'); + canvas.height = height; + canvas.width = 0; + draw_logo_on_canvas(logo, canvas, false); + return canvas; +} + +/* + * Create a button designed to contain a single symbol + */ +function make_sym_btn(symbol, title, action) { + var box, sbox; + box = document.createElement("div"); + box.tabIndex = 0; + box.className = "sym_btn"; + sbox = document.createElement("span"); + if (typeof symbol == "string") { + sbox.appendChild(document.createTextNode(symbol)); + } else { + sbox.appendChild(symbol); + } + box.appendChild(sbox); + box.title = title; + box.addEventListener('click', action, false); + box.addEventListener('keydown', action, false); + return box; +} + +/* + * Create a pair of text spans with different classes. + * This is useful when using CSS to only display one of them. + */ +function text_pair(txt1, cls1, txt2, cls2) { + var container, part1, part2; + container = document.createElement("span"); + part1 = document.createElement("span"); + part1.appendChild(document.createTextNode(txt1)); + part1.className = cls1; + container.appendChild(part1); + part2 = document.createElement("span"); + part2.appendChild(document.createTextNode(txt2)); + part2.className = cls2; + container.appendChild(part2); + return container; +} + +/* + * Make a colourised sequence. + */ +function make_seq(seq) { + var i, j, letter, lbox, sbox; + sbox = document.createElement("span"); + for (i = 0; i < seq.length; i = j) { + letter = seq.charAt(i); + for (j = i+1; j < seq.length; j++) { + if (seq.charAt(j) !== letter) { + break; + } + } + lbox = document.createElement("span"); + lbox.style.color = dreme_alphabet.get_colour(dreme_alphabet.get_index(letter)); + lbox.appendChild(document.createTextNode(seq.substring(i, j))); + sbox.appendChild(lbox); + } + return sbox; +} + +/* + * Create a description element taking into account the newlines in the source text. + */ +function make_description(text) { + var i, j, lines, p; + var container = document.createElement("div"); + var paragraphs = text.split(/\n\n+/); + for (i = 0; i < paragraphs.length; i++) { + lines = paragraphs[i].split(/\n/); + p = document.createElement("p"); + p.appendChild(document.createTextNode(lines[0])); + for (j = 1; j < lines.length; j++) { + p.appendChild(document.createElement("br")); + p.appendChild(document.createTextNode(lines[j])); + } + container.appendChild(p); + } + return container; +} + +/* + * Make the table header for the discovered motifs. + */ +function make_motif_header() { + var row = document.createElement("tr"); + add_text_header_cell(row, "", "", "motif_ordinal"); + add_text_header_cell(row, "Motif", "pop_motifs_word", "motif_word"); + add_text_header_cell(row, "Logo", "pop_motifs_logo", "motif_logo"); + if (data.options.revcomp) { + add_text_header_cell(row, "RC Logo", "pop_motifs_rc_logo", "motif_logo"); + } + add_text_header_cell(row, "E-value", "pop_motifs_evalue", "motif_evalue"); + add_text_header_cell(row, "Unerased E-value", "pop_motifs_uevalue", "motif_evalue"); + add_text_header_cell(row, "More", "pop_more", "motif_more"); + add_text_header_cell(row, "Submit/Download", "pop_submit_dl", "motif_submit"); + row.className = "more"; + return row; +} + +/* + * Make a compact motif summary row for the discovered motifs. + */ +function make_motif_row(tbody, ordinal, motif) { + var row = document.createElement("tr"); + add_text_cell(row, "" + ordinal + ".", "motif_ordinal"); + add_text_cell(row, motif["id"], "motif_word"); + add_cell(row, make_logo(motif, 50, false), "motif_logo"); + if (data.options.revcomp) { + add_cell(row, make_logo(motif, 50, true), "motif_logo"); + } + add_text_cell(row, motif["evalue"], "motif_evalue"); + add_text_cell(row, motif["unerased_evalue"], "motif_evalue"); + add_cell(row, make_sym_btn(text_pair("\u21A7", "less", "\u21A5", "more"), "Show more information.", function(e) { toggle_class(tbody, "collapsed"); }, "\u21A5", ""), "motif_more"); + add_cell(row, make_sym_btn("\u21E2", "Submit the motif to another MEME Suite program or download it.", function(e) { action_show_outpop(e, ordinal); }), "motif_submit"); + return row; +} + +/* + * Make a sortable table of enriched matching rows. + */ +function make_motif_words(motif) { + var row, i, match; + var table = document.createElement("table"); + var thead = document.createElement("thead"); + row = document.createElement("tr"); + add_text_header_cell(row, "Word", "pop_match_word", "match_word", function(e) {sort_table(this, compare_words);}); + add_text_header_cell(row, "Positives", "pop_match_pos", "match_count", function(e) {sort_table(this, compare_counts);}); + add_text_header_cell(row, "Negatives", "pop_match_neg", "match_count", function(e) {sort_table(this, compare_counts);}); + add_text_header_cell(row, "P-value", "pop_match_pval", "match_evalue", function(e) {sort_table(this, compare_evalues);}); + add_text_header_cell(row, "E-value", "pop_match_eval", "match_evalue", function(e) {sort_table(this, compare_evalues);}); + thead.appendChild(row); + table.appendChild(thead); + var tbody = document.createElement("tbody"); + for (i = 0; i < motif.matches.length; i++) { + match = motif.matches[i]; + row = document.createElement("tr"); + add_cell(row, make_seq(match.seq), "match_word"); + add_text_cell(row, match.p + " / " + data.sequence_db.count, "match_count"); + add_text_cell(row, match.n + " / " + data.control_db.count, "match_count"); + add_text_cell(row, match.pvalue, "match_evalue"); + add_text_cell(row, match.evalue, "match_evalue"); + tbody.appendChild(row); + } + table.appendChild(tbody); + return table; +} + +/* + * Make an expanded view of a discovered motif. + */ +function make_motif_exp(tbody, ordinal, motif) { + "use strict"; + var box, pspm, logo_box; + box = $("tmpl_motif_expanded").cloneNode(true); + toggle_class(box, "template", false); + box.id = ""; + find_child(box, "tvar_logo").appendChild(make_logo(motif, 150, false)); + if (data.options.revcomp) { + find_child(box, "tvar_rclogo").appendChild(make_logo(motif, 150, true)); + } + set_tvar(box, "tvar_p", motif["p"]); + set_tvar(box, "tvar_p_total", data.sequence_db.count); + set_tvar(box, "tvar_n", motif["n"]); + set_tvar(box, "tvar_n_total", data.control_db.count); + set_tvar(box, "tvar_pvalue", motif["pvalue"]); + set_tvar(box, "tvar_evalue", motif["evalue"]); + set_tvar(box, "tvar_uevalue", motif["unerased_evalue"]); + set_tvar(box, "tvar_words", make_motif_words(motif)); + var cell = document.createElement("td"); + cell.colSpan = 8; + cell.appendChild(box); + var row = document.createElement("tr"); + row.className = "more"; + row.appendChild(cell); + return row; +} + +/* + * Convert a string containing a scientific number into the log of that number + * without having an intermediate representation of the number. + * This is intended to avoid underflow problems with the tiny evalues that + * MEME and DREME can create. + */ +function sci2log(scinum) { + "use strict"; + var ev_re, match, sig, exp; + ev_re = /^(.*)e(.*)$/; + if (match = ev_re.exec(scinum)) { + sig = parseFloat(match[1]); + exp = parseInt(match[2]); + return Math.log(sig) + (exp * Math.log(10)); + } + return 0; +} + +/* + * Create a table of discovered motifs. A fresh table body is used for each + * motif to make hiding/showing rows with css easier. + */ +function make_motifs() { + "use strict"; + var i, row, tbody, motif, ordinal; + // make the motifs table + var container = $("motifs"); + container.innerHTML = ""; // clear content + var table = document.createElement("table"); + // add a header that is always shown + var thead = document.createElement("thead"); + thead.appendChild(make_motif_header()); + table.appendChild(thead); + for (i = 0; i < data.motifs.length; i++) { + ordinal = i + 1; + motif = data.motifs[i]; + tbody = document.createElement("tbody"); + tbody.className = "collapsed"; + tbody.appendChild(make_motif_row(tbody, ordinal, motif)); + tbody.appendChild(make_motif_exp(tbody, ordinal, motif)); + // create a following header for every row except the last one + if ((i + 1) < data.motifs.length) tbody.appendChild(make_motif_header()); + table.appendChild(tbody); + } + container.appendChild(table); +} + +/* + * Create a table showing all the alphabet symbols, their names and frequencies. + */ +function make_alpha_bg(alph, freqs) { + function colour_symbol(index) { + var span = document.createElement("span"); + span.appendChild(document.createTextNode(alph.get_symbol(index))); + span.style.color = alph.get_colour(index); + span.className = "alpha_symbol"; + return span; + } + var table, thead, tbody, row, th, span, i; + // create table + table = document.createElement("table"); + table.className = "inputs"; + // create header + thead = document.createElement("thead"); + table.appendChild(thead); + row = thead.insertRow(thead.rows.length); + if (alph.has_complement()) { + add_text_header_cell(row, "Name", "pop_alph_name"); + add_text_header_cell(row, "Bg.", "pop_alph_control"); + add_text_header_cell(row, ""); + add_text_header_cell(row, ""); + add_text_header_cell(row, ""); + add_text_header_cell(row, "Bg.", "pop_alph_control"); + add_text_header_cell(row, "Name", "pop_alph_name"); + } else { + add_text_header_cell(row, ""); + add_text_header_cell(row, "Name", "pop_alph_name"); + add_text_header_cell(row, "Bg.", "pop_alph_control"); + } + // add alphabet entries + tbody = document.createElement("tbody"); + table.appendChild(tbody); + if (alph.has_complement()) { + for (i = 0; i < alph.get_size_core(); i++) { + var c = alph.get_complement(i); + if (i > c) continue; + row = tbody.insertRow(tbody.rows.length); + add_text_cell(row, alph.get_name(i)); + add_text_cell(row, "" + freqs[i].toFixed(3)); + add_cell(row, colour_symbol(i)); + add_text_cell(row, "~"); + add_cell(row, colour_symbol(c)); + add_text_cell(row, "" + freqs[c].toFixed(3)); + add_text_cell(row, alph.get_name(c)); + } + } else { + for (i = 0; i < alph.get_size_core(); i++) { + row = tbody.insertRow(tbody.rows.length); + add_cell(row, colour_symbol(i)); + add_text_cell(row, alph.get_name(i)); + add_text_cell(row, "" + freqs[i].toFixed(3)); + } + } + return table; +} + +/* + * Updates the format download text in the popup. + * This is called when either the format or current motif changes. + */ +function update_outpop_format(index) { + var motif = data.motifs[index]; + var fn = [motif_count_matrix, motif_prob_matrix, motif_minimal_meme]; + var suffix = ["_counts.txt", "_freqs.txt", ".meme"]; + var format = parseInt($("text_format").value); + var text = fn[format](motif); + prepare_download(text, "text/plain", motif.id + suffix[format], $("outpop_text_dl")); + $("outpop_text").value = text; +} + +/* + * Updates the motif logos and format download text in the popup. + * This is called whenever the current motif changes. + */ +function update_outpop_motif(index) { + "use strict"; + var motifs, motif, pspm, logo, canvas, num; + motifs = data["motifs"]; + if (index < 0 || index >= motifs.length) {return;} + current_motif = index; + motif = motifs[index]; + pspm = new Pspm(motif["pwm"]); + logo = new Logo(dreme_alphabet, ""); + logo.add_pspm(pspm, 0); + canvas = $("outpop_logo"); + canvas.width = canvas.width; // clear canvas + draw_logo_on_canvas(logo, canvas, false); + canvas = $("outpop_logo_rc"); + canvas.width = canvas.width; // clear rc canvas + if (data.options.revcomp) { + pspm.reverse_complement(dreme_alphabet); + logo = new Logo(dreme_alphabet, ""); + logo.add_pspm(pspm, 0); + draw_logo_on_canvas(logo, canvas, false); + } + num = $("outpop_num"); + num.innerHTML = ""; + num.appendChild(document.createTextNode("" + (index + 1))); + update_outpop_format(index); +} + + +/* + * Initialise and display the download popup. + */ +function action_show_outpop(e, ordinal) { + "use strict"; + function init() { + "use strict"; + var close_btn, next_btn, prev_btn, cancel_btn, do_btn; + var tab1, tab2, tab3; + var pnl1, pnl2, pnl3; + var format_list; + var tbl_submit, inputs, i, default_prog; + close_btn = $("outpop_close"); + close_btn.addEventListener("click", action_hide_outpop, false); + close_btn.addEventListener("keydown", action_hide_outpop, false); + next_btn = $("outpop_next"); + next_btn.addEventListener("click", action_outpop_next, false); + next_btn.addEventListener("keydown", action_outpop_next, false); + prev_btn = $("outpop_prev"); + prev_btn.addEventListener("click", action_outpop_prev, false); + prev_btn.addEventListener("keydown", action_outpop_prev, false); + cancel_btn = $("outpop_cancel"); + cancel_btn.addEventListener("click", action_hide_outpop, false); + do_btn = $("outpop_do"); + do_btn.addEventListener("click", action_outpop_submit, false); + tab1 = $("outpop_tab_1"); + tab1.tabIndex = 0; + tab1.addEventListener("click", action_outpop_tab, false); + tab1.addEventListener("keydown", action_outpop_tab, false); + tab2 = $("outpop_tab_2"); + tab2.tabIndex = 0; + tab2.addEventListener("click", action_outpop_tab, false); + tab2.addEventListener("keydown", action_outpop_tab, false); + tab3 = $("outpop_tab_3"); + tab3.tabIndex = 0; + tab3.addEventListener("click", action_outpop_tab, false); + tab3.addEventListener("keydown", action_outpop_tab, false); + pnl1 = $("outpop_pnl_1"); + pnl2 = $("outpop_pnl_2"); + pnl3 = $("outpop_pnl_3"); + toggle_class(tab1, "activeTab", true); + toggle_class(tab2, "activeTab", false); + toggle_class(tab3, "activeTab", false); + pnl1.style.display = "block"; + pnl2.style.display = "none"; + pnl3.style.display = "none"; + format_list = $("text_format"); + format_list.addEventListener("change", action_outpop_format, false); + // setup program selection + tbl_submit = $("programs"); + // when not dna, hide the inputs for programs that require dna motifs + toggle_class(tbl_submit, "alphabet_dna", dreme_alphabet.has_complement());//TODO FIXME alphabet_dna is a bad name for a field when allowing custom alphabets + // add a click listener for the radio buttons + inputs = tbl_submit.querySelectorAll("input[type='radio']"); + for (i = 0; i < inputs.length; i++) { + inputs[i].addEventListener("click", action_outpop_program, false); + } + // ensure that a default program option is selected for DNA and Protein + default_prog = document.getElementById(dreme_alphabet.has_complement() ? "submit_tomtom" : "submit_fimo"); + default_prog.checked = true; + action_outpop_program.call(default_prog); + // disable reverse-complement when not DNA + $("logo_rc_option").disabled = !dreme_alphabet.has_complement(); + // set errorbars on when ssc is on + $("logo_ssc").addEventListener("change", action_outpop_ssc, false); + } + // store the focused element + action_hide_outpop.last_active = document.activeElement; + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + // hide the help popup + help_popup(); + // on first load initilize the popup + if (!action_show_outpop.ready) { + init(); + action_show_outpop.ready = true; + } + update_outpop_motif(ordinal - 1); + // display the download popup + $("grey_out_page").style.display = "block"; + $("download").style.display = "block"; + $("outpop_close").focus(); +} + +/* + * Hide the download popup. + */ +function action_hide_outpop(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + $("download").style.display = "none"; + $("grey_out_page").style.display = "none"; + if (typeof action_hide_outpop.last_active !== "undefined") { + action_hide_outpop.last_active.focus(); + } +} + +/* + * Show the next motif in the download popup. + */ +function action_outpop_next(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + update_outpop_motif(current_motif + 1); +} + +/* + * Show the previous motif in the download popup. + */ +function action_outpop_prev(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + update_outpop_motif(current_motif - 1); +} + +/* + * Highlight the selected row in the program list. + */ +function action_outpop_program() { + "use strict"; + var table, tr, rows, i; + tr = find_parent_tag(this, "TR"); + table = find_parent_tag(tr, "TABLE"); + rows = table.querySelectorAll("tr"); + for (i = 0; i < rows.length; i++) { + toggle_class(rows[i], "selected", rows[i] === tr); + } +} + +/* + * Enable error bars when small sample correction is enabled. + */ +function action_outpop_ssc() { + "use strict"; + $("logo_err").value = $("logo_ssc").value; +} + +/* + * Submit the motif to the selected program. + */ +function action_outpop_submit(e) { + "use strict"; + var form, input, program, motifs; + // find out which program is selected + var radios, i; + radios = document.getElementsByName("program"); + program = "fimo"; // default to fimo, since it works with all alphabet types + for (i = 0; i < radios.length; i++) { + if (radios[i].checked) program = radios[i].value; + } + + motifs = motif_minimal_meme(data.motifs[current_motif]); + form = document.createElement("form"); + form.setAttribute("method", "post"); + form.setAttribute("action", site_url + "/tools/" + program); + + input = document.createElement("input"); + input.setAttribute("type", "hidden"); + input.setAttribute("name", "motifs_embed"); + input.setAttribute("value", motifs); + form.appendChild(input); + + document.body.appendChild(form); + form.submit(); + document.body.removeChild(form); +} + +/* + * Download the format text. + * Wire the link containing the data URI text to a download button so it looks + * the same as the server submit stuff. + */ +function action_outpop_download_motif(e) { + $("outpop_text_dl").click(); +} + +/* + * Download the motif logo. + * The EPS format can be calculated locally in Javascript + */ +function action_outpop_download_logo(e) { + "use strict"; + var pspm, logo, eps; + var logo_rc, logo_ssc, logo_width, logo_height; + var motif = data.motifs[current_motif]; + if ($("logo_format").value == "0") { // EPS + logo_rc = ($("logo_rc").value == "1"); + logo_ssc = ($("logo_ssc").value == "1"); + logo_width = parseFloat($("logo_width").value); + if (isNaN(logo_width) || !isFinite(logo_width) || logo_width <= 0) logo_width = null; + logo_height = parseFloat($("logo_height").value); + if (isNaN(logo_height) || !isFinite(logo_height) || logo_height <= 0) logo_height = null; + // create a PSPM from the motif + pspm = motif_pspm(motif); + if (logo_rc) pspm.reverse_complement(dreme_alphabet); + logo = new Logo(dreme_alphabet); + logo.add_pspm(pspm, 0); + eps = logo.as_eps({"ssc": logo_ssc, "logo_width": logo_width, "logo_height": logo_height}); + prepare_download(eps, "application/postscript", motif.id + ".eps"); + } else { + $("logo_motifs").value = motif_minimal_meme(motif); + $("logo_form").submit(); + } +} + +/* + * Change the selected tab in the download popup. + */ +function action_outpop_tab(e) { + "use strict"; + var tab1, tab2, tab3, pnl1, pnl2, pnl3, do_btn; + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + tab1 = $("outpop_tab_1"); + tab2 = $("outpop_tab_2"); + tab3 = $("outpop_tab_3"); + pnl1 = $("outpop_pnl_1"); + pnl2 = $("outpop_pnl_2"); + pnl3 = $("outpop_pnl_3"); + do_btn = $("outpop_do"); + + toggle_class(tab1, "activeTab", (this === tab1)); + toggle_class(tab2, "activeTab", (this === tab2)); + toggle_class(tab3, "activeTab", (this === tab3)); + pnl1.style.display = ((this === tab1) ? "block" : "none"); + pnl2.style.display = ((this === tab2) ? "block" : "none"); + pnl3.style.display = ((this === tab3) ? "block" : "none"); + do_btn.value = ((this === tab1) ? "Submit" : "Download"); + do_btn.removeEventListener("click", action_outpop_submit, false); + do_btn.removeEventListener("click", action_outpop_download_logo, false); + do_btn.removeEventListener("click", action_outpop_download_motif, false); + if (this === tab1) { + do_btn.addEventListener("click", action_outpop_submit, false); + } else if (this === tab2) { + do_btn.addEventListener("click", action_outpop_download_motif, false); + } else { + do_btn.addEventListener("click", action_outpop_download_logo, false); + } +} + +/* + * Update the text in the download format popup. + */ +function action_outpop_format() { + update_outpop_format(current_motif); +} + +/* + * Find all text nodes in the given container. + */ +function text_nodes(container) { + var textNodes = []; + var stack = [container]; + // depth first search to maintain ordering when flattened + while (stack.length > 0) { + var node = stack.pop(); + if (node.nodeType == Node.TEXT_NODE) { + textNodes.push(node); + } else { + for (var i = node.childNodes.length-1; i >= 0; i--) { + stack.push(node.childNodes[i]); + } + } + } + return textNodes; +} + +/* + * Get the text out of a specific text node. + */ +function node_text(node) { + if (node === undefined) { + return ''; + } else if (node.textContent) { + return node.textContent; + } else if (node.innerText) { + return node.innerText; + } else { + return ''; + } +} + +/* + * Get the text contained within the element. + */ +function elem_text(elem, separator) { + if (separator === undefined) separator = ''; + return text_nodes(elem).map(node_text).join(separator); +} + +/* + * Sort all rows in the first table body based on the column of the given element and the comparison function. + * The sort is not very fast and is intended for small tables only. + */ +function sort_table(colEle, compare_function) { + //find the parent of colEle that is either a td or th + var i, j; + var cell = colEle; + while (true) { + if (cell == null) return; + if (cell.nodeType == Node.ELEMENT_NODE && + (cell.tagName.toLowerCase() == "td" || cell.tagName.toLowerCase() == "th")) { + break; + } + cell = cell.parentNode; + } + //find the parent of cell that is a tr + var row = cell; + while (true) { + if (row == null) return; + if (row.nodeType == Node.ELEMENT_NODE && row.tagName.toLowerCase() == "tr") { + break; + } + row = row.parentNode; + } + //find the parent of row that is a table + var table = row; + while (true) { + if (table == null) return; + if (table.nodeType == Node.ELEMENT_NODE && table.tagName.toLowerCase() == "table") { + break; + } + table = table.parentNode; + } + var column_index = cell.cellIndex; + // do a bubble sort, because the tables are so small it doesn't matter + var change; + var trs = table.tBodies[0].getElementsByTagName('tr'); + var already_sorted = true; + var reverse = false; + while (true) { + do { + change = false; + for (i = 0; i < trs.length -1; i++) { + var v1 = elem_text(trs[i].cells[column_index]); + var v2 = elem_text(trs[i+1].cells[column_index]); + if (reverse) { + var tmp = v1; + v1 = v2; + v2 = tmp; + } + if (compare_function(v1, v2) > 0) { + exchange(trs[i], trs[i+1], table); + change = true; + already_sorted = false; + trs = table.tBodies[0].getElementsByTagName('tr'); + } + } + } while (change); + if (reverse) break;// we've sorted twice so exit + if (!already_sorted) break;// sort did something so exit + // when it's sorted one way already then sort the opposite way + reverse = true; + } + // put arrows on the headers + var headers = table.tHead.getElementsByTagName('tr'); + for (i = 0; i < headers.length; i++) { + for (j = 0; j < headers[i].cells.length; j++) { + var cell = headers[i].cells[j]; + var arrows = cell.getElementsByClassName("sort_arrow"); + var arrow; + if (arrows.length == 0) { + arrow = document.createElement("span"); + arrow.className = "sort_arrow"; + cell.insertBefore(arrow, cell.firstChild); + } else { + arrow = arrows[0]; + } + arrow.innerHTML = ""; + if (j == column_index) { + arrow.appendChild(document.createTextNode(reverse ? "\u25B2" : "\u25BC")); + } + } + } +} + +/* + * Swap two rows in a table. + */ +function exchange(oRowI, oRowJ, oTable) { + var i = oRowI.rowIndex; + var j = oRowJ.rowIndex; + if (i == j+1) { + oTable.tBodies[0].insertBefore(oRowI, oRowJ); + } if (j == i+1) { + oTable.tBodies[0].insertBefore(oRowJ, oRowI); + } else { + var tmpNode = oTable.tBodies[0].replaceChild(oRowI, oRowJ); + if(typeof(oRowI) != "undefined") { + oTable.tBodies[0].insertBefore(tmpNode, oRowI); + } else { + oTable.appendChild(tmpNode); + } + } +} + +/* + * Compare two E-values which may be very small. + */ +function compare_evalues(v1, v2) { + var e1 = sci2log(v1); + var e2 = sci2log(v2); + if (e1 < e2) return -1; + else if (e1 > e2) return 1; + return 0; +} + +/* + * Compare two counts. + */ +function compare_counts(v1, v2) { + var re = /(\d+)\s*\/\s*\d+/; + var m1 = re.exec(v1); + var m2 = re.exec(v2); + if (m1 == null && m2 == null) return 0; + if (m1 == null) return -1; + if (m2 == null) return 1; + return parseInt(m2[1]) - parseInt(m1[1]); +} + +/* + * Compare two sequence words. + */ +function compare_words(v1, v2) { + return v1.localeCompare(v2); +} + + +</script> + <style> +/* The following is the content of meme.css */ +body { background-color:white; font-size: 12px; font-family: Verdana, Arial, Helvetica, sans-serif;} + +div.help { + display: inline-block; + margin: 0px; + padding: 0px; + width: 12px; + height: 13px; + cursor: pointer; + background-image: url(data:image/gif;base64,R0lGODlhDAANAIABANR0AP///yH5BAEAAAEALAAAAAAMAA0AAAIdhI8Xy22MIFgv1DttrrJ7mlGNNo4c+aFg6SQuUAAAOw==); +} + +div.help:hover { + background-image: url(data:image/gif;base64,R0lGODlhDAANAKEAANR0AP///9R0ANR0ACH+EUNyZWF0ZWQgd2l0aCBHSU1QACH5BAEAAAIALAAAAAAMAA0AAAIdDGynCe3PgoxONntvwqz2/z2K2ImjR0KhmSIZUgAAOw==); +} + +p.spaced { line-height: 1.8em;} + +span.citation { font-family: "Book Antiqua", "Palatino Linotype", serif; color: #004a4d;} + +p.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;} + +td.jump { font-size: 13px; color: #ffffff; background-color: #00666a; + font-family: Georgia, "Times New Roman", Times, serif;} + +a.jump { margin: 15px 0 0; font-style: normal; font-variant: small-caps; + font-weight: bolder; font-family: Georgia, "Times New Roman", Times, serif;} + +h2.mainh {font-size: 1.5em; font-style: normal; margin: 15px 0 0; + font-variant: small-caps; font-family: Georgia, "Times New Roman", Times, serif;} + +h2.line {border-bottom: 1px solid #CCCCCC; font-size: 1.5em; font-style: normal; + margin: 15px 0 0; padding-bottom: 3px; font-variant: small-caps; + font-family: Georgia, "Times New Roman", Times, serif;} + +h4 {border-bottom: 1px solid #CCCCCC; font-size: 1.2em; font-style: normal; + margin: 10px 0 0; padding-bottom: 3px; font-family: Georgia, "Times New Roman", Times, serif;} + +h5 {margin: 0px} + +a.help { font-size: 9px; font-style: normal; text-transform: uppercase; + font-family: Georgia, "Times New Roman", Times, serif;} + +div.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;} + +div.pad1 { margin: 10px 5px;} + +div.pad2 { margin: 25px 5px 5px;} +h2.pad2 { padding: 25px 5px 5px;} + +div.pad3 { padding: 5px 0px 10px 30px;} + +div.box { border: 2px solid #CCCCCC; padding:10px; overflow: hidden;} + +div.bar { border-left: 7px solid #00666a; padding:5px; margin-top:25px; } + +div.subsection {margin:25px 0px;} + +img {border:0px none;} + +th.majorth {text-align:left;} +th.minorth {font-weight:normal; text-align:left; width:8em; padding: 3px 0px;} +th.actionth {font-weight:normal; text-align:left;} + +.explain h5 {font-size:1em; margin-left: 1em;} + +div.doc {margin-left: 2em; margin-bottom: 3em;} + +th.trainingset { + border-bottom: thin dashed black; + font-weight:normal; + padding:0px 10px; +} +div.pop_content { + position:absolute; + z-index:50; + width:300px; + padding: 5px; + background: #E4ECEC; + font-size: 12px; + font-family: Arial; + border-style: double; + border-width: 3px; + border-color: #AA2244; + display:none; +} + +div.pop_content > *:first-child { + margin-top: 0px; +} + +div.pop_content h1, div.pop_content h2, div.pop_content h3, div.pop_content h4, +div.pop_content h5, div.pop_content h6, div.pop_content p { + margin: 0px; +} + +div.pop_content p + h1, div.pop_content p + h2, div.pop_content p + h3, +div.pop_content p + h4, div.pop_content p + h5, div.pop_content p + h6 { + margin-top: 5px; +} + +div.pop_content p + p { + margin-top: 5px; +} + +div.pop_content > *:last-child { + margin-bottom: 0px; +} + +div.pop_content div.pop_close { + /* old definition */ + float:right; + bottom: 0; +} + +div.pop_content span.pop_close, div.pop_content span.pop_back { + display: inline-block; + border: 2px outset #661429; + background-color: #CCC; + padding-left: 1px; + padding-right: 1px; + padding-top: 0px; + padding-bottom: 0px; + cursor: pointer; + color: #AA2244; /*#661429;*/ + font-weight: bold; +} + +div.pop_content span.pop_close:active, div.pop_content span.pop_back:active { + border-style: inset; +} + +div.pop_content span.pop_close { + float:right; + /*border: 2px outset #AA002B;*/ + /*color: #AA2244;*/ +} + +div.pop_content:not(.nested) .nested_only { + display: none; +} + +div.pop_back_sec { + margin-bottom: 5px; +} + +div.pop_close_sec { + margin-top: 5px; +} + +table.hide_advanced tr.advanced { + display: none; +} +span.show_more { + display: none; +} +table.hide_advanced span.show_more { + display: inline; +} +table.hide_advanced span.show_less { + display: none; +} + + +/***************************************************************************** + * Program logo styling + ****************************************************************************/ +div.prog_logo { + border-bottom: 0.25em solid #0f5f60; + height: 4.5em; + width: 24em; + display:inline-block; +} +div.prog_logo img { + float:left; + width: 4em; + border-style: none; + margin-right: 0.2em; +} +div.prog_logo h1, div.prog_logo h1:hover, div.prog_logo h1:active, div.prog_logo h1:visited { + margin:0; + padding:0; + font-family: Arial, Helvetica, sans-serif; + font-size: 3.2em; + line-height: 1em; + vertical-align: top; + display: block; + color: #026666; + letter-spacing: -0.06em; + text-shadow: 0.04em 0.06em 0.05em #666; +} +div.prog_logo h2, div.prog_logo h2:hover, div.prog_logo h2:active, div.prog_logo h2:visited { + display: block; + margin:0; + padding:0; + font-family: Helvetica, sans-serif; + font-size: 0.9em; + line-height: 1em; + letter-spacing: -0.06em; + color: black; +} + +div.big.prog_logo { + font-size: 18px; +} + +</style> + <style> +/* dreme output specific css */ +div.header { + position: relative; + overflow: hidden; + margin-top: 15px; + margin-bottom: 5px; + margin-right: 3px; + margin-left: 3px; +} +div.header > h2 { + font-size: 1.5em; + font-style: normal; + margin: 0; + font-variant: small-caps; + font-family: Georgia, "Times New Roman", Times, serif; +} +div.header > span { + position: absolute; + right: 0; + bottom: 0; +} + +div.template { + position: absolute; + z-index: 1; + left: 0; + top: 0; + visibility: hidden; +} + +div.sym_btn { + display:inline-block; + text-decoration: underline; + cursor: pointer; + font-size: 20px; + line-height:20px; + text-align: center; + width: 20px; + height: 20px; + color: blue; +} +div.sym_btn:hover { + color: white; + background-color: blue; +} + +div.sym_btn.positioned { + position: absolute; + top: 0px; +} + +div.box + div.box { + margin-top: 5px; +} + +th.motif_ordinal { + +} +td.motif_ordinal { + text-align: right; + padding-right: 10px; + font-weight: bold; + font-size: large; +} +th.motif_word { + padding-right: 10px; +} +td.motif_word { + font-size:15px; + font-family: 'Courier New', Courier, monospace; + padding-right: 10px; +} +th.motif_logo { + padding-right: 10px; +} +td.motif_logo { + padding-right: 10px; +} +th.motif_evalue { + text-align:right; + padding-right: 10px; +} +td.motif_evalue { + text-align: right; + white-space: nowrap; + padding-right: 20px; +} +th.motif_more { + padding: 0 5px; +} +td.motif_more { + text-align: center; + padding: 0 5px; +} +th.motif_submit { + padding: 0 5px; +} +td.motif_submit { + text-align: center; + padding: 0 5px; +} +th.match_word { + padding-right: 10px; +} +td.match_word { + padding-right: 10px; + font-weight: bold; + font-size: large; + font-family: 'Courier New', Courier, monospace; +} +th.match_evalue, th.match_count { + text-align: right; + padding-right: 10px; +} +td.match_evalue, td.match_count { + text-align: right; + white-space: nowrap; + padding-right: 20px; +} + +div.tabArea { + font-size: 80%; + font-weight: bold; +} + +.norc div.tabArea { + display: none; +} + +span.tab, span.tab:visited { + cursor: pointer; + color: #888; + background-color: #ddd; + border: 2px solid #ccc; + padding: 2px 1em; + text-decoration: none; +} +span.tab.middle { + border-left-width: 0px; +} +div.tabArea.base span.tab { + border-top-width: 0px; +} +div.tabArea.top span.tab { + border-bottom-width: 0px; +} + +span.tab:hover { + background-color: #bbb; + border-color: #bbb; + color: #666; +} +span.tab.activeTab, span.tab.activeTab:hover, span.tab.activeTab:visited { + background-color: white; + color: black; + cursor: default; +} +div.tabMain { + border: 2px solid #ccc; + background-color: white; + padding: 10px; +} +div.tabMain.base { + margin-top: 5px; + display: inline-block; + max-width: 98%; +} + +div.tabMain.top { + margin-bottom: 5px; +} + +div.grey_background { + position:fixed; + z-index: 8; + background-color: #000; + -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=50)"; + opacity: 0.5; + left: 0; + top: 0; + width: 100%; + height: 100%; +} + +div.popup_wrapper { + position:fixed; + z-index:9; + width:100%; + height:0; + top:50%; + left:0; +} + +div.popup { + width: 600px; + z-index:9; + margin-left: auto; + margin-right: auto; + padding: 5px; + background-color: #FFF; + border-style: double; + border-width: 5px; + border-color: #00666a; + position:relative; +} +div.close { + cursor: pointer; + border: 1px solid black; + width:15px; + height:15px; + line-height:15px; /* this causes vertical centering */ + text-align:center; + background-color:#FFF; + color:#000; + font-size:15px; + font-family:monospace; +} + +div.close:hover { + color:#FFF; + background-color:#000; +} + +div.navnum { + width:100%; + height:20px; + line-height:20px; + text-align:center; + font-size:medium; +} + +div.navarrow { + font-size: 30px; + text-decoration:none; + cursor: pointer; + -moz-user-select: none; + -webkit-user-select: none; + -ms-user-select: none; +} + +div.navarrow > span.inactive { + display: inline; +} +div.navarrow > span.active { + display: none; +} + +div.navarrow:hover > span.active { + display: inline; +} +div.navarrow:hover > span.inactive { + display: none; +} + +table.programs { + width: 100%; +} + +table.programs tr { + background-color: #EFE; +} + +table.programs tr.selected { + background-color: #262; + color: #FFF; +} + +table.programs tr.dna_only { + display: none; +} + +table.programs.alphabet_dna tr.dna_only { + display: table-row; +} + +table.inputs { + margin-top: 20px; + border-collapse:collapse; +} +table.inputs * td, table.inputs * th { + padding-left: 15px; + padding-right: 15px; + padding-top: 1px; + padding-bottom: 1px; +} + +/* program settings */ +span.strand_none, span.strand_given, span.strand_both { + display: none; +} +td.none span.strand_none, td.given span.strand_given, td.both span.strand_both { + display: inline; +} + +/* show the expanded motif only when the collapsed one is hidden */ +tbody *.less, tbody.collapsed *.more { + display: none; +} + +tbody.collapsed *.less { + display: inline; +} + +</style> + </head> + <body data-scrollpad="true"> + <!-- --> + <div id="grey_out_page" class="grey_background" style="display:none;"> + </div> + + <!-- Help popups --> + <div class="pop_content" id="pop_"> + <p>Help poup.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_motifs_word"> + <p> + The name of the motif uses the IUPAC codes for nucleotides which has + a different letter to represent each of the 15 possible combinations. + </p> + <p> + The name is itself a representation of the motif though the position + weight matrix is not directly equalivant as it is generated from the + sites found that matched the letters given in the name. + </p> + <p> + <a id="doc_alphabets_url" href="#"> + Read more about the MEME suite's use of the IUPAC alphabets. + </a> + <script>$("doc_alphabets_url").href = site_url + "/doc/alphabets.html";</script> + </p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_logo"> + <p>The logo of the motif.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_rc_logo"> + <p>The logo of the reverse complement motif.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_evalue"> + <p>The E-value is the enrichment p-value times the number of candidate + motifs tested.</p> + <p>The enrichment p-value is calculated using Fisher's Exact Test for + enrichment of the motif in the positive sequences.</p> + <p>Note that the counts used in Fisher's Exact Test are made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_uevalue"> + <p>The E-value of the motif calculated without erasing the sites of + previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_more"> + <p>Show more information on the motif.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_submit_dl"> + <p>Submit your motif to another MEME Suite program or download your motif.</p> + <h5>Supported Programs</h5> + <dl> + <dt>Tomtom</dt> + <dd>Tomtom is a tool for searching for similar known motifs. + </dd> + <dt>MAST</dt> + <dd>MAST is a tool for searching biological sequence databases for + sequences that contain one or more of a group of known motifs. + </dd> + <dt>FIMO</dt> + <dd>FIMO is a tool for searching biological sequence databases for + sequences that contain one or more known motifs. + </dd> + <dt>GOMO</dt> + <dd>GOMO is a tool for identifying possible roles (Gene Ontology + terms) for DNA binding motifs. + </dd> + <dt>SpaMo</dt> + <dd>SpaMo is a tool for inferring possible transcription factor + complexes by finding motifs with enriched spacings. + </dd> + </dl> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_positives"> + <p># positive sequences matching the motif / # positive sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_negatives"> + <p># negative sequences matching the motif / # negative sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_pvalue"> + <p>The p-value of Fisher's Exact Test for enrichment of the motif in + the positive sequences.</p> + <p>Note that the counts used in Fisher's Exact Test are made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_evalue"> + <p>The E-value is the motif p-value times the number of candidate motifs + tested.</p> + <p>Note that the p-value was calculated with counts made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_uevalue"> + <p>The E-value of the motif calculated without erasing the sites of + previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_word"> + <p>All words matching the motif whose uncorrected p-value is less than + <span id="help_add_pv_thresh"></span>.</p> + <script>$("help_add_pv_thresh").innerHTML = data.options.add_pv_thresh;</script> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_pos"> + <p># positive sequences with matches to the word / # positive sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_neg"> + <p># negative sequences with matches to the word / # negative sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_pval"> + <p>The p-value of Fisher's Exact Test for enrichment of the word in + the positive sequences.</p> + <p>Note that the counts used in Fisher's Exact Test are made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_eval"> + <p>The word p-value times the number of candidates tested.</p> + <p>Note that the p-value was calculated with counts made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_seq_source"> + <p>The sequence file used by DREME to find the motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_seq_alph"> + <p>The alphabet of the sequences.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_seq_count"> + <p>The count of the sequences.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_alph_name"> + <p>The name of the alphabet symbol.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_alph_control"> + <p>The frequency of the alphabet symbol in the control dataset.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <!-- templates --> + + <div class="template box expanded_motif" id="tmpl_motif_expanded"> + <div> + <span class="tvar_logo"></span> + <span class="tvar_rclogo"></span> + </div> + <h4>Details</h4> + <table class="details"> + <thead> + <tr> + <th class="match_count">Positives <div class="help" data-topic="pop_motif_positives"></div></th> + <th class="match_count">Negatives <div class="help" data-topic="pop_motif_negatives"></div></th> + <th class="match_evalue">P-value <div class="help" data-topic="pop_motif_pvalue"></div></th> + <th class="match_evalue">E-value <div class="help" data-topic="pop_motif_evalue"></div></th> + <th class="match_evalue">Unerased E-value <div class="help" data-topic="pop_motif_uevalue"></div></th> + </tr> + </thead> + <tbody> + <tr> + <td class="match_count"> + <span class="tvar_p"></span> / <span class="tvar_p_total"></span> + </td> + <td class="match_count"> + <span class="tvar_n"></span> / <span class="tvar_n_total"></span> + </td> + <td class="tvar_pvalue match_evalue"></td> + <td class="tvar_evalue match_evalue"></td> + <td class="tvar_uevalue match_evalue"></td> + </tr> + </tbody> + </table> + <h4>Enriched Matching Words</h4> + <div class="tvar_words"></div> + </div> + + + <div class="popup_wrapper"> + <div class="popup" style="display:none; top: -150px;" id="download"> + <div> + <div style="float:right; "> + <div id="outpop_close" class="close" tabindex="0">x</div> + </div> + <h2 class="mainh" style="margin:0; padding:0;">Submit or Download</h2> + <div style="clear:both"></div> + </div> + <div style="height:100px"> + <div style="float:right; width: 30px;"> + <div id="outpop_prev" class="navarrow" tabindex="0"> + <span class="inactive">⇧</span><span class="active">⬆</span> + </div> + <div id="outpop_num" class="navnum"></div> + <div id="outpop_next" class="navarrow" tabindex="0"> + <span class="inactive">⇩</span><span class="active">⬇</span> + </div> + </div> + <div id="logo_box" style="height: 100px; margin-right: 40px;"> + <canvas id="outpop_logo" height="100" width="250"></canvas> + <canvas id="outpop_logo_rc" height="100" width="250"></canvas> + </div> + </div> + <div> + <!-- tabs start --> + <div class="tabArea top"> + <span id="outpop_tab_1" class="tab">Submit Motif</span><span + id="outpop_tab_2" class="tab middle">Download Motif</span><span + id="outpop_tab_3" class="tab middle">Download Logo</span> + </div> + <div class="tabMain top"> + <!-- Submit to another program --> + <div id="outpop_pnl_1"> + <h4 class="compact">Submit to program</h4> + <table id="programs" class="programs"> + <tr class="dna_only"> + <td><input type="radio" name="program" value="tomtom" id="submit_tomtom"></td> + <td><label for="submit_tomtom">Tomtom</label></td> + <td><label for="submit_tomtom">Find similar motifs in + published libraries or a library you supply.</label></td> + </tr> + <tr> + <td><input type="radio" name="program" value="fimo" id="submit_fimo"></td> + <td><label for="submit_fimo">FIMO</label></td> + <td><label for="submit_fimo">Find motif occurrences in + sequence data.</label></td> + </tr> + <tr> + <td><input type="radio" name="program" value="mast" id="submit_mast"></td> + <td><label for="submit_mast">MAST</label></td> + <td><label for="submit_mast">Rank sequences by affinity to + groups of motifs.</label></td> + </tr> + <tr class="dna_only"> + <td><input type="radio" name="program" value="gomo" id="submit_gomo"></td> + <td><label for="submit_gomo">GOMo</label></td> + <td><label for="submit_gomo">Identify possible roles (Gene + Ontology terms) for motifs.</label></td> + </tr> + <tr class="dna_only"> + <td><input type="radio" name="program" value="spamo" id="submit_spamo"></td> + <td><label for="submit_spamo">SpaMo</label></td> + <td><label for="submit_spamo">Find other motifs that are + enriched at specific close spacings which might imply the existance of a complex.</label></td> + </tr> + </table> + </div> + <!-- download text format --> + <div id="outpop_pnl_2"> + <div> + <label for="text_format">Format:</label> + <select id="text_format"> + <option value="0">Count Matrix</option> + <option value="1">Probability Matrix</option> + <option value="2">Minimal MEME</option> + </select> + </div> + <textarea id="outpop_text" name="content" + style="width:99%; white-space: pre; word-wrap: normal; overflow-x: scroll;" + rows="8" readonly="readonly" wrap="off"></textarea> + <a id="outpop_text_dl" download="meme.txt" href=""></a> + </div> + <!-- download logo format --> + <div id="outpop_pnl_3"> + <form id="logo_form" method="post" action=""> + <script>$("logo_form").action = site_url + "/utilities/generate_logo";</script> + <input type="hidden" name="program" value="DREME"/> + <input type="hidden" id="logo_motifs" name="motifs" value=""/> + <table> + <tr> + <td><label for="logo_format">Format:</label></td> + <td> + <select id="logo_format" name="png"> + <option value="1">PNG (for web)</option> + <option value="0">EPS (for publication)</option> + </select> + </td> + </tr> + <tr> + <td><label for="logo_rc">Orientation:</label></td> + <td> + <select id="logo_rc" name="rc1"> + <option value="0">Normal</option> + <option value="1" id="logo_rc_option">Reverse Complement</option> + </select> + </td> + </tr> + <tr> + <td><label for="logo_ssc">Small Sample Correction:</label></td> + <td> + <input type="hidden" id="logo_err" name="errbars" value="0"/> + <select id="logo_ssc" name="ssc"> + <option value="0">Off</option> + <option value="1">On</option> + </select> + </td> + </tr> + <tr> + <td><label for="logo_width">Width:</label></td> + <td> + <input type="text" id="logo_width" size="4" placeholder="default" name="width"/> cm + </td> + </tr> + <tr> + <td><label for="logo_height">Height:</label></td> + <td> + <input type="text" id="logo_height" size="4" placeholder="default" name="height"/> cm + </td> + </tr> + </table> + </form> + </div> + <!-- Buttons --> + <div> + <div style="float:left;"> + <input type="button" id="outpop_do" value="Submit" /> + </div> + <div style="float:right;"> + <input id="outpop_cancel" type="button" value="Cancel" /> + </div> + <div style="clear:both;"></div> + </div> + </div> + </div> + </div> + </div> + + + + <!-- Page starts here --> + <div id="top" class="pad1"> + <div class="prog_logo big"> + <img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAIAAAACACAYAAADDPmHLAAAAAXNSR0IArs4c6QAAAAZiS0dEAP8A/wD/oL2nkwAAAAlwSFlzAAAPYQAAD2EBqD+naQAAAAd0SU1FB9wLGwYBMoyhiwgAACAASURBVHja7Z13fFRV9sC/503JpIeaKFVREBQVEEFFQVcUuyDouuraFoVV17IrayPjDP4U3XXXhrpiXxuKKF1dV8WCiEgXRUAQlJIYAilMf+f3x3szmVSSkICyOR/eh8wr9717z7mn3XPOhRZogRbYLQiQJiJGy1D8D0LHjh1/XrZsmQK9gU3Ap0mE0QL7KTx411136Z///GdV1ZhpmvrYY4+pqsZUVceNG6dAz5Zh2j/hnpKSEtM0TVVVrfq/qmosFtMxY8Yo8CPQHejucDjyfm0dbZFp1WGaxmJ3ppSWSiQUIhQKIWJxehGhpKSE1LQ0uvfowQHZ2exYt65D8dq1qzUaXR2LxTYCP7UM4a8MVFWA9mY0+nLhmjV63LHH6vMvvKATJkzQfn366CtPPKEDjjtOV61apeeedZZqMKgaCKju2KFmYaFqJKJaWqqqqoACR/9a+u5sQT+IiD77zDPbKCnR00aOZPHSpcydO5fLf/972rdvTzgcZsEnnzDmqquYPmsW/PxzxbMOB4NPOokRZ5+tB3XrJsAUYKmqOkQkVuVVKUBGDRbGz/vSvPlfBHcVDpB7XP/+Gz9/5x1mzJ/P1i1buPbaa1m/fj1du3alW5curPvqqxobCoVCpKSkIO3a1Wc89bCuBy51OZwu1RgiBqGYGf1uw09/Bd5t4QDNT+wKfPXoxIl9jzm6gkt/OmsWn3/4oRIMyrfLlzPuzjvp27cvHTt2ZNGXX+K/7baaW8zJITM1lflz5wL8ZtWqVWm9evXaVcv7Q2cN6hM68tAuR2MIhirFpUEef+MdBFK1RQQ0v6g/MC9PLxk5Uq+/7joIBECSJmwwKKqKR4RTTjyR0885h2effZaNa9Ywa9YstKQkoQzGwSwuJhwIwK5ddO3a9b+9evWqjQPoSf16qUOQles2gYLL5WDaBwu5dtSw8L/eeKdFB2huaJWTo0NOOMF8wOs1qiG/QhfghtGj+dMNN4DblhJlZVBaWg35AIYI7NgBbjcbNmwwjz766I+WLl16OfCDfUs3YB3AAdke6d7tYNR2Jv6wuZA2rbIwxbFPxfD/jBn4t7vv5uUnnzRsTNelEEIoBKWl1qH1YM7hMAXffWcsWbBgMLAB+AgoAtYC5SJCp86dUTPG89M/ACASi1mDH4u2+AH2Bvzhpps+p3Xrmi+mp2Oa5h613y4nh1WLFuHxeHTq1KmDVbWVqjJjxozU4cOH88rsj1FXKteMOh3D4eQ/ny/hjnwfn32zyWUYxtAWK6D54YW1X355WbcePSr32elk1EUX8cYbb1gzvvG+BEzA2b49msQ1RARVZe7cuTzzjwl079qB6R8s4PhThjF58mQADjroIDZs2CAtBLAXFMEaTwaDe4R8ALKzEbcbVUVVE4hP/t/lctGnTx9+c8op3HvffQm9YubMmZx77rlic2Rzbw7I/5oreNzJgwapqqI7dqA7d1pHSUnyVG5Uw0MGD6agoCCB7IQ+kcQFIpEIkydPZszYsQmuoaqEw2H95JNPdOHChTHgervJT4DTWzhA08OjwGWT7r8/u3xXhckei8W47c47obwcMjMtsy9OEHUojdhI/M2oUXwwb16dIqKqJVFaWkJmZlal60OGDJk7b968M1SVsWPH8uSTTxYC7WmBvQIbV6xcGQK0aM0a3bRsmW5fu1b1559NLSzUakdBgXXYawC7A0CXLVtW7fzMmTOrnTNNU03T1OXLl5u1ia4WaA4lQbXVmDFjcoFcIHfJ0qUXqKqaBQXVCMC0kZ+MtNogEAjoli1bar0ef/bee++tiXDMFszsQ+jbt+/r1111leqOHZWJIBBQ7913azgc1qaAeABCVUKqQgBvAO8BL7RgZu9xhd6nnnpqNLpzp8559VXVkhL9ZOZM/X79+j1Bdm1sP2KaZix+rqioSBctWqSqejPw2KhRo+IPxjp06KC0rOg2p82AkE8O4zkbiAJ6ySWXVJLRjUW2qmqrVq30+eefr3RrFWYQf4+pqjpq1Khq7zYMY4/0g5agxppgPCnARcC1GPRFSUF5gAn0VNVz69vMkiVLWLNmDRdeeGGt93Tu3JmNGzfu1slkGAZbt24lNze30jWHw4Fpmo3GYwv7SIY7GYKD8UA/INteQFaKEL7iqBNPPPHYhjTXp08f+vTpU+O1rVu38sc//pE5c+ZgmiaGUbtLJu5HqMNdfYXT6VwdjUY/b+EAdXm9DMNlmmYrAA/I6SKe6ao/JM38v2Pw52oPrgV9Seu06RugTzT62ZogNzeXbdu2ISIYhpFmmmagxRNYC7Gbptlnw5Il29Z/9dW2H1ev3jpddQPwQ79+/f5k32NNsSpStdeSXonZ99JLL+0RAkWEG2+8samUU7Zt2xb3KKppmptbREAd43Vwly5fdDniCLS42DoRDILb3fnRiRPzLzzrrIdVlX9MeoKCw36GSMUIpaWlJVh0UVHRHiPt4YcfbhqKruxyFiDUIsfrhpWAfjprlpplZVZUb1UHTyBgRfnGD1Xt0KlTvR0++xIcDodecMEFCvxDVXv/79nrM2lnzuAanUWdnV8InzocDu104IGqO3aY+vPPWqOrt7BQdds2jcRijTLzmsg5VO93RCyCNa+88kotKCgosTnC6f8rIkD/PGcsQ044AYAZL9XOgkdfdlnxibEYuzZvjkpOjrN1q1Yc1Llz4p4Lzz+fcePH21qBidMwGDhwIA8++CAn2O1XZcWjR4/mmmuuoX///k2ruIjw9ttvc/755+9enjudAGIYBu3atctUVXr16vXOqlWrOovIpv169pszeX/yP/9Z+0xOPqLRymy+yvHp7Nl61tChetbQoTpt6tRaF2x+qSLh6quvTvw9adIkE3hrw4YNjv3WDNSZDEZ5/6Hl9zhvGjsWzKZbOykH0tu2Tdjie9H9XCmYpCHPjR49mqeffjqZi5iq+jQwVkTM/c4MVCUfcM564y6u+8ufmxRRV1xxxb6xWUUSR0Ofa2clqdgSzOTVV181otHoNTNnzjxjv9MBzBl0EeUUNeD9e2Dkfc/z53xPnUGeN4wezcFHHlmvwX1j1iwAJk6cuNf7tmLFit16CavCww8/jMPhSHZ+sWDBAi688EL97W9/O0tVPSIS2m9EgDmda8XgSRRFKvqjigooQh85h+Xx819BaxO2nQ/ODGAjrA5A9WyeTA4kg1y2UCnO75cOJ510Eh9//HGN10aOHKmLFi2a98MPP5y834gAEYaikIx8+7wAhpr8oabnpgMvA5/Av4C+1Y5bWMRoIJUXBg0apL8G5KsqH3/8cY0iUFWZOnWqnHfeeUNUtcPeJoBUwFPHkdoYbqQ+BBiitYVMWYs57iqnYskv0trEoGlzjXGMX7du3R3RaNMlcDz55JN1c7VGKrFVg1DjiE++duutt6phGAtV1dhbBHBW6+zM0iM6tSkccFTPwv6HH1o44KiehUd0ap34PahPr0Kga4MJ4CjOUWgjUgvxKIiDc8yZpMVPReEkrZ/uk2hz69atr7344ot2i3sOY8aMqRXJt99+e40yf9q0aU2iRHbs2FEGDhx4wPr1689sbiXwcDEck3My044ePWKo4dRwRjQUILPtgZRt34rDeTCxWJSs1rk8PmUOKSkeCYWCDSR5OiXQpLYggLCCS8TCv0CmmBWELtDNThPeKZBdzzdtuPrqqyU1NVXPPPNMsrKyqs26hkJtil12dnaN7HvEiBEN1kPatGnD9OnTOe+88yqdnzRpkoiIpzk5wMnZGWkrhxxz+HG3XHRqqsPplPKyMlxZ7dkVCODMaEtZeRlpOe3419S5dOt8ANFYrDHy/5i4wocgKH9Xg0MFvkiewVolqNKexu+p5TFIq+/7fve733Wcm5PzStzbJyK43e4mHbjbbrutmgyvmmdQX+jatSu1ia4tW7asbS4O0Mntcn5wxx9GaUlJiQQiiivFQKNhHAaEy8pwuj1kt8njqTfepXvXA+nToyvzvlzZCK2HYxGsf8oKPNxunE5U3+Kv6uBdBI8qHlEOB76sLiBQA04GfPV840/dIPDEV1/dd5lhXP0TLAmrzveIyKlnnXV3z549uSknp/Qf27dnDh06lGHDhu2RLG+M4ygOmzZt4swzz+SCCy6o8f7PPvtsS3MRwPI22Zn61LT3JRwoQw0noIg4UP0Wp8uNwzAQEbp3PZDB/Xqxs2xXwzs8B6dGcNvs3BST2+V0ogAynI/N6SwTYYCCC8FTnQEkwNEwqYNDwbgZCoAPROSBL6CLMXv2rctmz85eC5suX7Yss3fv5lmMi0QiqGo1ziMiZGdns2LFCjp37kynTp3w+/01EoqtDJY0FwEEI6FAzgF5OQw6vi/ZuZ2qsDTFYRj4n5pKSXmAwcc0cqBCHC0ODrFlf1TdLK6CqWUKA5IxvhwkDCfsoSY3AHhCLQKIZ+x4gNgy0KOgpP9RR5kh1QNVVZrafEx28lRF7M6dO+vFXbZt2zYzLiKbRQfof2QvBg/sh5HZlrJdAcp2BSgPBO0jRFnAUvaGDuhNWKVR+XhacQiwQkJsq9RRk9fFVgvjKCgHUTjY/j0TCNOApItnraacWAUgNgI9kr4n8Hu4HejxCVwhIufbkT9ah07RoD5PmTIFwzBqVCDrS2hjxozh0ksvzW1WP4DGPTGqlO/4GTEMMGMJRBticGiXA4hEYxAO1J17V7sCmJpkq70vw6shsrwWV6fadPGFQkSg+6dW9a7dQtuK7glgSAXxuA3IFbgnaQhmPvroo2kvvviiTJkyhfnz51ebsa+++mqD+nzRRRdVUxAbsu6hqvztb3/ToqKi9LfeessNuJqFAFJcTsx4UqXhsIY8o03i7x+3FfH1uk10ymvbKOTbLP4uxEaFWb3CVtw5ZP9f0yw37OttU6mkI9QK7SALONh+7geFTp9bhHBI8jsdkGkTQeDyyy+XRy6++MCJQ4aQ4jJwuxy4nQYOw2DqM4/w6KOPNsi/EJ/p4XCYYDCIiDBz5sz6IF9FhKysLFHVZ4YPH74DiDQLAfxnwTI8bhcA6QceCmrCrh1JyFGcDgebC7ZbMe+N0XohB0BNtkuUFdUNapYqrBTlWnawIPnRKm8z+sHO+rzTsPP3HfCdAcUKrRwWAcTZglj0WNmpNV+15OgLYMLYU/nsoYP4+w0D6NPzIFYu/YqbLDEhDZ3NW7duZf369agq55xzTr0IZ+TIkfTs2fMqEflns4qAXcEQD7000+pQeBehcMTqY0paJXZkGILDYbDw63UYTkcjGQGFMrJ6oUXjZEKEOEHOZbJcTsy+1wW018revtKvbGKqr3SzxYgA6tiNFxFg1nhy+x4coaA0g+8Lc1mxqSsOw8CMmYrAIYcc8pWIMGHCBD744IN4mjGzZ8+u9UM6d+5Mz5496yP7TWDh+PHj5c0337z5m2++eS75YnNYAUuBYcUlZRTtLKNtNjhTMyAWhkAJVCm57zAMPl60ktRUD4FG+Nu1jjUEYxQlVe51A22A4hDsTIEihdxwPXUAJ7QywWXP9gKgvQluhSyjMmEkOqmzOBqTawpLiKalf+WcumQkaZ7VRCMRwsEyycnKCq9bt+4e4G2v1wswbs2aNfcfcsghnH322XsU26CqFBQUGHl5eZMsCca/apSDTQxnAEsNw+Bfb7yDw+nAiIYs5ljDfguC4HQ5oQEeOX2LTsDRtgqwraHjIrDhBNgKfA+kOmFIPblNOhADchXuAGKm1auOSRbJarGqh6PT6YPJuTj4dvgDrPv7zJNp3+pHwsEQS77bqNlpLkrLylxVfBEP9OvXL7t169bFzzzzTKMJIO4YysvLU9216wWgNRDYGwQAdrFkj8dj6WmGUaupVx4MIohCDXK8ts45SMewuJdq40usaoUdbzRABDgU3hZrrwBxWs/GrdJLgamAQ+dyACnI1PlDNslZW5Z/tvxC98at82MSLg+nOwkhEvnHy+8QicYEeDP5JSUlJSXFxcVnXH311Yfcd999DepTfJFpxIgRiAgbFi+Oh8gJtWnCzQBvJ3ynBdvrObkaKPs18aDRAIRrfcVHLc9nWRYoOTbCU0LWgpJD4Zn+VoiBiIGDCA+tWt/5xElPnb/11uzhOfD6tNUb1sy654XZcx+c8v5MPPpM4Q0l5yb67k36tnyuwcsaYN2bb7652lbidzvjwUpIFZFvZ8yY8U9AFi1bJpgmpw4e7Hn8iSfa7y0C2BFXmMLRmGUFZOVZXKBKR9I8KbYzr/khDVphKYJxKGggAXSsgWhjapmBAfueoKTQ86ftbd4cNvZv342KPtj3b/4FC4C/AOfbxygC/BGYjJerKymY+dyNn6fwsR1g8eLFh4kFNdr+yev9IsLAgQMBnjFN8xawah8RCjH12Wfd2dnZf9pbBHCl9U1JXj61TfHUrEZX4tpTiMJRgEcrMPiuzbu7NcDqSDYHDCzF0p0w5WBtaSDd3fGKDwdc1/rO464bt+kZbmRrjY35yQMW4+VBNNH0kYnr3sS5/r17917bt29fzjzzzER0kmmaiAiHdu/OgL59WfzBB0QikUqv+L/HHoNWrcjOztY/33jjnap6dnNbAYmPq8S2DAcYTUdvWuGTq7PAnzmdozEpM4azNsmMe99G5nr791H1fGerJCL4RKCvEzpbcSd8Y99jOohFx7cfNf/JS9Yu5C4b+V5yUcZWoiA/d+NjCV4mIVxGPjvwVzJJ7yGfUvxMXLly5aH2uRduvfXW30+bNo1Vq1bN9Hg8Zxd8842069TJKoAdDlf65uVLl743b/bsUwcff7zx1xtvVBE5CpjV7ARAJbepQGlBHaK+gSqA4BZLoIeBGnOAzHcRCeJVAy9wElbd3jgU1TyhdwuH2Q+8HYMrndaagClgKBTbDao4gtnzTlr93YZ/sslm688AF+InM2l2tyKfAEIaPo7HyybCDALgrwzEzTx8pPR6rJesYlXyN1z+97///fKMjAyXx+OJANF2HTo4CNSaFX76I5Mn6+Djj+emcePkhWnTzli6ePH/NbcIALghMcBij7DhqHGkXbYTyOPxXFw/9sJVGveKhqkWSWK+TT8JsdJGfk1UmdKYDomle84Pw4VRCKj1uyPQmQo38I8pMe75eGqSVePnanxJyAfwUYyfVOAa+3enj679aMW9H99bFLwn+Ln6NWKapq66flWNxFlWVhZpqNiipIQ+3bufoKr/anYCcDqdyypZ+6oEgoGqwbuEI1Fuu/J8cjLTFOhUrw4ZpCS5X6uy/KEYzEfoJdVV/Y72gMQX0x0NHIc0gc3HQ2SQlXi5zrAcLO74esMxML8//LsBQ/U1+TyOFx3yxJCH7njjjpM9Lo+ISIZhGPVhjY7vvv66Tg722cKF4HKBKrfecIOKyEnNTgAulyvJTWmha9eW7xEUl9NRKcwpHImi2mCTrDboIVW2hEl65veSNCkUFoiFyH71fGc/S5dMNBKxiSgSg28bOVSfIUxC+fCREY+s59GKHIZ6Qu+1dRealq0FBectWLBAAXr26SM9DjnksCVLlvTdGzoAYhgEy3bgycgmvU0eGijhgHatq/mw60fsu9ccpGK5tyZiidp/L7bPXwakaP11ALcJHye1G8WS/+4YBBs1QD4U+Bo45U/+PzXK9e5yuSq6XD3aWIEZp40cKSUbNyrl5fLa5Mn06dMnrVk5gL0Vm+XtKy4EEVLSMkGEDZsLKsKi7aybmy85m2CwYWOoDSeUDvbfZQthmgF3S8NCvdVIcqfO5oznT2POfxww5Xj4jn0Dg6KRSJyd0uGgg2q8qbSs7IzNP/0ksViMjPR0Jk+e3LwcQERmqypqmrTueDCoJpb+K0W0CIgKu4JNU91E6yYE077+qgGt1FoXkPrQ0nJwhaBrhUqxsN/duLIBTz+YyL6DBWaSuR0Oh2vMZDZEPuzQu3eJqmYempe3CXikua2ADBGxAkOo0AUioSrmSkome6sWssI2+0vi9nz8w7IWWG7eWmGXpVekAz/Cyr5geCD2M5hL+IWAmiaFRUU1LiCZqiERWSYiAaDL3jADUVW6dcy1RlmsSOBoMgGoWg6iRkYFST3PKbDQ0tYHUF0/UIEsl4XcOtcRBCKTuMYNWg6aB/IK9Iv9UghARKo5gqrg46SsrKz2e8MVXAnHoJDexqbS5HAMgWBZk7J7Tfo/mfdErb46arLt6/MuAzmojPSVU7i4OwT7gsyDfr+oqlyqWrHbWS1QUlJSvldcwTWlMZmmSVp2a3YW7UiSylEUSE9NaeIPoFwAFdJFCRh7mAp/LLo5j9e+DZAxEPgDHFP6S0G8y+UCtxsxDFrl5OAwjB9i9UwwbRYCSE1NTVFV0jzuauxZq85XO7Pz+Rkf4XanEA7Xf1JJ7d66dUQZpk7mohyCtQCkdbUT3s1YCItag7YB9wg4KvhLmvnDkmoR2/L/jfo+21wi4OGYaeqNvzuLmGnaYeL2QDprZlE/7yhtsC9Aa+7RQkyOM0awNp4cqyYxo3osQPJvtxN+U/fbytdD/zN/aciPm9zxgwZyuuYiAAUkGAoTLN2BiAFlRVbwlMOdUFhcTme1Ldb2WBE6h4XG+RRW0gOcGAYcYfdXbeSLwncmPG/fuxsZNHj3PNXLoc2K6b9wYigSupwbGNug527nZrxMx8uBe4sAKsynnUVWSFgSbYgITofBh4u+xu1qvBTanQEvlf9ok6R6isKiGBzeiJjCuuD4ZhvIfN7DyTtRjT6vj+gk7iJGvrUEXQdBtsPL53qvrsbHefjYvNcJoE3nQzFj8awgC11tsjO57OzB/PDTNis82jSJRmON4TMOcXNCXaZbTQShMMMJJw5M8utT+e+KJmJEGvBF/ya/0rJz04Gf05hIevq49C4dHuwgOkEnTr94+pXG3UYxXsprQH4PrEDQITEz1mGvKoGVNP9YLCGI4/hwuxw899qHiQCRcCRK6a5Ag6phYWn4DkyOISnAIXFtFjlqkpcsEW1q+MgDI3tXlIOOV1o+A3im0uRQbuGeKtE8Xt6ASkEoG/BhpeH6MPEyGS95+GqJAtpTeIiNm9kssk3ye3ftfT3wb5SX8PIZJrOZwL3cxFCUTvh5FqB/Xv8ruZNcHDyBn6K9SgAJuW6HhyngcDj3SN5rZQO+ZtYRpZc4yNDqzy5OQj6KpS9QOd4PDCbhY2MVNjwNHyOqEMQBeNmAcjF+PsdysZ6FFR3cfJDKSyu2rTDwsxYvxUC7Nultvp7749z/e+ubt7hv6H3xYNO3T+t2WtclY5fcszeVwKpmScULDQc7Nm+o17NL4IAaiUoxRHfLHQ6KZ2mQTlShVy3WY827bFRFvsWGR9Rw3xZ8dMXP53h5Dx8BlEnNrvr7+R5hjv0NrVCuL7qtqMexHY+VNFcaqvoR+UTxcf7EoRPz97YVUAnh5TsqZ25Z6wG1Y3ARdPsSvozC+Fq8iy8ma/k1EolB3wSq04hRS9yfNOVChDKKfD7GT64d5CE1yOamLBjQm3y+sAniIfJR8vnD+Nnjh8pd0gc/zqlfTxXqSH5tdgIQh5NYknPHNGO07nCQlRHkMFizcUul+7+EEQrLgWMEMudXDuOOY62Iiiz002tBRq5URnQ8O2JHLZ/q+XRPRaKfnfg5iXyOAYIog2v4rqvx8h7eSvpG48BHCD8D8NolboQr8PM0afyH/yP7uSXP6cjDR6qIPLbPCKDs581ktM2rpIkbTjfZGWm4nE4Wrfo+ce30aPQ0gdelIk1suLPCfKvNDGxXTfGciaHKwBruj5kwt5bmfmoSVuAlHcGNn1uQJI+cl1S8BPDzND5Ow5fIB2gKOAkvgo8X8LIVH4KXdVf2uVLI54p94QhKhP6nt26PiGHrAla9gFgsyvUXDSMQDNOv18EJVt5F9US1F2xs5LqB3+7GE5ii06tk95aSJkJ2LSKiqkNnrcIcAy48sWZTsKGzshyYZn/gNXjJJp8XUVrjs4paNDn4OBl4CC9ulP72uW54KUCYXdejzWYFHNyhPSJimYGGEzSGQ6Ns27KJtq1y2BUKgcbo0eVAAqEwrbMyMIp3uqtYbS7g8M/BcVwVbV8FEUUx6KIx+gIfJC5mcCbQVuIpRy5q3WHTgMIoXNKPKra0lwwUL5L0XqsYXVHco4iSDfyIn8cT8t0K8boLL0OB2cBDwN0Im5uV1fqI70S1KencbncdbzYC2Fq0w1oRVAVPBlq+nSlzP+LIzq1p1+aYRKZQLFEfUCv7kSvs80tdcC8VSRyIEFOTXRikq5WVcYr5Jh8aF6Dm2xgoN2Hlo/5HlFOD82kLdsx9FehnvW5HFXOvLVao9yuAQRTFQRQoRVmAUGqXoC0CnHgZh9IJpTtesvDxNF6eQ/Hhr+Id9HIYVuyBAEvwsU/jCZptLSAQClcIanEQDEdZvbmYEjMlYRq63W6m/OdzAqEwRTvLksmgIMlec8bssiwJ2Mk6YGVivV8ZKS477l7JQ+hjhyGEENAwTir0it33WSgGvkH4FlhVMr4kHViG8D1CayAHP53x0wc/vfHRFZgBPAisw0suEKiG/HwUK5l0FfD1HiE/n3FNgahm4QDJAaEgEA3iSXFxxx9GgghqmoghqEKq221XXDLi4rnIztm7LE4ADhgO/DfR4qWY5vREHJGqcChwhU5nKvCICh5bh1ibrAQohBywsR7sNEZS8GeWL+sTVT1fRKYnIWAW8Cx+W977GW4j/jzgRdTOcfAyFzgN2IKvCU1AaRrcNRcHGNOtY57l7bM9gPEUIVEzyTsIwXAET4qb1tnpcc3RNGGjWCHcaiPy5K9qswbssvCi/E2Fb9XgAtFEINKcKq7gsEKjQpAqId9C+NkIHrxMJZ8rbcLZBrwOvIcQxcst+DgDHw58VTyNzQVeO9MI4E+cz1+rW0PNzgFEhB8LiiqigtQEhxuJhSElA8JWZdBIOMzFw04gEAqT17YV5s/FCEwOw/1uuFEgw9L36Bi1qm58DqBvISqsUOhvl4lVxMrSTSDf0hVMtf6PU44a0wAADOxJREFUn3I2qcD18YqtJ1js3Y/gs7dq86JNMuO9OFBS8e+GcL38AZiAz/ae3sIgfVD/DVwo98veNwMPaJNTMdMjAUhrXaurWFUZecoATNMkBl96rLy7Fyo8v2Q54KoEgQ1HxeRf8ZTqeLl4iXMEQTD5UiN8KyDFy+gOuAVGD6SGlbOmYcmLbUSk2cUeXE3UsgehG16OrOJFrIrVc/FxAF4EL7dKpqwTkUzJl6v3jR+g0lqAQLicJKldjWNErcgh0wFb+kFU4Lvk5VyF3E+pZEerUPtSrQg7RXAA6wrnkgrc1h9ea0YzrJ9tBu6yZ36sidotx8cylP/aJibkEyJ5BTSfyfiIb2t/JcpoRXfh5SGEW+pyPze7J9CMRSzEh8vt11X+lnhmcHFJGbtgmwkLbYTPxpbX9hMnpVvr2xb2f2IpymqtzUOovI6DHRRzZHgbT/SHvze7/PUlqZy+Jk528NMOr+3UEYL4WJbk2ppuE8Ig4EH8dMfaMfRW/Gys61uanQBKCjYj8WqhalZUDgXEcLD42/VEojEem/IuLpcz8aUGbLft7PipzCgk0seN64iqEJUaOI/d/Eo5n1K5nED/2v3/vzaovnI5nmKdoGWMYxTwHj5a4eVRfLyOb/fBLM1OAK7UNKLhoB2IZev0CfvOwdpNW4nFYjgEypTCATbCTYvdB5NYhgGc+kVyAoda8Xw1sIAdmKxkfwMf99j6Raatb/TAYCxw76Aeg/6CnzTyeRz4x742AxOQ2ToPrSNGPVEvwDA40TTzAeZDZwP+A/TQCnkPMESS6wka/KhKTLWyG1FMJhvDKWV/BCUdtXZCE6QNPl57/MvHp8/fNH+aPaAd8FV4TfeZK7hCyzdxuOrOVkn1uGmdlU7fguDOhTBArLp58Uze5AQfF3AmtoUg5bxDGisQjrb3CUSEsLIXAjL2FfjZBTyLl+s0omNV9XC5XT5iIifjJYqvYTjdK9vGWYtCUWKRcC1EAqaVMpYr8K5ABxvzPyu8lMQFDIE+iXZ/S7kq/1TTrk5v7Rs03TiXH9jfQXno5d++/FdLg+YW8nkJu0DnL44A4gpf8eYNSKisxpKx9se8FN/JS+FHE07TuPPHeqrs2zwrGijJ3HsT4d9qEkL5gihj+F8AofCSIy+ZLSJiHGCkImTga7jes3cIQBwI0LZL90T5uNQUN0n1+uJOI6ddSvI7gcEDYEnMEgfrDNh16ZVMuOyaymvqci7l4uCPAscS5UQZYVXr+kWCFw/5XNpErT2Bl3mQKA/bqHLre4cAnCnWHLZdww7D4PE33sPpMDBVCYYjyRtHLVc49RirkDMu+DkTplx/Mb5VnVmFn8+q0ddZlMl5LDdGNCiGf19o8UHgVbw82ARtTQBOAejVvtdCfAxvHAHk4yOfmXjrXTO/8X7BlIxEQfUtQ4sItg9y5KGdMU0zTsWLIzDk2KSghmPAPOxe5n9+KFvxVY///xUqcTEaUBl9N0QQA/j6uq+vNk1zTuMkSYU78SWEQpQZ+PlwT74rNTVVO7RvzUWnHR93BliewMxcKN2G4XDwwLzpDOvQhz7du7Jm4xZ6z/n46xNUj64WljWeS1Bi3NOMbtx9AfHFoyYA0zQLDcNot2ciwM+l+LgZYSNeFC+X4G1qEWFxggm5r+PY6CAtxY0gvDx7Hk+53RdUQ76X36HsqIz8+Zn7iTkn5DeByPJiNhb5NesAPtbZixkLgbHkN5VHTatSLa/O+RhPiguny8VmkUiVGTKSGC7uSQ5qXDQK3K79hgsIfcnn/AZwjYer/P4C355NUqfdkA+pISJWWY6fI8hnIjALP5820htklYhRZYO7gKtWnMorfMp5pwwkGI4kfAVJbP8iYDJBKuLJ+eIWYCZEOmCtE/z6wccK8rmMpP0V6pjpU/BxUdLvl/FZNY/2nAD8NdfUxcsg8ilE6IFyCV5W4KvfDluVIFwOqZmwcyuSYmA4LKI9uEP76hWtLLb/AlBi+Ym/NICnQB8FvRKMf+5nFv3h9UD+DnxJSnp+EwWb7NYM9PEpftqhBBC6AB3twMbdTPgqhWAMB5QUgOEg3eXh6TffQ0Qo2F6FlsZzMcrLdrybsOVQB+gLIK+CXAuOt2BA4X6Ffj9nkV9rsgp4ObkS8r1kIPRtqtcb9fzIAPA8ynm28vJinaJNhEAwnCAGQwwrLkuVVzM/AXFgqtIxtyLML3RuaBjCYwl1IepciCttEX89+Wt6z/kdyELo+2UT59b9UnSBTnWoTq/ZiBe8DEK5CB9L9i4BWNxgJX7uxctHwH/JR/FyYhJbOiX+ZyQa5dQB1qbQhsNBSeFPliQIlFVgT8HjdlG0s8yOCMZEWWR/1TpWn5rJc08fyf0fLGHFsC/gmOftJw8mn6f2G+RbBH2pHcxRVel7Fz/xfX4PQTkFfxPkFO6RJ9DHEPy8gHAqMA8vx9lX1sRr0LicTuZ9ZW1yoKaJM8WDqsmM7C+4qei8Srs0/LClEIfDIGVGynsIp+HmFe5eOJVpvkugJAbGRXDsU/ZglaL0wZ8U+frrVwQVH0uRiiLUSVCSxAmm4cff1K937sGH/9f2JBaTz834eZ58lgNHqipOO9RLVUnNbGU5AtOzeOfdJXhS3PHVPwxDCF4TRLbLQGLi5a4VCrumoOEfIethkDH2bFhUbdOFX+aMdgC/QdmF8AJWfkFOPcLCT8FLb3yVts9bYre5EpLkfjwFLZ9DgG74G7913p7HA/hpRT7r8PIwPrLx8qg8IDbRWmG7ajggFkVRHA4rUbRjbmvmZixma7diPE95UId+ESyb1xVCr8Gx38PCiRC8CU6M4OXf+DjmVzKjY8B7NpK6JbHzOVh7FK/Cz4QanvwUrVjqTngKrXE9osq9t5DPQIQVifI0+4wALCLoRj4R8jkaMEzsDaPsAD1JyYRdxYm9/qKeGMHLggzddjzlgRCPx94lFnr8jyAvQb/vYeEEcE7Ce2w7YAE+OjdgBrpQ2iEU1icmrllZe+UxOrMScoUsfElRSz6ieHkT7L4KP9Rg++cA3yRi/5tEBHiTskkra58K5FCRVJFVp+3px0U+EZQRsQGxQ9Z/UnCa3RErGFSE7Fg6ZZlBUtJcXLJtCAK0ykq3zcZYAI5dAgvvwBF7lbuOPQblM6TyTty78ZTFgHeAMfALthYsS6ojXlYB1wMz8KGChBQFL2vw0ZX8JP+Ml09QzsHfdMiPc4D7azFNFDgQiODjbnuAb0bwxNGKcritqMzBzyybCFbHesZSnfMrPLYhwrgEWpmZzB+0mq7rc3FJ5eVrd9qNzwWdb9/K1cMGk7F9O7ABfz02dsznLWA7wiZ8jVsT30dE8CPQCS9DUd4ARuoOvfH292/X+96574JEZpFVfHKUbYI3eXSz7IadrrQR3BqlE0IaVkxeCJ+dj5/PowijgFyUE4AhrlmuAZGzI+fesXkkgrI6awcHl+XwwAFvcvyMXmwpLOZ3ZwyC9Na4gsXc88xbRA+68TPOes4gs+hKrMIQB9jf9yjCw/iS4vy8ZAPHAq/gox2/ZogrdF6+xcdhtnjItJXHTsBIfM2X0+DcjRw7ogbNcztwpR2eHEM5AR834KUz8APCBZEhkb84J7pY/4dtFLp2MiDSn+ScTDNeNNL2GEZvimA8mPeymVW0EFiDErMVIAOftRN3Jflp+c4v+NUjP1lX8HEYXhaggM8eLC/rsfYoajYCkEZSbW+U9ggG8B5KCTADP5fhZYkUSh5l5LXrlMXBgVx+Ez0JgqXMT/+G0vcCDO53OKkeD2ZaNs+lvc62B0rR0bHbtJ1+AzjxMy1pZjyFtd9uJjAK+BTffpPoUZNIU1tHUGAw/hr9A/vYD1DZVhW8HIdyDfkoyunaVt+lLRRHykihE0TDoCZhiWCq0io7g03fLufLo8ro9+khvNd9GeHW0ZsQXsbHX2wl9HK7ysZMhEvw8R/2d7C8gr9JKIp7xQvd9J24C2UGWLlrKeoiKjFu2zycmGny3oIVnH1aX/xZr3PnllGoKve2mUrqI6ndAuMCG7Ayf0pQyvGTQQs0KzRHUOgw/CyPk9ag8p5cuv0UAhKh+KfvibYx+XDV19y5ZRTRcIiH8mbieMZJcHRwNMpbKCUoHVqQ/2slAB+D8CKe+z0XuF9wU2IGOCCYzbK0DSw8ooRdrYJsWlWEAu+3W4G37CLMo00Q0hA+x4/gb+aKWi3QrBwAfKiIFOKEHms74ED4MHsF3QMHkvdjNtt3lmkwFObbnVujTy59d6drvnOjpmm0Vp9EC/zKCMAGx2ZHzAyHYmXbC2JXLTgilrOmNHZc58xYaSDMP16cPsN4zXHk+sHbMsO7wl1wM67Jc+pboJmsgPrBAlXNKy8uIJN0XA7LMxiOmfGNnQpLS8tIeO/2cb28FmiBFmiBFmiBFmiBFmiBFmiBFmiB/wH4f+jryq6sRdUDAAAAAElFTkSuQmCC" alt="DREME Logo"/> + <h1>DREME</h1> + <h2>Discriminative Regular Expression Motif Elicitation</h2> + </div> + <p class="spaced"> + For further information on how to interpret these results or to get a + copy of the MEME software please access + <a href="http://meme.nbcr.net/">http://meme.nbcr.net</a>. + </p> + <p> + If you use DREME in your research please cite the following paper:<br /> + <span class="citation"> + Timothy L. Bailey, "DREME: Motif discovery in transcription factor ChIP-seq data", <i>Bioinformatics</i>, <b>27</b>(12):1653-1659, 2011. + <a href="http://bioinformatics.oxfordjournals.org/content/27/12/1653">[full text]</a> + </span> + </p> + </div> + <!-- navigation --> + <div class="pad2"> + <a class="jump" href="#motifs_sec">Discovered Motifs</a> + | + <a class="jump" href="#inputs_sec">Inputs & Settings</a> + | + <a class="jump" href="#info_sec">Program information</a> + </div> + <!-- alert the user when their browser is not up to the task --> + <noscript><h1 style="color:red">Javascript is required to view these results!</h1></noscript> + <h1 id="html5_warning" style="color:red; display:none;">Your browser does not support canvas!</h1> + <script> + if (!window.HTMLCanvasElement) $("html5_warning").style.display = "block"; + </script> + <!-- description --> + <div id="description_section" style="display:none"> + <div id="description" class="header"> + <h2>Description</h2> + </div> + <div id="description_text" class="box"> + </div> + </div> + <script> + if (data.description) { + $("description_text").innerHTML = ""; + $("description_text").appendChild(make_description(data.description)); + $("description_section").style.display = "block"; + } + </script> + <!-- motifs --> + <div id="motifs_sec" class="header"> + <h2>Discovered Motifs</h2> + <span><a href="#inputs_sec">Next</a> <a href="#">Top</a></span> + </div> + <div id="motifs" class="box"> + <p>No motifs were discovered!</p> + </div> + <script>make_motifs();</script> + <!-- inputs and settings --> + <div id="inputs_sec" class="header"> + <h2>Inputs & Settings</h2> + <span><a href="#motifs_sec">Previous</a> <a href="#info_sec">Next</a> <a href="#">Top</a></span> + </div> + <div class="box"> + <h4>Sequences</h4> + <table id="seq_info" class="inputs"> + <tr><th>Source <div class="help" data-topic="pop_seq_source"></div></th> + <th>Alphabet <div class="help" data-topic="pop_seq_alph"></div></th> + <th>Sequence Count <div class="help" data-topic="pop_seq_count"></div></th> + </tr> + <tr> + <td id="ins_seq_source"></td> + <td id="ins_seq_alphabet"></td> + <td id="ins_seq_count"></td> + </tr> + </table> + <script> + { + var db = data.sequence_db; + $("ins_seq_source").innerHTML = db.file; + $("ins_seq_alphabet").innerHTML = dreme_alphabet.get_alphabet_name(); + $("ins_seq_count").innerHTML = db.count; + } + </script> + <h4>Control Sequences</h4> + <table id="seq_info" class="inputs"> + <tr><th>Source <div class="help" data-topic="pop_seq_source"></div></th> + <th>Sequence Count <div class="help" data-topic="pop_seq_count"></div></th> + </tr> + <tr> + <td id="ins_cseq_source"></td> + <td id="ins_cseq_count"></td> + </tr> + </table> + <script> + { + var db = data.control_db; + if (db.from == "shuffled") { + $("ins_cseq_source").innerHTML = "Shuffled Sequences"; + } else { + $("ins_cseq_source").innerHTML = db.file; + } + $("ins_cseq_count").innerHTML = db.count; + } + </script> + <h4>Background</h4> + <span id="alpha_bg"></span> + <script> + { + $("alpha_bg").appendChild(make_alpha_bg(dreme_alphabet, data.control_db.freqs)); + } + </script> + <h4>Other Settings</h4> + <table id="tbl_settings" class="inputs hide_advanced"> + <tr> + <th>Strand Handling</th> + <td id="opt_strand"> + <span class="strand_none">This alphabet only has one strand</span> + <span class="strand_given">Only the given strand is processed</span> + <span class="strand_both">Both the given and reverse complement strands are processed</span> + </td> + </tr> + <tr><th># REs to Generalize</th><td id="opt_ngen"></td></tr> + <tr><th>Shuffle Seed</th><td id="opt_seed"></td></tr> + <tr><th>E-value Threshold</th><td id="opt_stop_evalue"></td></tr> + <tr><th>Max Motif Count</th><td id="opt_stop_count"></td></tr> + <tr><th>Max Run Time</th><td id="opt_stop_time"></td></tr> + </table> + <script> + { + $("opt_strand").className = (dreme_alphabet.has_complement() ? (data.options.revcomp ? "both" : "given") : "none"); + $("opt_ngen").innerHTML = data.options.ngen; + $("opt_seed").innerHTML = data.options.seed; + $("opt_stop_evalue").innerHTML = data.options.stop.evalue; + $("opt_stop_count").innerHTML = (typeof data.options.stop.count == "number" ? data.options.stop.count : "No maximum motif count."); + $("opt_stop_time").innerHTML = (typeof data.options.stop.time == "number" ? data.options.stop.time + " seconds." : "No maximum running time."); + } + </script> + </div> + <!-- list information on this program --> + <div id="info_sec" class="bar" style="position:relative"> + <div style="position: absolute; right: 0;"><a href="#inputs_sec">Previous</a> <a href="#">Top</a></div> + <div class="subsection"> + <h5 id="version">DREME version</h5> + <span id="ins_version"></span> + (Release date: <span id="ins_release"></span>)<br> + </div> + <script> + $("ins_version").innerHTML = data["version"]; + $("ins_release").innerHTML = data["release"]; + </script> + <div class="subsection"> + <h5 id="reference">Reference</h5> + <span class="citation"> + Timothy L. Bailey, "DREME: Motif discovery in transcription factor ChIP-seq data", <i>Bioinformatics</i>, <b>27</b>(12):1653-1659, 2011. + <a href="http://bioinformatics.oxfordjournals.org/content/27/12/1653">[full text]</a> + </span> + </div> + <div class="subsection"> + <h5 id="command">Command line</h5> + <textarea id="cmd" rows="3" style="width:100%;" readonly="readonly"> + </textarea> + <script>$("cmd").value = data["cmd"].join(" ");</script> + </div> + </div> + + </body> +</html>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/dreme1.txt Wed Apr 25 12:12:22 2018 -0400 @@ -0,0 +1,102 @@ +# DREME 4.12.0 +# command: dreme -oc dreme_out -rna -norc -p dreme_test_sites.fa -e 0.05 -mink 3 -maxk 8 +# positives: 1000 from dreme_test_sites.fa (Thu Apr 19 19:09:45 CEST 2018) +# negatives: 1000 from shuffled positives +# host: ThinkPad-T450s +# when: Thu Apr 19 19:11:17 CEST 2018 + +MEME version 4.12.0 + +ALPHABET "RNA" RNA-LIKE +A "Adenine" CC0000 +C "Cytosine" 0000CC +G "Guanine" FFB300 +U "Uracil" 008000 +N "Any base" = ACGU +X = ACGU +. = ACGU +V "Not U" = ACG +H "Not G" = ACU +D "Not C" = AGU +B "Not A" = CGU +M "Amino" = AC +R "Purine" = AG +W "Weak" = AU +S "Strong" = CG +Y "Pyrimidine" = CU +K "Keto" = GU +T = U +END ALPHABET + +Background letter frequencies (from dataset): +A 0.221 C 0.245 G 0.221 U 0.312 + + +MOTIF UUYUCY DREME-1 + +# Word Pos Neg P-value E-value +# BEST UUYUCY 387 210 2.6e-018 1.2e-013 +# UUUUCC 147 75 1.8e-007 8.1e-003 +# UUUUCU 155 94 2.2e-005 1.0e+000 +# UUCUCU 94 51 1.3e-004 6.1e+000 +# UUCUCC 75 42 1.1e-003 5.0e+001 + +letter-probability matrix: alength= 4 w= 6 nsites= 459 E= 1.2e-013 +0.000000 0.000000 0.000000 1.000000 +0.000000 0.000000 0.000000 1.000000 +0.000000 0.294118 0.000000 0.705882 +0.000000 0.000000 0.000000 1.000000 +0.000000 1.000000 0.000000 0.000000 +0.000000 0.474946 0.000000 0.525054 + + +MOTIF YAGG DREME-2 + +# Word Pos Neg P-value E-value +# BEST YAGG 600 416 1.1e-016 5.1e-012 +# CAGG 441 304 1.5e-010 6.6e-006 +# UAGG 232 165 1.1e-004 4.7e+000 + +letter-probability matrix: alength= 4 w= 4 nsites= 793 E= 5.1e-012 +0.000000 0.692308 0.000000 0.307692 +1.000000 0.000000 0.000000 0.000000 +0.000000 0.000000 1.000000 0.000000 +0.000000 0.000000 1.000000 0.000000 + + +MOTIF GAAGAW DREME-3 + +# Word Pos Neg P-value E-value +# BEST GAAGAW 81 22 8.2e-010 3.4e-005 +# GAAGAU 45 7 2.4e-008 9.9e-004 +# GAAGAA 40 16 7.9e-004 3.3e+001 + +letter-probability matrix: alength= 4 w= 6 nsites= 89 E= 3.4e-005 +0.000000 0.000000 1.000000 0.000000 +1.000000 0.000000 0.000000 0.000000 +1.000000 0.000000 0.000000 0.000000 +0.000000 0.000000 1.000000 0.000000 +1.000000 0.000000 0.000000 0.000000 +0.494382 0.000000 0.000000 0.505618 + + +MOTIF SMUGGA DREME-4 + +# Word Pos Neg P-value E-value +# BEST SMUGGA 110 47 9.1e-008 3.7e-003 +# GAUGGA 22 6 1.7e-003 7.1e+001 +# GCUGGA 33 14 3.6e-003 1.5e+002 +# CCUGGA 32 15 8.6e-003 3.5e+002 +# CAUGGA 29 13 9.1e-003 3.7e+002 + +letter-probability matrix: alength= 4 w= 6 nsites= 119 E= 3.7e-003 +0.000000 0.529412 0.470588 0.000000 +0.428571 0.571429 0.000000 0.000000 +0.000000 0.000000 0.000000 1.000000 +0.000000 0.000000 1.000000 0.000000 +0.000000 0.000000 1.000000 0.000000 +1.000000 0.000000 0.000000 0.000000 + + +# Stopping reason: E-value threshold exceeded +# Running time: 13.45 seconds
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/dreme1.xml Wed Apr 25 12:12:22 2018 -0400 @@ -0,0 +1,32 @@ +<dreme version="4.12.0" release="Tue Jun 27 16:22:50 2017 -0700"> + <model> + <command_line>dreme -oc dreme_out -rna -norc -p dreme_test_sites.fa -e 0</command_line> + <positives name="dreme test sites" count="1000" file="dreme_test_sites.fa" last_mod_date="Thu Apr 19 19:09:45 CEST 2018" /> + <negatives name="shuffled positive sequences" count="1000" from="shuffled"/> + <alphabet name="RNA" like="rna"> + <letter id="A" symbol="A" name="Adenine" colour="CC0000"/> + <letter id="C" symbol="C" name="Cytosine" colour="0000CC"/> + <letter id="G" symbol="G" name="Guanine" colour="FFB300"/> + <letter id="U" symbol="U" aliases="T" name="Uracil" colour="008000"/> + <letter id="N" symbol="N" aliases="X." equals="ACGU" name="Any base"/> + <letter id="V" symbol="V" equals="ACG" name="Not U"/> + <letter id="H" symbol="H" equals="ACU" name="Not G"/> + <letter id="D" symbol="D" equals="AGU" name="Not C"/> + <letter id="B" symbol="B" equals="CGU" name="Not A"/> + <letter id="M" symbol="M" equals="AC" name="Amino"/> + <letter id="R" symbol="R" equals="AG" name="Purine"/> + <letter id="W" symbol="W" equals="AU" name="Weak"/> + <letter id="S" symbol="S" equals="CG" name="Strong"/> + <letter id="Y" symbol="Y" equals="CU" name="Pyrimidine"/> + <letter id="K" symbol="K" equals="GU" name="Keto"/> + </alphabet> + <strands>none</strands> + <background A="0.221" C="0.245" G="0.221" U="0.312" from="dataset"/> + <stop evalue="0"/> + <ngen>100</ngen> + <add_pv_thresh>0.01</add_pv_thresh> + <seed>1</seed> + <host>ThinkPad-T450s</host> + <when>Thu Apr 19 19:40:08 CEST 2018</when> + </model> + <motifs>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/dreme2.html Wed Apr 25 12:12:22 2018 -0400 @@ -0,0 +1,6118 @@ +<!DOCTYPE HTML> +<html> + <head> + <meta charset="UTF-8"> + <title>DREME</title> + <script> + // @JSON_VAR data + var data = { + "program": "dreme", + "version": "4.12.0", + "release": "Tue Jun 27 16:22:50 2017 -0700", + "cmd": [ + "dreme", "-oc", "dreme_out_adv", "-rna", "-norc", "-p", + "dreme_test_sites.fa", "-e", "0.00001", "-mink", "4", "-maxk", "10" + ], + "options": { + "revcomp": false, + "ngen": 100, + "add_pv_thresh": 0.01, + "seed": 1, + "stop": { + "evalue": "1e-05" + } + }, + "alphabet": { + "name": "RNA", + "like": "rna", + "ncore": 4, + "symbols": [ + { + "symbol": "A", + "name": "Adenine", + "colour": "CC0000" + }, { + "symbol": "C", + "name": "Cytosine", + "colour": "0000CC" + }, { + "symbol": "G", + "name": "Guanine", + "colour": "FFB300" + }, { + "symbol": "U", + "aliases": "T", + "name": "Uracil", + "colour": "008000" + }, { + "symbol": "N", + "aliases": "X.", + "name": "Any base", + "equals": "ACGU" + }, { + "symbol": "V", + "name": "Not U", + "equals": "ACG" + }, { + "symbol": "H", + "name": "Not G", + "equals": "ACU" + }, { + "symbol": "D", + "name": "Not C", + "equals": "AGU" + }, { + "symbol": "B", + "name": "Not A", + "equals": "CGU" + }, { + "symbol": "M", + "name": "Amino", + "equals": "AC" + }, { + "symbol": "R", + "name": "Purine", + "equals": "AG" + }, { + "symbol": "W", + "name": "Weak", + "equals": "AU" + }, { + "symbol": "S", + "name": "Strong", + "equals": "CG" + }, { + "symbol": "Y", + "name": "Pyrimidine", + "equals": "CU" + }, { + "symbol": "K", + "name": "Keto", + "equals": "GU" + } + ] + }, + "background": { + "freqs": [0.221, 0.245, 0.221, 0.312] + }, + "sequence_db": { + "name": "dreme test sites", + "file": "dreme_test_sites.fa", + "lmod": "Thu Apr 19 19:09:45 CEST 2018", + "count": 1000 + }, + "control_db": { + "name": "shuffled positive sequences", + "from": "shuffled", + "count": 1000, + "freqs": [0.221, 0.245, 0.221, 0.312] + }, + "motifs": [ + { + "db": 0, + "id": "UUYUCY", + "alt": "DREME-1", + "len": 6, + "nsites": 459, + "evalue": "3.3e-013", + "p": 387, + "n": 210, + "pvalue": "2.6e-018", + "unerased_evalue": "3.3e-013", + "pwm": [ + [0.000000, 0.000000, 0.000000, 1.000000], + [0.000000, 0.000000, 0.000000, 1.000000], + [0.000000, 0.294118, 0.000000, 0.705882], + [0.000000, 0.000000, 0.000000, 1.000000], + [0.000000, 1.000000, 0.000000, 0.000000], + [0.000000, 0.474946, 0.000000, 0.525054] + ], + "matches": [ + { + "seq": "UUUUCC", + "p": 147, + "n": 75, + "pvalue": "1.8e-007", + "evalue": "2.2e-002" + }, { + "seq": "UUUUCU", + "p": 155, + "n": 94, + "pvalue": "2.2e-005", + "evalue": "2.8e+000" + }, { + "seq": "UUCUCU", + "p": 94, + "n": 51, + "pvalue": "1.3e-004", + "evalue": "1.7e+001" + }, { + "seq": "UUCUCC", + "p": 75, + "n": 42, + "pvalue": "1.1e-003", + "evalue": "1.4e+002" + } + ] + }, { + "db": 0, + "id": "YAGG", + "alt": "DREME-2", + "len": 4, + "nsites": 793, + "evalue": "1.4e-011", + "p": 600, + "n": 416, + "pvalue": "1.1e-016", + "unerased_evalue": "6.3e-012", + "pwm": [ + [0.000000, 0.692308, 0.000000, 0.307692], + [1.000000, 0.000000, 0.000000, 0.000000], + [0.000000, 0.000000, 1.000000, 0.000000], + [0.000000, 0.000000, 1.000000, 0.000000] + ], + "matches": [ + { + "seq": "CAGG", + "p": 441, + "n": 304, + "pvalue": "1.5e-010", + "evalue": "1.8e-005" + }, { + "seq": "UAGG", + "p": 232, + "n": 165, + "pvalue": "1.1e-004", + "evalue": "1.3e+001" + } + ] + } + ], + "runtime": { + "host": "ThinkPad-T450s", + "when": "Tue Apr 24 18:44:36 CEST 2018", + "cpu": 18.17, + "real": 18.17, + "stop": "evalue" + } + }; + </script> + <script> +var site_url = "http://meme-suite.org"; +</script> + <script> + +/* + * $ + * + * Shorthand function for getElementById + */ +function $(el) { + return document.getElementById(el); +} + + +/* + * See http://stackoverflow.com/a/5450113/66387 + * Does string multiplication like the perl x operator. + */ +function string_mult(pattern, count) { + if (count < 1) return ''; + var result = ''; + while (count > 1) { + if (count & 1) result += pattern; + count >>= 1, pattern += pattern; + } + return result + pattern; +} + +/* + * See http://stackoverflow.com/questions/814613/how-to-read-get-data-from-a-url-using-javascript + * Slightly modified with information from + * https://developer.mozilla.org/en/DOM/window.location + */ +function parse_params() { + "use strict"; + var search, queryStart, queryEnd, query, params, nvPairs, i, nv, n, v; + search = window.location.search; + queryStart = search.indexOf("?") + 1; + queryEnd = search.indexOf("#") + 1 || search.length + 1; + query = search.slice(queryStart, queryEnd - 1); + + if (query === search || query === "") return {}; + + params = {}; + nvPairs = query.replace(/\+/g, " ").split("&"); + + for (i = 0; i < nvPairs.length; i++) { + nv = nvPairs[i].split("="); + n = decodeURIComponent(nv[0]); + v = decodeURIComponent(nv[1]); + // allow a name to be used multiple times + // storing each value in the array + if (!(n in params)) { + params[n] = []; + } + params[n].push(nv.length === 2 ? v : null); + } + return params; +} + +/* + * coords + * + * Calculates the x and y offset of an element. + * From http://www.quirksmode.org/js/findpos.html + * with alterations to take into account scrolling regions + */ +function coords(elem) { + var myX = myY = 0; + if (elem.getBoundingClientRect) { + var rect; + rect = elem.getBoundingClientRect(); + myX = rect.left + ((typeof window.pageXOffset !== "undefined") ? + window.pageXOffset : document.body.scrollLeft); + myY = rect.top + ((typeof window.pageYOffset !== "undefined") ? + window.pageYOffset : document.body.scrollTop); + } else { + // this fall back doesn't properly handle absolutely positioned elements + // inside a scrollable box + var node; + if (elem.offsetParent) { + // subtract all scrolling + node = elem; + do { + myX -= node.scrollLeft ? node.scrollLeft : 0; + myY -= node.scrollTop ? node.scrollTop : 0; + } while (node = node.parentNode); + // this will include the page scrolling (which is unwanted) so add it back on + myX += (typeof window.pageXOffset !== "undefined") ? window.pageXOffset : document.body.scrollLeft; + myY += (typeof window.pageYOffset !== "undefined") ? window.pageYOffset : document.body.scrollTop; + // sum up offsets + node = elem; + do { + myX += node.offsetLeft; + myY += node.offsetTop; + } while (node = node.offsetParent); + } + } + return [myX, myY]; +} + +/* + * position_popup + * + * Positions a popup relative to an anchor element. + * + * The avaliable positions are: + * 0 - Centered below the anchor. + */ +function position_popup(anchor, popup, position) { + "use strict"; + var a_x, a_y, a_w, a_h, p_x, p_y, p_w, p_h; + var a_xy, spacer, margin, scrollbar, page_w; + // define constants + spacer = 5; + margin = 15; + scrollbar = 15; + // define the positions and widths + a_xy = coords(anchor); + a_x = a_xy[0]; + a_y = a_xy[1]; + a_w = anchor.offsetWidth; + a_h = anchor.offsetHeight; + p_w = popup.offsetWidth; + p_h = popup.offsetHeight; + page_w = null; + if (window.innerWidth) { + page_w = window.innerWidth; + } else if (document.body) { + page_w = document.body.clientWidth; + } + // check the position type is defined + if (typeof position !== "number") { + position = 0; + } + // calculate the popup position + switch (position) { + case 1: + p_x = a_x + a_w + spacer; + p_y = a_y + (a_h / 2) - (p_h / 2); + break; + case 0: + default: + p_x = a_x + (a_w / 2) - (p_w / 2); + p_y = a_y + a_h + spacer; + break; + } + // constrain the popup position + if (p_x < margin) { + p_x = margin; + } else if (page_w != null && (p_x + p_w) > (page_w - margin - scrollbar)) { + p_x = page_w - margin - scrollbar - p_w; + } + if (p_y < margin) { + p_y = margin; + } + // position the popup + popup.style.left = p_x + "px"; + popup.style.top = p_y + "px"; +} + +function lookup_help_popup(popup_id) { + var _body, pop, info; + pop = document.getElementById(popup_id); + if (pop == null) { + _body = document.getElementsByTagName("body")[0]; + pop = document.createElement("div"); + pop.className = "pop_content"; + pop.id = popup_id; + pop.style.backgroundColor = "#FFC"; + pop.style.borderColor = "black"; + info = document.createElement("p"); + info.style.fontWeight = "bold"; + info.appendChild(document.createTextNode("Error: No popup for topic \"" + popup_id + "\".")); + pop.appendChild(info); + // this might cause problems with the menu, but as this only happens + // when something is already wrong I don't think that's too much of a problem + _body.insertBefore(pop, _body.firstChild); + } + if (document.getElementsByTagName('body')[0].hasAttribute("data-autobtns")) { + if (!/\bauto_buttons\b/.test(pop.className)) { + pop.className += " auto_buttons"; + var back_btn_sec = document.createElement("div"); + back_btn_sec.className = "nested_only pop_back_sec"; + var back_btn = document.createElement("span"); + back_btn.className = "pop_back"; + back_btn.appendChild(document.createTextNode("<< back")); + back_btn.addEventListener("click", function(e) { + help_return(); + }, false); + back_btn_sec.appendChild(back_btn); + pop.insertBefore(back_btn_sec, pop.firstChild); + var close_btn_sec = document.createElement("div"); + close_btn_sec.className = "pop_close_sec"; + var close_btn = document.createElement("span"); + close_btn.className = "pop_close"; + close_btn.appendChild(document.createTextNode("close")); + close_btn.addEventListener("click", function(e) { + help_popup(); + }, false); + close_btn_sec.appendChild(close_btn); + pop.appendChild(close_btn_sec); + } + } + return pop; +} + +/* + * help_popup + * + * Moves around help pop-ups so they appear + * below an activator. + */ +function help_popup(activator, popup_id) { + "use strict"; + var pop; + // set default values + if (typeof help_popup.popup === "undefined") { + help_popup.popup = []; + } + if (typeof help_popup.activator === "undefined") { + help_popup.activator = null; + } + var last_pop = (help_popup.popup.length > 0 ? help_popup.popup[help_popup.popup.length - 1] : null); + if (typeof(activator) == "undefined") { // no activator so hide + if (last_pop != null) { + last_pop.style.display = 'none'; + help_popup.popup = []; + } + return; + } + pop = lookup_help_popup(popup_id); + if (pop == last_pop) { + if (activator == help_popup.activator) { + //hide popup (as we've already shown it for the current help button) + last_pop.style.display = 'none'; + help_popup.popup = []; + return; // toggling complete! + } + } else if (last_pop != null) { + //activating different popup so hide current one + last_pop.style.display = 'none'; + } + help_popup.popup = [pop]; + help_popup.activator = activator; + toggle_class(pop, "nested", false); + //must make the popup visible to measure it or it has zero width + pop.style.display = 'block'; + position_popup(activator, pop); +} + +/* + * help_refine + * + * Intended for links within a help popup. Stores a stack of state so + * you can go back. + */ +function help_refine(popup_id) { + if (help_popup.popup == null || help_popup.popup.length == 0 || help_popup.activator == null) { + throw new Error("Can not refine a help popup when one is not shown!"); + } + var pop = lookup_help_popup(popup_id); + var last_pop = help_popup.popup[help_popup.popup.length - 1]; + if (pop == last_pop) return; // slightly odd, but no real cause for alarm + help_popup.popup.push(pop); + toggle_class(pop, "nested", true); + last_pop.style.display = "none"; + //must make the popup visible to measure it or it has zero width + pop.style.display = "block"; + position_popup(help_popup.activator, pop); +} + +/* + * help_return + * + * Intended for links within a help popup. Stores a stack of state so + * you can go back. + */ +function help_return() { + if (help_popup.popup == null || help_popup.popup.length == 0 || help_popup.activator == null) { + throw new Error("Can not return to a earlier help popup when one is not shown!"); + } + var last_pop = help_popup.popup.pop(); + last_pop.style.display = "none"; + var pop = (help_popup.popup.length > 0 ? help_popup.popup[help_popup.popup.length - 1] : null); + if (pop != null) { + toggle_class(pop, "nested", help_popup.popup.length > 1); + pop.style.display = "block"; + position_popup(help_popup.activator, pop); + } else { + help_popup.activator = null; + } +} + +/* + * update_scroll_pad + * + * Creates padding at the bottom of the page to allow + * scrolling of anything into view. + */ +function update_scroll_pad() { + var page, pad; + page = (document.compatMode === "CSS1Compat") ? document.documentElement : document.body; + pad = $("scrollpad"); + if (pad === null) { + pad = document.createElement("div"); + pad.id = 'scrollpad'; + document.getElementsByTagName('body')[0].appendChild(pad); + } + pad.style.height = Math.abs(page.clientHeight - 100) + "px"; +} + +function substitute_classes(node, remove, add) { + "use strict"; + var list, all, i, cls, classes; + list = node.className.split(/\s+/); + all = {}; + for (i = 0; i < list.length; i++) { + if (list[i].length > 0) all[list[i]] = true; + } + for (i = 0; i < remove.length; i++) { + if (all.hasOwnProperty(remove[i])) { + delete all[remove[i]]; + } + } + for (i = 0; i < add.length; i++) { + all[add[i]] = true; + } + classes = ""; + for (cls in all) { + classes += cls + " "; + } + node.className = classes; +} + +/* + * toggle_class + * + * Adds or removes a class from the node. If the parameter 'enabled' is not + * passed then the existence of the class will be toggled, otherwise it will be + * included if enabled is true. + */ +function toggle_class(node, cls, enabled) { + var classes = node.className; + var list = classes.replace(/^\s+/, '').replace(/\s+$/, '').split(/\s+/); + var found = false; + for (var i = 0; i < list.length; i++) { + if (list[i] == cls) { + list.splice(i, 1); + i--; + found = true; + } + } + if (typeof enabled == "undefined") { + if (!found) list.push(cls); + } else { + if (enabled) list.push(cls); + } + node.className = list.join(" "); +} + +/* + * find_child + * + * Searches child nodes in depth first order and returns the first it finds + * with the className specified. + * TODO replace with querySelector + */ +function find_child(node, className) { + var pattern; + if (node == null || typeof node !== "object") { + return null; + } + if (typeof className === "string") { + pattern = new RegExp("\\b" + className + "\\b"); + } else { + pattern = className; + } + if (node.nodeType == Node.ELEMENT_NODE && + pattern.test(node.className)) { + return node; + } else { + var result = null; + for (var i = 0; i < node.childNodes.length; i++) { + result = find_child(node.childNodes[i], pattern); + if (result != null) break; + } + return result; + } +} + +/* + * find_parent + * + * Searches parent nodes outwards from the node and returns the first it finds + * with the className specified. + */ +function find_parent(node, className) { + var pattern; + pattern = new RegExp("\\b" + className + "\\b"); + do { + if (node.nodeType == Node.ELEMENT_NODE && + pattern.test(node.className)) { + return node; + } + } while (node = node.parentNode); + return null; +} + +/* + * find_parent_tag + * + * Searches parent nodes outwards from the node and returns the first it finds + * with the tag name specified. HTML tags should be specified in upper case. + */ +function find_parent_tag(node, tag_name) { + do { + if (node.nodeType == Node.ELEMENT_NODE && node.tagName == tag_name) { + return node; + } + } while (node = node.parentNode); + return null; +} + +/* + * __toggle_help + * + * Uses the 'topic' property of the this object to + * toggle display of a help topic. + * + * This function is not intended to be called directly. + */ +function __toggle_help(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + + help_popup(this, this.getAttribute("data-topic")); +} + +function setup_help_button(button) { + "use strict"; + var topic; + if (button.hasAttribute("data-topic")) { + topic = button.getAttribute("data-topic"); + if (document.getElementById(topic) != null) { + button.tabIndex = "0"; // make keyboard selectable + button.addEventListener("click", function() { + help_popup(button, topic); + }, false); + button.addEventListener("keydown", function(e) { + // toggle only on Enter or Spacebar, let other keys do their thing + if (e.keyCode !== 13 && e.keyCode !== 32) return; + // stop a submit or something like that + e.preventDefault(); + help_popup(button, topic); + }, false); + } else { + button.style.visibility = "hidden"; + } + } + button.className += " active"; +} + +/* + * help_button + * + * Makes a help button for the passed topic. + */ +function help_button(topic) { + var btn = document.createElement("div"); + btn.className = "help"; + btn.setAttribute("data-topic", topic); + setup_help_button(btn); + return btn; +} + +/* + * prepare_download + * + * Sets the attributes of a link to setup a file download using the given content. + * If no link is provided then create one and click it. + */ +function prepare_download(content, mimetype, filename, link) { + "use strict"; + // if no link is provided then create one and click it + var click_link = false; + if (!link) { + link = document.createElement("a"); + click_link = true; + } + try { + // Use a BLOB to convert the text into a data URL. + // We could do this manually with a base 64 conversion. + // This will only be supported on modern browsers, + // hence the try block. + var blob = new Blob([content], {type: mimetype}); + var reader = new FileReader(); + reader.onloadend = function() { + // If we're lucky the browser will also support the download + // attribute which will let us suggest a file name to save the link. + // Otherwise it is likely that the filename will be unintelligible. + link.setAttribute("download", filename); + link.href = reader.result; + if (click_link) { + // must add the link to click it + document.body.appendChild(link); + link.click(); + document.body.removeChild(link); + } + } + reader.readAsDataURL(blob); + } catch (error) { + if (console && console.log) console.log(error); + // probably an old browser + link.href = ""; + link.visible = false; + } +} + +/* + * add_cell + * + * Add a cell to the table row. + */ +function add_cell(row, node, cls, click_action) { + var cell = row.insertCell(row.cells.length); + if (node) cell.appendChild(node); + if (cls && cls !== "") cell.className = cls; + if (click_action) cell.addEventListener("click", click_action, false); +} + +/* + * add_header_cell + * + * Add a header cell to the table row. + */ +function add_header_cell(row, node, help_topic, cls, colspan) { + var th = document.createElement("th"); + if (node) th.appendChild(node); + if (help_topic && help_topic !== "") th.appendChild(help_button(help_topic)); + if (cls && cls !== "") th.className = cls; + if (typeof colspan == "number" && colspan > 1) th.colSpan = colspan; + row.appendChild(th); +} + +/* + * add_text_cell + * + * Add a text cell to the table row. + */ +function add_text_cell(row, text, cls, action) { + var node = null; + if (typeof(text) != 'undefined') node = document.createTextNode(text); + add_cell(row, node, cls, action); +} + +/* + * add_text_header_cell + * + * Add a text header cell to the table row. + */ +function add_text_header_cell(row, text, help_topic, cls, action, colspan) { + var node = null; + if (typeof(text) != 'undefined') { + var nbsp = (help_topic ? "\u00A0" : ""); + var str = "" + text; + var parts = str.split(/\n/); + if (parts.length === 1) { + if (action) { + node = document.createElement("span"); + node.appendChild(document.createTextNode(str + nbsp)); + } else { + node = document.createTextNode(str + nbsp); + } + } else { + node = document.createElement("span"); + for (var i = 0; i < parts.length; i++) { + if (i !== 0) { + node.appendChild(document.createElement("br")); + } + node.appendChild(document.createTextNode(parts[i])); + } + } + if (action) { + node.addEventListener("click", action, false); + node.style.cursor = "pointer"; + } + } + add_header_cell(row, node, help_topic, cls, colspan); +} + +function setup_help() { + "use strict"; + var help_buttons, i; + help_buttons = document.querySelectorAll(".help:not(.active)"); + for (i = 0; i < help_buttons.length; i++) { + setup_help_button(help_buttons[i]); + } +} + +function setup_scrollpad() { + "use strict"; + if (document.getElementsByTagName('body')[0].hasAttribute("data-scrollpad") && document.getElementById("scrollpad") == null) { + window.addEventListener("resize", update_scroll_pad, false); + update_scroll_pad(); + } +} + +// anon function to avoid polluting global scope +(function() { + "use strict"; + window.addEventListener("load", function load(evt) { + window.removeEventListener("load", load, false); + setup_help(); + setup_scrollpad(); + }, false); +})(); + +/* + * make_link + * + * Creates a text node and if a URL is specified it surrounds it with a link. + * If the URL doesn't begin with "http://" it automatically adds it, as + * relative links don't make much sense in this context. + */ +function make_link(text, url) { + var textNode = null; + var link = null; + if (typeof text !== "undefined" && text !== null) textNode = document.createTextNode(text); + if (typeof url === "string") { + if (url.indexOf("//") == -1) { + url = "http://" + url; + } + link = document.createElement('a'); + link.href = url; + if (textNode) link.appendChild(textNode); + return link; + } + return textNode; +} +</script> + <script> +function motif_logo_template(inputs) { + function _input(name) { + if (typeof inputs[name] === "undefined") { + throw new Error("Missing template variable: " + name); + } + return inputs[name]; + } + return ( +"%!PS-Adobe-3.0 EPSF-3.0\n" + +"%%Title: Sequence Logo : " + _input("TITLE") + "\n" + +"%%Creator: " + _input("CREATOR") + "\n" + +"%%CreationDate: " + _input("CREATIONDATE") + "\n" + +"%%BoundingBox: 0 0 " + _input("BOUNDINGWIDTH") + " " + _input("BOUNDINGHEIGHT") + " \n" + +"%%Pages: 0\n" + +"%%DocumentFonts: \n" + +"%%EndComments\n" + +"\n" + +"% ---- CONSTANTS ----\n" + +"\/cmfactor 72 2.54 div def % defines points -> cm conversion\n" + +"\/cm {cmfactor mul} bind def % defines centimeters\n" + +"\n" + +"% ---- VARIABLES ----\n" + +"\n" + +"% NA = Nucleic Acid, AA = Amino Acid\n" + +"\/logoType (" + _input("LOGOTYPE") + ") def \n" + +"\n" + +"\/logoTitle (" + _input("TITLE") + ") def\n" + +"\n" + +"% Dimensions in cm\n" + +"\/logoWidth " + _input("LOGOWIDTH") + " cm def\n" + +"\/logoHeight " + _input("LOGOLINEHEIGHT") + " cm def\n" + +"\/totalHeight " + _input("LOGOHEIGHT") + " cm def\n" + +"\n" + +"\/yaxis " + _input("YAXIS") + " def\n" + +"\/yaxisLabel (" + _input("YAXISLABEL") + ") def\n" + +"\/yaxisBits " + _input("BARBITS") + " def % bits\n" + +"\/yaxisTicBits " + _input("TICBITS") + " def\n" + +"\n" + +"\/xaxis " + _input("NUMBERING") + " def\n" + +"\/xaxisLabel (" + _input("XAXISLABEL") + ") def\n" + +"\/showEnds (" + _input("SHOWENDS") + ") def \n" + +"\n" + +"\/showFineprint true def\n" + +"\/fineprint (" + _input("FINEPRINT") + ") def\n" + +"\n" + +"\/charsPerLine " + _input("CHARSPERLINE") + " def\n" + +"\n" + +"\/showingBox " + _input("SHOWINGBOX") + " def \n" + +"\/shrinking false def % true falses\n" + +"\/shrink 1.0 def\n" + +"\/outline " + _input("OUTLINE") + " def\n" + +"\n" + +"\/IbeamFraction " + _input("ERRORBARFRACTION") + " def\n" + +"\/IbeamGray 0.50 def\n" + +"\/IbeamLineWidth 0.5 def\n" + +"\n" + +"\/fontsize " + _input("FONTSIZE") + " def\n" + +"\/titleFontsize " + _input("TITLEFONTSIZE") + " def\n" + +"\/smallFontsize " + _input("SMALLFONTSIZE") + " def\n" + +"\n" + +"\/topMargin " + _input("TOPMARGIN") + " cm def\n" + +"\/bottomMargin " + _input("BOTTOMMARGIN") + " cm def\n" + +"\n" + +"\/defaultColor [0 0 0] def \n" + +"\n" + +_input("COLORDICT") + "\n" + +"\n" + +"\/colorDict fullColourDict def\n" + +"\n" + +"% ---- DERIVED PARAMETERS ----\n" + +"\n" + +"\/leftMargin\n" + +" fontsize 3.5 mul\n" + +"\n" + +"def \n" + +"\n" + +"\/rightMargin \n" + +" %Add extra room if showing ends\n" + +" showEnds (false) eq { fontsize}{fontsize 1.5 mul} ifelse\n" + +"def\n" + +"\n" + +"\/yaxisHeight \n" + +" logoHeight \n" + +" bottomMargin sub \n" + +" topMargin sub\n" + +"def\n" + +"\n" + +"\/ticWidth fontsize 2 div def\n" + +"\n" + +"\/pointsPerBit yaxisHeight yaxisBits div def\n" + +"\n" + +"\/stackMargin 1 def\n" + +"\n" + +"% Do not add space aroung characters if characters are boxed\n" + +"\/charRightMargin \n" + +" showingBox { 0.0 } {stackMargin} ifelse\n" + +"def\n" + +"\n" + +"\/charTopMargin \n" + +" showingBox { 0.0 } {stackMargin} ifelse\n" + +"def\n" + +"\n" + +"\/charWidth\n" + +" logoWidth\n" + +" leftMargin sub\n" + +" rightMargin sub\n" + +" charsPerLine div\n" + +" charRightMargin sub\n" + +"def\n" + +"\n" + +"\/charWidth4 charWidth 4 div def\n" + +"\/charWidth2 charWidth 2 div def\n" + +"\n" + +"\/stackWidth \n" + +" charWidth charRightMargin add\n" + +"def\n" + +" \n" + +"\/numberFontsize \n" + +" fontsize charWidth lt {fontsize}{charWidth} ifelse\n" + +"def\n" + +"\n" + +"% movements to place 5'\/N and 3'\/C symbols\n" + +"\/leftEndDeltaX fontsize neg def\n" + +"\/leftEndDeltaY fontsize 1.5 mul neg def\n" + +"\/rightEndDeltaX fontsize 0.25 mul def\n" + +"\/rightEndDeltaY leftEndDeltaY def\n" + +"\n" + +"% Outline width is proporional to charWidth, \n" + +"% but no less that 1 point\n" + +"\/outlinewidth \n" + +" charWidth 32 div dup 1 gt {}{pop 1} ifelse\n" + +"def\n" + +"\n" + +"\n" + +"% ---- PROCEDURES ----\n" + +"\n" + +"\/StartLogo { \n" + +" % Save state\n" + +" save \n" + +" gsave \n" + +"\n" + +" % Print Logo Title, top center \n" + +" gsave \n" + +" SetStringFont\n" + +"\n" + +" logoWidth 2 div\n" + +" logoTitle\n" + +" stringwidth pop 2 div sub\n" + +" totalHeight\n" + +" titleFontsize sub\n" + +" moveto\n" + +"\n" + +" logoTitle\n" + +" show\n" + +" grestore\n" + +"\n" + +" % Print X-axis label, bottom center\n" + +" gsave\n" + +" SetStringFont\n" + +"\n" + +" logoWidth 2 div\n" + +" xaxisLabel\n" + +" stringwidth pop 2 div sub\n" + +" 0\n" + +" titleFontsize 3 div\n" + +" add\n" + +" moveto\n" + +"\n" + +" xaxisLabel\n" + +" show\n" + +" grestore\n" + +"\n" + +" % Show Fine Print\n" + +" showFineprint {\n" + +" gsave\n" + +" SetSmallFont\n" + +" logoWidth\n" + +" fineprint stringwidth pop sub\n" + +" smallFontsize sub\n" + +" smallFontsize 3 div\n" + +" moveto\n" + +" \n" + +" fineprint show\n" + +" grestore\n" + +" } if\n" + +"\n" + +" % Move to lower left corner of last line, first stack\n" + +" leftMargin bottomMargin translate\n" + +"\n" + +" % Move above first line ready for StartLine \n" + +" 0 totalHeight translate\n" + +"\n" + +" SetLogoFont\n" + +"} bind def\n" + +"\n" + +"\/EndLogo { \n" + +" grestore \n" + +" showpage \n" + +" restore \n" + +"} bind def\n" + +"\n" + +"\n" + +"\/StartLine { \n" + +" % move down to the bottom of the line:\n" + +" 0 logoHeight neg translate\n" + +" \n" + +" gsave \n" + +" yaxis { MakeYaxis } if\n" + +" xaxis { showEnds (true) eq {ShowLeftEnd} if } if\n" + +"} bind def\n" + +"\n" + +"\/EndLine{ \n" + +" xaxis { showEnds (true) eq {ShowRightEnd} if } if\n" + +" grestore \n" + +"} bind def\n" + +"\n" + +"\n" + +"\/MakeYaxis {\n" + +" gsave \n" + +" stackMargin neg 0 translate\n" + +" ShowYaxisBar\n" + +" ShowYaxisLabel\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowYaxisBar { \n" + +" gsave \n" + +" SetStringFont\n" + +"\n" + +" \/str 10 string def % string to hold number \n" + +" \/smallgap stackMargin 2 div def\n" + +"\n" + +" % Draw first tic and bar\n" + +" gsave \n" + +" ticWidth neg 0 moveto \n" + +" ticWidth 0 rlineto \n" + +" 0 yaxisHeight rlineto\n" + +" stroke\n" + +" grestore\n" + +"\n" + +" \n" + +" % Draw the tics\n" + +" % initial increment limit proc for\n" + +" 0 yaxisTicBits yaxisBits abs %cvi\n" + +" {\/loopnumber exch def\n" + +"\n" + +" % convert the number coming from the loop to a string\n" + +" % and find its width\n" + +" loopnumber 10 str cvrs\n" + +" \/stringnumber exch def % string representing the number\n" + +"\n" + +" stringnumber stringwidth pop\n" + +" \/numberwidth exch def % width of number to show\n" + +"\n" + +" \/halfnumberheight\n" + +" stringnumber CharBoxHeight 2 div\n" + +" def\n" + +"\n" + +" numberwidth % move back width of number\n" + +" neg loopnumber pointsPerBit mul % shift on y axis\n" + +" halfnumberheight sub % down half the digit\n" + +"\n" + +" moveto % move back the width of the string\n" + +"\n" + +" ticWidth neg smallgap sub % Move back a bit more \n" + +" 0 rmoveto % move back the width of the tic \n" + +"\n" + +" stringnumber show\n" + +" smallgap 0 rmoveto % Make a small gap \n" + +"\n" + +" % now show the tic mark\n" + +" 0 halfnumberheight rmoveto % shift up again\n" + +" ticWidth 0 rlineto\n" + +" stroke\n" + +" } for\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\/ShowYaxisLabel {\n" + +" gsave\n" + +" SetStringFont\n" + +"\n" + +" % How far we move left depends on the size of\n" + +" % the tic labels.\n" + +" \/str 10 string def % string to hold number \n" + +" yaxisBits yaxisTicBits div cvi yaxisTicBits mul \n" + +" str cvs stringwidth pop\n" + +" ticWidth 1.5 mul add neg \n" + +"\n" + +"\n" + +" yaxisHeight\n" + +" yaxisLabel stringwidth pop\n" + +" sub 2 div\n" + +"\n" + +" translate\n" + +" 90 rotate\n" + +" 0 0 moveto\n" + +" yaxisLabel show\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/StartStack { % <stackNumber> startstack\n" + +" xaxis {MakeNumber}{pop} ifelse\n" + +" gsave\n" + +"} bind def\n" + +"\n" + +"\/EndStack {\n" + +" grestore\n" + +" stackWidth 0 translate\n" + +"} bind def\n" + +"\n" + +"\n" + +"% Draw a character whose height is proportional to symbol bits\n" + +"\/MakeSymbol{ % charbits character MakeSymbol\n" + +" gsave\n" + +" \/char exch def\n" + +" \/bits exch def\n" + +"\n" + +" \/bitsHeight \n" + +" bits pointsPerBit mul \n" + +" def\n" + +"\n" + +" \/charHeight \n" + +" bitsHeight charTopMargin sub\n" + +" dup \n" + +" 0.0 gt {}{pop 0.0} ifelse % if neg replace with zero \n" + +" def \n" + +" \n" + +" charHeight 0.0 gt {\n" + +" char SetColor\n" + +" charWidth charHeight char ShowChar\n" + +"\n" + +" showingBox { % Unfilled box\n" + +" 0 0 charWidth charHeight false ShowBox\n" + +" } if\n" + +"\n" + +"\n" + +" } if\n" + +"\n" + +" grestore\n" + +"\n" + +" 0 bitsHeight translate \n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowChar { % <width> <height> <char> ShowChar\n" + +" gsave\n" + +" \/tc exch def % The character\n" + +" \/ysize exch def % the y size of the character\n" + +" \/xsize exch def % the x size of the character\n" + +"\n" + +" \/xmulfactor 1 def \n" + +" \/ymulfactor 1 def\n" + +" \/limmulfactor 0.01 def\n" + +" \/drawable true def\n" + +"\n" + +" \n" + +" % if ysize is negative, make everything upside down!\n" + +" ysize 0 lt {\n" + +" % put ysize normal in this orientation\n" + +" \/ysize ysize abs def\n" + +" xsize ysize translate\n" + +" 180 rotate\n" + +" } if\n" + +"\n" + +" shrinking {\n" + +" xsize 1 shrink sub 2 div mul\n" + +" ysize 1 shrink sub 2 div mul translate \n" + +"\n" + +" shrink shrink scale\n" + +" } if\n" + +"\n" + +" % Calculate the font scaling factors\n" + +" % Loop twice to catch small correction due to first scaling\n" + +" 2 {\n" + +" gsave\n" + +" xmulfactor ymulfactor scale\n" + +" \n" + +" ysize % desired size of character in points\n" + +" tc CharBoxHeight \n" + +" dup 0.0 ne {\n" + +" div % factor by which to scale up the character\n" + +" \/ymulfactor exch def\n" + +" } % end if\n" + +" {pop pop}\n" + +" ifelse\n" + +"\n" + +" xsize % desired size of character in points\n" + +" tc CharBoxWidth \n" + +" dup 0.0 ne {\n" + +" div % factor by which to scale up the character\n" + +" \/xmulfactor exch def\n" + +" } % end if\n" + +" {pop pop}\n" + +" ifelse\n" + +" grestore\n" + +" % if the multiplication factors get too small we need to avoid a crash\n" + +" xmulfactor limmulfactor lt {\n" + +" \/xmulfactor 1 def\n" + +" \/drawable false def\n" + +" } if\n" + +" ymulfactor limmulfactor lt {\n" + +" \/ymulfactor 1 def\n" + +" \/drawable false def\n" + +" } if\n" + +" } repeat\n" + +"\n" + +" % Adjust horizontal position if the symbol is an I\n" + +" tc (I) eq {\n" + +" charWidth 2 div % half of requested character width\n" + +" tc CharBoxWidth 2 div % half of the actual character\n" + +" sub 0 translate\n" + +" % Avoid x scaling for I \n" + +" \/xmulfactor 1 def \n" + +" } if\n" + +"\n" + +"\n" + +" % ---- Finally, draw the character\n" + +" drawable { \n" + +" newpath\n" + +" xmulfactor ymulfactor scale\n" + +"\n" + +" % Move lower left corner of character to start point\n" + +" tc CharBox pop pop % llx lly : Lower left corner\n" + +" exch neg exch neg\n" + +" moveto\n" + +"\n" + +" outline { % outline characters:\n" + +" outlinewidth setlinewidth\n" + +" tc true charpath\n" + +" gsave 1 setgray fill grestore\n" + +" clip stroke\n" + +" } { % regular characters\n" + +" tc show\n" + +" } ifelse\n" + +" } if\n" + +"\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowBox { % x1 y1 x2 y2 filled ShowBox\n" + +" gsave\n" + +" \/filled exch def \n" + +" \/y2 exch def\n" + +" \/x2 exch def\n" + +" \/y1 exch def\n" + +" \/x1 exch def\n" + +" newpath\n" + +" x1 y1 moveto\n" + +" x2 y1 lineto\n" + +" x2 y2 lineto\n" + +" x1 y2 lineto\n" + +" closepath\n" + +"\n" + +" clip\n" + +" \n" + +" filled {\n" + +" fill\n" + +" }{ \n" + +" 0 setgray stroke \n" + +" } ifelse\n" + +"\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/MakeNumber { % number MakeNumber\n" + +" gsave\n" + +" SetNumberFont\n" + +" stackWidth 0 translate\n" + +" 90 rotate % rotate so the number fits\n" + +" dup stringwidth pop % find the length of the number\n" + +" neg % prepare for move\n" + +" stackMargin sub % Move back a bit\n" + +" charWidth (0) CharBoxHeight % height of numbers\n" + +" sub 2 div %\n" + +" moveto % move back to provide space\n" + +" show\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/Ibeam{ % heightInBits Ibeam\n" + +" gsave\n" + +" % Make an Ibeam of twice the given height in bits\n" + +" \/height exch pointsPerBit mul def \n" + +" \/heightDRAW height IbeamFraction mul def\n" + +"\n" + +" IbeamLineWidth setlinewidth\n" + +" IbeamGray setgray \n" + +"\n" + +" charWidth2 height neg translate\n" + +" ShowIbar\n" + +" newpath\n" + +" 0 0 moveto\n" + +" 0 heightDRAW rlineto\n" + +" stroke\n" + +" newpath\n" + +" 0 height moveto\n" + +" 0 height rmoveto\n" + +" currentpoint translate\n" + +" ShowIbar\n" + +" newpath\n" + +" 0 0 moveto\n" + +" 0 heightDRAW neg rlineto\n" + +" currentpoint translate\n" + +" stroke\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowIbar { % make a horizontal bar\n" + +" gsave\n" + +" newpath\n" + +" charWidth4 neg 0 moveto\n" + +" charWidth4 0 lineto\n" + +" stroke\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowLeftEnd {\n" + +" gsave\n" + +" SetStringFont\n" + +" leftEndDeltaX leftEndDeltaY moveto\n" + +" logoType (NA) eq {(5) show ShowPrime} if\n" + +" logoType (AA) eq {(N) show} if\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowRightEnd { \n" + +" gsave\n" + +" SetStringFont\n" + +" rightEndDeltaX rightEndDeltaY moveto\n" + +" logoType (NA) eq {(3) show ShowPrime} if\n" + +" logoType (AA) eq {(C) show} if\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"\/ShowPrime {\n" + +" gsave\n" + +" SetPrimeFont\n" + +" (\\242) show \n" + +" grestore\n" + +"} bind def\n" + +"\n" + +" \n" + +"\/SetColor{ % <char> SetColor\n" + +" dup colorDict exch known {\n" + +" colorDict exch get aload pop setrgbcolor\n" + +" } {\n" + +" pop\n" + +" defaultColor aload pop setrgbcolor\n" + +" } ifelse \n" + +"} bind def\n" + +"\n" + +"% define fonts\n" + +"\/SetTitleFont {\/Times-Bold findfont titleFontsize scalefont setfont} bind def\n" + +"\/SetLogoFont {\/Helvetica-Bold findfont charWidth scalefont setfont} bind def\n" + +"\/SetStringFont{\/Helvetica-Bold findfont fontsize scalefont setfont} bind def\n" + +"\/SetPrimeFont {\/Symbol findfont fontsize scalefont setfont} bind def\n" + +"\/SetSmallFont {\/Helvetica findfont smallFontsize scalefont setfont} bind def\n" + +"\n" + +"\/SetNumberFont {\n" + +" \/Helvetica-Bold findfont \n" + +" numberFontsize\n" + +" scalefont\n" + +" setfont\n" + +"} bind def\n" + +"\n" + +"%Take a single character and return the bounding box\n" + +"\/CharBox { % <char> CharBox <lx> <ly> <ux> <uy>\n" + +" gsave\n" + +" newpath\n" + +" 0 0 moveto\n" + +" % take the character off the stack and use it here:\n" + +" true charpath \n" + +" flattenpath \n" + +" pathbbox % compute bounding box of 1 pt. char => lx ly ux uy\n" + +" % the path is here, but toss it away ...\n" + +" grestore\n" + +"} bind def\n" + +"\n" + +"\n" + +"% The height of a characters bounding box\n" + +"\/CharBoxHeight { % <char> CharBoxHeight <num>\n" + +" CharBox\n" + +" exch pop sub neg exch pop\n" + +"} bind def\n" + +"\n" + +"\n" + +"% The width of a characters bounding box\n" + +"\/CharBoxWidth { % <char> CharBoxHeight <num>\n" + +" CharBox\n" + +" pop exch pop sub neg \n" + +"} bind def\n" + +"\n" + +"% Set the colour scheme to be faded to indicate trimming\n" + +"\/MuteColour {\n" + +" \/colorDict mutedColourDict def\n" + +"} def\n" + +"\n" + +"% Restore the colour scheme to the normal colours\n" + +"\/RestoreColour {\n" + +" \/colorDict fullColourDict def\n" + +"} def\n" + +"\n" + +"% Draw the background for a trimmed section\n" + +"% takes the number of columns as a parameter\n" + +"\/DrawTrimBg { % <num> DrawTrimBox\n" + +" \/col exch def\n" + +" \n" + +" \/boxwidth \n" + +" col stackWidth mul \n" + +" def\n" + +" \n" + +" gsave\n" + +" 0.97 setgray\n" + +"\n" + +" newpath\n" + +" 0 0 moveto\n" + +" boxwidth 0 rlineto\n" + +" 0 yaxisHeight rlineto\n" + +" 0 yaxisHeight lineto\n" + +" closepath\n" + +" \n" + +" fill\n" + +" grestore\n" + +"} def\n" + +"\n" + +"\/DrawTrimEdge {\n" + +" gsave\n" + +" 0.2 setgray\n" + +" [2] 0 setdash\n" + +"\n" + +" newpath\n" + +" 0 0 moveto\n" + +" 0 yaxisHeight lineto\n" + +" \n" + +" stroke\n" + +"\n" + +"} def\n" + +"\n" + +"\n" + +"% Deprecated names\n" + +"\/startstack {StartStack} bind def\n" + +"\/endstack {EndStack} bind def\n" + +"\/makenumber {MakeNumber} bind def\n" + +"\/numchar { MakeSymbol } bind def\n" + +"\n" + +"%%EndProlog\n" + +"\n" + +"%%Page: 1 1\n" + +"StartLogo\n" + +"\n" + +_input("DATA") + "\n" + +"\n" + +"EndLogo\n" + +"\n" + +"%%EOF\n" + ); +}</script> + <script> +//====================================================================== +// start Alphabet object +//====================================================================== +var Alphabet = function(alphabet, background) { + "use strict"; + var i, j, sym, aliases, complement, comp_e_sym, ambigs, generate_background; + generate_background = (background == null); + if (generate_background) { + background = []; + for (i = 0; i < alphabet.ncore; i++) background[i] = 1.0 / alphabet.ncore; + } else if (alphabet.ncore != background.length) { + throw new Error("The background length does not match the alphabet length."); + } + this.name = alphabet.name; + this.like = (alphabet.like != null ? alphabet.like.toUpperCase() : null); + this.ncore = alphabet.ncore; + this.symbols = alphabet.symbols; + this.background = background; + this.genbg = generate_background; + this.encode = {}; + this.encode2core = {}; + this.complement = {}; + // check if all symbols are same case + var seen_uc = false; + var seen_lc = false; + var check_case = function (syms) { + var s, sym; + if (typeof syms === "string") { + for (s = 0; s < syms.length; s++) { + sym = syms.charAt(s); + if (sym >= 'a' && sym <= 'z') seen_lc = true; + else if (sym >= 'A' && sym <= 'Z') seen_uc = true; + } + } + }; + for (i = 0; i < this.symbols.length; i++) { + check_case(this.symbols[i].symbol); + check_case(this.symbols[i].aliases); + } + // now map symbols to indexes + var update_array = function(array, syms, index) { + var s, sym; + if (typeof syms === "string") { + for (s = 0; s < syms.length; s++) { + sym = syms.charAt(s); + array[sym] = index; + // when only a single case is used, then encode as case insensitive + if (seen_uc != seen_lc) { + if (sym >= 'a' && sym <= 'z') { + array[sym.toUpperCase()] = index; + } else if (sym >= 'A' && sym <= 'Z') { + array[sym.toLowerCase()] = index; + } + } + } + } + } + // map core symbols to index + for (i = 0; i < this.ncore; i++) { + update_array(this.encode2core, this.symbols[i].symbol, i); + update_array(this.encode, this.symbols[i].symbol, i); + update_array(this.encode2core, this.symbols[i].aliases, i); + update_array(this.encode, this.symbols[i].aliases, i); + } + // map ambigous symbols to index + ambigs = {}; + for (i = this.ncore; i < this.symbols.length; i++) { + update_array(this.encode, this.symbols[i].symbol, i); + update_array(this.encode, this.symbols[i].aliases, i); + ambigs[this.symbols[i].equals] = i; + } + // determine complements + for (i = 0; i < this.ncore; i++) { + complement = this.symbols[i].complement; + if (typeof complement === "string") { + this.complement[i] = this.encode2core[complement]; + } + } + next_symbol: + for (i = this.ncore; i < this.symbols.length; i++) { + complement = ""; + for (j = 0; j < this.symbols[i].equals.length; j++) { + comp_e_sym = this.complement[this.encode2core[this.symbols[i].equals.charAt(j)]]; + if (typeof comp_e_sym !== "number") continue next_symbol; + complement += this.symbols[comp_e_sym].symbol; + } + complement = complement.split("").sort().join(""); + if (typeof ambigs[complement] === "number") { + this.complement[i] = ambigs[complement]; + } + } + // determine case insensitivity + this.case_insensitive = true; + if (seen_uc == seen_lc) { + // when there is a mixture of cases it probably won't + // be case insensitive but we still need to check + loop: + for (i = 0; i < this.symbols.length; i++) { + sym = this.symbols[i].symbol; + if (sym >= 'A' && sym <= 'Z') { + if (this.encode[sym.toLowerCase()] != i) { + this.case_insensitive = false; + break loop; + } + } else if (sym >= 'a' && sym <= 'z') { + if (this.encode[sym.toUpperCase()] != i) { + this.case_insensitive = false; + break loop; + } + } + aliases = this.symbols[i].aliases; + if (aliases != null) { + for (j = 0; j < aliases.length; j++) { + sym = aliases.charAt(j); + if (sym >= 'A' && sym <= 'Z') { + if (this.encode[sym.toLowerCase()] != i) { + this.case_insensitive = false; + break loop; + } + } else if (sym >= 'a' && sym <= 'z') { + if (this.encode[sym.toUpperCase()] != i) { + this.case_insensitive = false; + break loop; + } + } + } + } + } + } + // normalise aliases to remove the prime symbol and eliminate + // the alternate cases when the alphabet is case insensitive + var seen, out; + for (i = 0; i < this.symbols.length; i++) { + sym = this.symbols[i].symbol; + aliases = this.symbols[i].aliases; + if (typeof aliases != "string") aliases = ""; + seen = {}; + out = []; + if (this.case_insensitive) { + sym = sym.toUpperCase(); + aliases = aliases.toUpperCase(); + } + seen[sym] = true; + for (j = 0; j < aliases.length; j++) { + if (!seen[aliases.charAt(j)]) { + seen[aliases.charAt(j)] = true; + out.push(aliases.charAt(j)); + } + } + this.symbols[i].aliases = out.sort().join(""); + } +}; +// return the name of the alphabet +Alphabet.prototype.get_alphabet_name = function() { + return this.name; +}; +// return if the alphabet can be complemented +Alphabet.prototype.has_complement = function() { + return (typeof this.symbols[0].complement === "string"); +}; +// return true if an uppercase letter has the same meaning as the lowercase form +Alphabet.prototype.is_case_insensitive = function() { + return this.case_insensitive; +}; +// return the information content of an alphabet letter +Alphabet.prototype.get_ic = function() { + return Math.log(this.ncore) / Math.LN2; +}; +// return the count of the core alphabet symbols +Alphabet.prototype.get_size_core = function() { + return this.ncore; +}; +// return the count of all alphabet symbols +Alphabet.prototype.get_size_full = function() { + return this.symbols.length; +}; +// return the symbol for the given alphabet index +Alphabet.prototype.get_symbol = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("Alphabet index out of bounds"); + } + return this.symbols[alph_index].symbol; +}; +// return the aliases for the given alphabet index +Alphabet.prototype.get_aliases = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("Alphabet index out of bounds"); + } + var sym_obj = this.symbols[alph_index]; + return (sym_obj.aliases != null ? sym_obj.aliases : ""); +}; +// return the name for the given alphabet index +Alphabet.prototype.get_name = function(alph_index) { + "use strict"; + var sym; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("Alphabet index out of bounds"); + } + sym = this.symbols[alph_index]; + return (typeof sym.name === "string" ? sym.name : sym.symbol); +}; +// return the alphabet it is like or null +Alphabet.prototype.get_like = function() { + "use strict"; + return this.like; +}; +// return the index of the complement for the given alphabet index +Alphabet.prototype.get_complement = function(alph_index) { + var comp_e_sym = this.complement[alph_index]; + if (typeof comp_e_sym === "number") { + return comp_e_sym; + } else { + return -1; + } +}; +// return a string containing the core symbols +Alphabet.prototype.get_symbols = function() { + "use strict"; + var i, core_symbols; + core_symbols = ""; + for (i = 0; i < this.ncore; i++) { + core_symbols += this.symbols[i].symbol; + } + return core_symbols; +}; +// return if the background was not a uniform generated background +Alphabet.prototype.has_bg = function() { + "use strict"; + return !this.genbg; +}; +// get the background frequency for the index +Alphabet.prototype.get_bg_freq = function(alph_index) { + "use strict"; + var freq, i, symbols; + if (alph_index >= 0) { + if (alph_index < this.ncore) { + return this.background[alph_index]; + } else if (alph_index < this.symbols.length) { + freq = 0; + symbols = this.symbols[alph_index].equals; + for (i = 0; i < symbols.length; i++) { + freq += this.background[this.encode2core[symbols.charAt(i)]]; + } + return freq; + } + } + throw new Error("The alphabet index is out of range."); +}; +// get the colour of the index +Alphabet.prototype.get_colour = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("BAD_ALPHABET_INDEX"); + } + if (typeof this.symbols[alph_index].colour != "string") { + return "black"; + } + return "#" + this.symbols[alph_index].colour; +}; +// get the rgb componets of the colour at the index +Alphabet.prototype.get_rgb = function(alph_index) { + "use strict"; + if (alph_index < 0 || alph_index >= this.symbols.length) { + throw new Error("BAD_ALPHABET_INDEX"); + } + if (typeof this.symbols[alph_index].colour != "string") { + return {"red": 0, "green": 0, "blue": 0}; + } + var colour = this.symbols[alph_index].colour; + var red = parseInt(colour.substr(0, 2), 16) / 255; + var green = parseInt(colour.substr(2, 2), 16) / 255; + var blue = parseInt(colour.substr(4, 2), 16) / 255; + return {"red": red, "green": green, "blue": blue}; +}; +// convert a symbol into the index +Alphabet.prototype.get_index = function(letter) { + "use strict"; + var alph_index; + alph_index = this.encode[letter]; + if (typeof alph_index === "undefined") { + return -1; + } + return alph_index; +}; +// convert a symbol into the list of core indexes that it equals +Alphabet.prototype.get_indexes = function(letter) { + "use strict"; + var alph_index, comprise_str, i, comprise_list; + alph_index = this.encode[letter]; + if (typeof alph_index === "undefined") { + throw new Error("Unknown letter"); + } + comprise_str = this.symbols[alph_index].equals; + comprise_list = []; + if (typeof comprise_str == "string") { + for (i = 0; i < comprise_str.length; i++) { + comprise_list.push(this.encode2core[comprise_str.charAt(i)]); + } + } else { + comprise_list.push(alph_index); + } + return comprise_list; +}; +// check if a symbol is the primary way of representing the symbol in the alphabet +Alphabet.prototype.is_prime_symbol = function(letter) { + var alph_index; + alph_index = this.encode[letter]; + if (alph_index == null) return false; + if (this.is_case_insensitive()) { + return (this.symbols[alph_index].symbol.toUpperCase() == letter.toUpperCase()); + } else { + return (this.symbols[alph_index].symbol == letter); + } +}; +// compare 2 alphabets +Alphabet.prototype.equals = function(other) { + "use strict"; + var i, sym1, sym2; + // first check that it's actually an alphabet object + if (!(typeof other === "object" && other != null && other instanceof Alphabet)) { + return false; + } + // second shortcircuit if it's the same object + if (this === other) return true; + // compare + if (this.name !== other.name) return false; + if (this.ncore !== other.ncore) return false; + if (this.symbols.length !== other.symbols.length) return false; + for (i = 0; i < this.symbols.length; i++) { + sym1 = this.symbols[i]; + sym2 = other.symbols[i]; + if (sym1.symbol !== sym2.symbol) return false; + if (sym1.aliases !== sym2.aliases) return false; + if (sym1.name !== sym2.name) return false; + if (typeof sym1.colour !== typeof sym2.colour || + (typeof sym1.colour === "string" && typeof sym2.colour === "string" && + parseInt(sym1.colour, 16) != parseInt(sym2.colour, 16))) { + return false; + } + if (sym1.complement !== sym2.complement) return false; + if (sym1.equals !== sym2.equals) return false; + } + return true; +}; +Alphabet.prototype.check_core_subset = function(super_alph) { + var complement_same = true; + var seen_set = {}; + var sub_i, sub_symbol, super_i, super_symbol; + for (sub_i = 0; sub_i < this.ncore; sub_i++) { + sub_symbol = this.symbols[sub_i]; + super_i = super_alph.encode[sub_symbol.symbol]; + if (super_i == null) return 0; + super_symbol = super_alph.symbols[super_i]; + if (seen_set[super_i]) return 0; + seen_set[super_i] = true; + // check complement + if (sub_symbol.complement != null && super_symbol.complement != null) { + if (super_alph.encode[sub_symbol.complement] != super_alph.encode[super_symbol.complement]) { + complement_same = false; + } + } else if (sub_symbol.complement != null || super_symbol.complement != null) { + complement_same = false; + } + } + return (complement_same ? 1 : -1); +}; +// convert a sequence to its reverse complement +Alphabet.prototype.invcomp_seq = function(seq) { + "use strict"; + var syms, i, e_sym, comp_e_sym; + if (!this.has_complement()) throw new Error("Alphabet must be complementable"); + syms = seq.split(""); + for (i = 0; i < syms.length; i++) { + e_sym = this.encode[syms[i]]; + if (typeof e_sym === "undefined") { + e_sym = this.ncore; // wildcard + } + comp_e_sym = this.complement[e_sym]; + if (typeof comp_e_sym === "undefined") { + comp_e_sym = e_sym; // not complementable + } + syms[i] = this.symbols[comp_e_sym].symbol; + } + return syms.reverse().join(""); +}; +// convert the alphabet to the text version +Alphabet.prototype.as_text = function() { + "use strict"; + function name_as_text(name) { + var i, c, out; + out = "\""; + for (i = 0; i < name.length; i++) { + c = name.charAt(i); + if (c == "\"") { + out += "\\\""; + } else if (c == "/") { + out += "\\/"; + } else if (c == "\\") { + out += "\\\\"; + } else { + out += c; + } + } + out += "\""; + return out; + } + function symbol_as_text(sym) { + var out; + out = sym.symbol; + if (typeof sym.name === "string" && sym.name != sym.symbol) { + out += " " + name_as_text(sym.name); + } + if (typeof sym.colour === "string") { + out += " " + sym.colour; + } + return out; + } + var out, i, j, c, sym; + out = ""; + // output core symbols with 2 way complements + for (i = 0; i < this.ncore; i++) { + c = this.complement[i]; + if (typeof c === "number" && i < c && this.complement[c] === i) { + out += symbol_as_text(this.symbols[i]) + " ~ " + symbol_as_text(this.symbols[c]) + "\n"; + } + } + // output core symbols with no complement + for (i = 0; i < this.ncore; i++) { + if (typeof this.complement[i] === "undefined") { + out += symbol_as_text(this.symbols[i]) + "\n"; + } + } + // output ambiguous symbols that have comprising characters + for (i = this.ncore; i < this.symbols.length; i++) { + if (this.symbols[i].equals.length == 0) break; + out += symbol_as_text(this.symbols[i]) + " = " + this.symbols[i].equals + "\n"; + if (typeof this.symbols[i].aliases === "string") { + for (j = 0; j < this.symbols[i].aliases.length; j++) { + if (this.symbols[i].aliases.charAt(j) == this.symbols[i].symbol) continue; + out += this.symbols[i].aliases.charAt(j) + " = " + this.symbols[i].equals + "\n"; + } + } + } + // output aliases of core symbols + for (i = 0; i < this.ncore; i++) { + if (typeof this.symbols[i].aliases === "string") { + for (j = 0; j < this.symbols[i].aliases.length; j++) { + if (this.symbols[i].aliases.charAt(j) == this.symbols[i].symbol) continue; + out += this.symbols[i].aliases.charAt(j) + " = " + this.symbols[i].symbol + "\n"; + } + } + } + // output gap symbols + i = this.symbols.length - 1; + if (this.symbols[i].equals.length == 0) { + out += symbol_as_text(this.symbols[i]) + " =\n"; + if (typeof this.symbols[i].aliases === "string") { + for (j = 0; j < this.symbols[i].aliases.length; j++) { + if (this.symbols[i].aliases.charAt(j) == this.symbols[i].symbol) continue; + out += this.symbols[i].aliases.charAt(j) + " =\n"; + } + } + } + return out; +}; +// output the alphabet as it appears in minimal MEME format +Alphabet.prototype.as_meme = function() { + "use strict"; + function name_as_text(name) { + var i, c, out; + out = "\""; + for (i = 0; i < name.length; i++) { + c = name.charAt(i); + if (c == "\"") { + out += "\\\""; + } else if (c == "/") { + out += "\\/"; + } else if (c == "\\") { + out += "\\\\"; + } else { + out += c; + } + } + out += "\""; + return out; + } + if (this.equals(AlphStd.DNA)) { + return "ALPHABET= ACGT\n"; + } else if (this.equals(AlphStd.PROTEIN)) { + return "ALPHABET= ACDEFGHIKLMNPQRSTVWY\n"; + } else { + return "ALPHABET" + + (this.name != null ? " " + name_as_text(this.name) : "") + + (this.like != null ? " " + this.like + "-LIKE" : "") + "\n" + + this.as_text() + "END ALPHABET\n"; + } +}; + +// Returns a table showing all the letters in the alphabet +Alphabet.prototype.as_table = function() { + "use strict"; + var i, j, row, th, td, aliases, equals, sym; + var table = document.createElement("table"); + // create the core symbol header + row = table.insertRow(table.rows.length); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Symbol(s)")); + row.appendChild(th); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Name")); + row.appendChild(th); + th = document.createElement("th"); + if (this.has_complement()) { + th.appendChild(document.createTextNode("Complement")); + } + row.appendChild(th); + // list the core symbols + for (i = 0; i < this.ncore; i++) { + row = table.insertRow(table.rows.length); + td = document.createElement("td"); + if (this.symbols[i].colour != null) { + td.style.color = '#' + this.symbols[i].colour; + } + td.appendChild(document.createTextNode(this.symbols[i].symbol)); + aliases = this.get_aliases(i); + if (aliases.length > 0) { + td.appendChild(document.createTextNode(' ' + aliases.split('').join(' '))); + } + row.appendChild(td); + td = document.createElement("td"); + if (this.symbols[i].name != null) { + td.appendChild(document.createTextNode(this.symbols[i].name)); + } + row.appendChild(td); + td = document.createElement("td"); + if (this.symbols[i].complement != null) { + td.style.color = this.get_colour(this.get_index(this.symbols[i].complement)); + td.appendChild(document.createTextNode(this.symbols[i].complement)); + } + row.appendChild(td); + } + // create the ambiguous symbol header + row = table.insertRow(table.rows.length); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Symbol(s)")); + row.appendChild(th); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Name")); + row.appendChild(th); + th = document.createElement("th"); + th.appendChild(document.createTextNode("Matches")); + row.appendChild(th); + // list the ambiguous symbols + for (i = this.ncore; i < this.symbols.length; i++) { + row = table.insertRow(table.rows.length); + td = document.createElement("td"); + if (this.symbols[i].colour != null) { + td.style.color = '#' + this.symbols[i].colour; + } + td.appendChild(document.createTextNode(this.symbols[i].symbol)); + aliases = this.get_aliases(i); + if (aliases.length > 0) { + td.appendChild(document.createTextNode(' ' + aliases.split('').join(' '))); + } + row.appendChild(td); + td = document.createElement("td"); + if (this.symbols[i].name != null) { + td.appendChild(document.createTextNode(this.symbols[i].name)); + } + row.appendChild(td); + td = document.createElement("td"); + equals = this.symbols[i].equals.split(''); + for (j = 0; j < equals.length; j++) { + if (j != 0) td.appendChild(document.createTextNode(' ')); + sym = document.createElement("span"); + sym.style.color = this.get_colour(this.get_index(equals[j])); + sym.appendChild(document.createTextNode(equals[j])); + td.appendChild(sym); + } + row.appendChild(td); + } + return table; +}; + +// returns a dictionary of the colours for EPS +Alphabet.prototype._as_eps_dict = function() { + "use strict"; + var i, sym, rgb; + var out = "/fullColourDict <<\n"; + for (i = 0; i < this.ncore; i++) { + sym = this.get_symbol(i); + sym = sym.replace(/\\/g, "\\\\"); + sym = sym.replace(/\(/g, "\\("); + sym = sym.replace(/\)/g, "\\)"); + rgb = this.get_rgb(i); + out += " (" + sym + ") [" + rgb.red.toFixed(4) + " " + rgb.green.toFixed(4) + " " + rgb.blue.toFixed(4) + "]\n"; + } + out += ">> def\n"; + out += "/mutedColourDict <<\n"; + for (i = 0; i < this.ncore; i++) { + sym = this.get_symbol(i); + sym = sym.replace(/\\/g, "\\\\"); + sym = sym.replace(/\(/g, "\\("); + sym = sym.replace(/\)/g, "\\)"); + rgb = Alphabet.lighten_colour(this.get_rgb(i)); + out += " (" + sym + ") [" + rgb.red.toFixed(4) + " " + rgb.green.toFixed(4) + " " + rgb.blue.toFixed(4) + "]\n"; + } + out += ">> def\n"; + return out; +}; + +// return the alphabet name or a list of primary symbols +Alphabet.prototype.toString = function() { + "use strict"; + if (this.name != null) { + return this.name; + } else { + return this.get_symbols(); + } +}; + +//~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +// Helper functions +//~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + +// Convert a colour specified in RGB colourspace values into LAB colourspace +Alphabet.rgb2lab = function(rgb) { + "use strict"; + var xyzHelper, labHelper; + // XYZ helper + xyzHelper = function(value) { + if (value > 0.0445) { + value = (value + 0.055) / 1.055; + value = Math.pow(value, 2.4); + } else { + value /= 12.92; + } + value *= 100; + return value; + }; + // lab helper + labHelper = function(value) { + if (value > 0.008856) { + value = Math.pow(value, 1.0 / 3.0); + } else { + value = (7.787 * value) + (16.0 / 116.0); + } + return value; + }; + // convert into XYZ colourspace + var c1, c2, c3; + if (typeof rgb == "number") { + c1 = xyzHelper(((rgb >> 16) & 0xFF) / 255.0); + c2 = xyzHelper(((rgb >> 8) & 0xFF) / 255.0); + c3 = xyzHelper((rgb & 0xFF) / 255.0); + } else { + c1 = xyzHelper(rgb.red); + c2 = xyzHelper(rgb.green); + c3 = xyzHelper(rgb.blue); + } + var x = (c1 * 0.4124) + (c2 * 0.3576) + (c3 * 0.1805); + var y = (c1 * 0.2126) + (c2 * 0.7152) + (c3 * 0.0722); + var z = (c1 * 0.0193) + (c2 * 0.1192) + (c3 * 0.9505); + // convert into Lab colourspace + c1 = labHelper(x / 95.047); + c2 = labHelper(y / 100.0); + c3 = labHelper(z / 108.883); + var l = (116.0 * c2) - 16; + var a = 500.0 * (c1 - c2); + var b = 200.0 * (c2 - c3); + return {"l": l, "a": a, "b": b}; +}; + +// Convert a colour specified in HSV colourspace into RGB colourspace +Alphabet.hsv2rgb = function(hue, sat, value, output_object) { + // achromatic (grey) + var r = value; + var g = value; + var b = value; + if (sat != 0) { + var h = hue / 60.0; + var i = Math.floor(h); + var f = h - i; + var p = value * (1.0 - sat); + var q = value * (1.0 - (sat * f)); + var t = value * (1.0 - (sat * (1.0 - f))); + if (i == 0) { + r = value; + g = t; + b = p; + } else if (i == 1) { + r = q; + g = value; + b = p; + } else if (i == 2) { + r = p; + g = value; + b = t; + } else if (i == 3) { + r = p; + g = q; + b = value; + } else if (i == 4) { + r = t; + g = p; + b = value; + } else { + r = value; + g = p; + b = q; + } + } + if (output_object) { + return {"red": r, "green": g, "blue": b}; + } else { + return (Math.floor(r * 255) << 15) | (Math.floor(g * 255) << 8) | (Math.floor(b * 255)); + } +}; + +// Calculate a distance score between two colours in LAB colourspace +Alphabet.lab_dist = function(lab1, lab2) { + var c1 = Math.sqrt((lab1.l * lab1.l) + (lab1.a * lab1.a)); + var c2 = Math.sqrt((lab2.l * lab2.l) + (lab2.a * lab2.a)); + var dc = c1 - c2; + var dl = lab1.l - lab2.l; + var da = lab1.a - lab2.a; + var db = lab1.b - lab2.b; + // we don't want NaN due to rounding errors so fudge things a bit... + var dh = 0; + var dh_squared = (da * da) + (db * db) - (dc * dc); + if (dh_squared > 0) { + dh = Math.sqrt(dh_squared); + } + var first = dl; + var second = dc / (1.0 + (0.045 * c1)); + var third = dh / (1.0 + (0.015 * c1)); + return Math.sqrt((first * first) + (second * second) + (third * third)); +}; + +// convert an RGB value into a HSL value +Alphabet.rgb2hsl = function(rgb) { + "use strict"; + var min, max, delta, h, s, l, r, g, b; + if (typeof rgb == "number") { + r = ((rgb >> 16) & 0xFF) / 255.0; + g = ((rgb >> 8) & 0xFF) / 255.0; + b = (rgb & 0xFF) / 255.0; + } else { + r = rgb.red; + g = rgb.green; + b = rgb.blue; + } + min = Math.min(r, g, b); + max = Math.max(r, g, b); + delta = max - min; + l = min + (delta / 2); + if (max == min) { + h = 0; // achromatic (grayscale) + s = 0; + } else { + if (l > 0.5) { + s = delta / (2 - max - min); + } else { + s = delta / (max + min); + } + if (max == r) { + h = (g - b) / delta; + if (g < b) h += 6; + } else if (max == g) { + h = ((b - r) / delta) + 2; + } else { + h = ((r - g) / delta) + 4; + } + h /= 6; + } + return {"h": h, "s": s, "l": l}; +}; + +// convert a HSL value into an RGB value +Alphabet.hsl2rgb = function(hsl, output_object) { + "use strict"; + function _hue(p, q, t) { + "use strict"; + if (t < 0) t += 1; + else if (t > 1) t -= 1; + if (t < (1.0 / 6.0)) { + return p + ((q - p) * 6.0 * t); + } else if (t < 0.5) { + return q; + } else if (t < (2.0 / 3.0)) { + return p + ((q - p) * ((2.0 / 3.0) - t) * 6.0); + } else { + return p; + } + } + var r, g, b, p, q; + if (hsl.s == 0) { + // achromatic (grayscale) + r = hsl.l; + g = hsl.l; + b = hsl.l; + } else { + if (hsl.l < 0.5) { + q = hsl.l * (1 + hsl.s); + } else { + q = hsl.l + hsl.s - (hsl.l * hsl.s); + } + p = (2 * hsl.l) - q; + r = _hue(p, q, hsl.h + (1.0 / 3.0)); + g = _hue(p, q, hsl.h); + b = _hue(p, q, hsl.h - (1.0 / 3.0)); + } + if (output_object) { + return {"red": r, "green": g, "blue": b}; + } else { + return (Math.floor(r * 255) << 15) | (Math.floor(g * 255) << 8) | (Math.floor(b * 255)); + } +}; + +Alphabet.lighten_colour = function(rgb) { + "use strict"; + var hsl = Alphabet.rgb2hsl(rgb); + hsl.l += (1.0 - hsl.l) * 2 / 3; + return Alphabet.hsl2rgb(hsl, typeof rgb != "number"); +}; + +//====================================================================== +// end Alphabet object +//====================================================================== + +//====================================================================== +// start StandardAlphabet object +//====================================================================== + +// an extension of the alphabet object to support some additional fields +// only present in standard alphabets. +var StandardAlphabet = function(enum_code, enum_name, alphabet_data) { + Alphabet.apply(this, [alphabet_data]); + this.enum_code = enum_code; + this.enum_name = enum_name; +}; +StandardAlphabet.prototype = Alphabet.prototype; +StandardAlphabet.prototype.constructor = StandardAlphabet; + +// A unique code for this standard alphabet. +// This code will be a power of 2 to enable creation of bitsets for +// a selection of standard alphabets. +StandardAlphabet.prototype.get_code = function() { + return this.enum_code; +}; + +// A unique name for this standard alphabet. +// this name will be all upper case and the same as the property that +// refers to this alphabet in the AlphStd collection. +StandardAlphabet.prototype.get_enum = function() { + return this.enum_name; +}; + +//====================================================================== +// end StandardAlphabet object +//====================================================================== + +// A collection of standard alphabets. +var AlphStd = { + RNA: new StandardAlphabet(1, "RNA", { + "name": "RNA", + "like": "RNA", + "ncore": 4, + "symbols": [ + {"symbol": "A", "name": "Adenine", "colour": "CC0000"}, + {"symbol": "C", "name": "Cytosine", "colour": "0000CC"}, + {"symbol": "G", "name": "Guanine", "colour": "FFB300"}, + {"symbol": "U", "name": "Uracil", "colour": "008000", + "aliases": "T"}, + {"symbol": "N", "name": "Any base", "equals": "ACGU", "aliases": "X."}, + {"symbol": "V", "name": "Not U", "equals": "ACG"}, + {"symbol": "H", "name": "Not G", "equals": "ACU"}, + {"symbol": "D", "name": "Not C", "equals": "AGU"}, + {"symbol": "B", "name": "Not A", "equals": "CGU"}, + {"symbol": "M", "name": "Amino", "equals": "AC"}, + {"symbol": "R", "name": "Purine", "equals": "AG"}, + {"symbol": "W", "name": "Weak", "equals": "AU"}, + {"symbol": "S", "name": "Strong", "equals": "CG"}, + {"symbol": "Y", "name": "Pyrimidine", "equals": "CU"}, + {"symbol": "K", "name": "Keto", "equals": "GU"} + ] + }), + DNA: new StandardAlphabet(2, "DNA", { + "name": "DNA", + "like": "DNA", + "ncore": 4, + "symbols": [ + {"symbol": "A", "name": "Adenine", "colour": "CC0000", "complement": "T"}, + {"symbol": "C", "name": "Cytosine", "colour": "0000CC", "complement": "G"}, + {"symbol": "G", "name": "Guanine", "colour": "FFB300", "complement": "C"}, + {"symbol": "T", "name": "Thymine", "colour": "008000", "complement": "A", + "aliases": "U"}, + {"symbol": "N", "name": "Any base", "equals": "ACGT", "aliases": "X."}, + {"symbol": "V", "name": "Not T", "equals": "ACG"}, + {"symbol": "H", "name": "Not G", "equals": "ACT"}, + {"symbol": "D", "name": "Not C", "equals": "AGT"}, + {"symbol": "B", "name": "Not A", "equals": "CGT"}, + {"symbol": "M", "name": "Amino", "equals": "AC"}, + {"symbol": "R", "name": "Purine", "equals": "AG"}, + {"symbol": "W", "name": "Weak", "equals": "AT"}, + {"symbol": "S", "name": "Strong", "equals": "CG"}, + {"symbol": "Y", "name": "Pyrimidine", "equals": "CT"}, + {"symbol": "K", "name": "Keto", "equals": "GT"} + ] + }), + PROTEIN: new StandardAlphabet(4, "PROTEIN", { + "name": "Protein", + "like": "PROTEIN", + "ncore": 20, + "symbols": [ + {"symbol": "A", "name": "Alanine", "colour": "0000CC"}, + {"symbol": "C", "name": "Cysteine", "colour": "0000CC"}, + {"symbol": "D", "name": "Aspartic acid", "colour": "FF00FF"}, + {"symbol": "E", "name": "Glutamic acid", "colour": "FF00FF"}, + {"symbol": "F", "name": "Phenylalanine", "colour": "0000CC"}, + {"symbol": "G", "name": "Glycine", "colour": "FFB300"}, + {"symbol": "H", "name": "Histidine", "colour": "FFCCCC"}, + {"symbol": "I", "name": "Isoleucine", "colour": "0000CC"}, + {"symbol": "K", "name": "Lysine", "colour": "CC0000"}, + {"symbol": "L", "name": "Leucine", "colour": "0000CC"}, + {"symbol": "M", "name": "Methionine", "colour": "0000CC"}, + {"symbol": "N", "name": "Asparagine", "colour": "008000"}, + {"symbol": "P", "name": "Proline", "colour": "FFFF00"}, + {"symbol": "Q", "name": "Glutamine", "colour": "008000"}, + {"symbol": "R", "name": "Arginine", "colour": "CC0000"}, + {"symbol": "S", "name": "Serine", "colour": "008000"}, + {"symbol": "T", "name": "Threonine", "colour": "008000"}, + {"symbol": "V", "name": "Valine", "colour": "0000CC"}, + {"symbol": "W", "name": "Tryptophan", "colour": "0000CC"}, + {"symbol": "Y", "name": "Tyrosine", "colour": "33E6CC"}, + {"symbol": "X", "name": "Any amino acid", "equals": "ACDEFGHIKLMNPQRSTVWY", "aliases": "*."}, + {"symbol": "B", "name": "Asparagine or Aspartic acid", "equals": "DN"}, + {"symbol": "Z", "name": "Glutamine or Glutamic acid", "equals": "EQ"}, + {"symbol": "J", "name": "Leucine or Isoleucine", "equals": "IL"} + ] + }) +}; + +//====================================================================== +// start Symbol object +//====================================================================== +var Symbol = function(alph_index, scale, alphabet) { + "use strict"; + //variable prototype + this.symbol = alphabet.get_symbol(alph_index); + this.scale = scale; + this.colour = alphabet.get_colour(alph_index); +}; + +Symbol.prototype.get_symbol = function() { + "use strict"; + return this.symbol; +}; + +Symbol.prototype.get_scale = function() { + "use strict"; + return this.scale; +}; + +Symbol.prototype.get_colour = function() { + "use strict"; + return this.colour; +}; + +Symbol.prototype.toString = function() { + "use strict"; + return this.symbol + " " + (Math.round(this.scale*1000)/10) + "%"; +}; + +function compare_symbol(sym1, sym2) { + "use strict"; + if (sym1.get_scale() < sym2.get_scale()) { + return -1; + } else if (sym1.get_scale() > sym2.get_scale()) { + return 1; + } else { + return 0; + } +} +//====================================================================== +// end Symbol object +//====================================================================== + +//====================================================================== +// start Pspm object +//====================================================================== +var Pspm = function(matrix, name, ltrim, rtrim, nsites, evalue, pssm, alt) { + "use strict"; + var row, col, data, row_sum, delta, evalue_re; + if (typeof name !== "string") { + name = ""; + } + this.name = name; + //construct + if (matrix instanceof Pspm) { + // copy constructor + this.alph_length = matrix.alph_length; + this.motif_length = matrix.motif_length; + this.name = matrix.name; + this.alt = matrix.alt; + this.nsites = matrix.nsites; + this.evalue = matrix.evalue; + this.ltrim = matrix.ltrim; + this.rtrim = matrix.rtrim; + this.pspm = []; + for (row = 0; row < matrix.motif_length; row++) { + this.pspm[row] = []; + for (col = 0; col < matrix.alph_length; col++) { + this.pspm[row][col] = matrix.pspm[row][col]; + } + } + if (matrix.pssm != null) { + this.pssm = []; + for (row = 0; row < matrix.motif_length; row++) { + this.pspm[row] = []; + for (col = 0; col < matrix.alph_length; col++) { + this.pssm[row][col] = matrix.pssm[row][col]; + } + } + } + } else { + // check parameters + if (ltrim == null) { + ltrim = 0; + } else if (typeof ltrim !== "number" || ltrim % 1 !== 0 || ltrim < 0) { + throw new Error("ltrim must be a non-negative integer, got: " + ltrim); + } + if (rtrim == null) { + rtrim = 0; + } else if (typeof rtrim !== "number" || rtrim % 1 !== 0 || rtrim < 0) { + throw new Error("rtrim must be a non-negative integer, got: " + rtrim); + } + if (nsites != null) { + if (typeof nsites !== "number" || nsites < 0) { + throw new Error("nsites must be a positive number, got: " + nsites); + } else if (nsites == 0) { + nsites = null; + } + } + if (evalue != null) { + if (typeof evalue === "number") { + if (evalue < 0) { + throw new Error("evalue must be a non-negative number, got: " + evalue); + } + } else if (typeof evalue === "string") { + evalue_re = /^((?:[+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)|inf)$/; + if (!evalue_re.test(evalue)) { + throw new Error("evalue must be a non-negative number, got: " + evalue); + } + } else { + throw new Error("evalue must be a non-negative number, got: " + evalue); + } + } + // set properties + this.name = name; + this.alt = alt; + this.nsites = nsites; + this.evalue = evalue; + this.ltrim = ltrim; + this.rtrim = rtrim; + if (typeof matrix === "string") { + // string constructor + data = parse_pspm_string(matrix); + this.alph_length = data["alph_length"]; + this.motif_length = data["motif_length"]; + this.pspm = data["pspm"]; + if (this.evalue == null) { + if (data["evalue"] != null) { + this.evalue = data["evalue"]; + } else { + this.evalue = 0; + } + } + if (this.nsites == null) { + if (typeof data["nsites"] === "number") { + this.nsites = data["nsites"]; + } else { + this.nsites = 20; + } + } + } else { + // assume pspm is a nested array + this.motif_length = matrix.length; + this.alph_length = (matrix.length > 0 ? matrix[0].length : 0); + if (this.nsites == null) { + this.nsites = 20; + } + if (this.evalue == null) { + this.evalue = 0; + } + this.pspm = []; + // copy pspm and check + for (row = 0; row < this.motif_length; row++) { + if (this.alph_length != matrix[row].length) { + throw new Error("COLUMN_MISMATCH"); + } + this.pspm[row] = []; + row_sum = 0; + for (col = 0; col < this.alph_length; col++) { + this.pspm[row][col] = matrix[row][col]; + row_sum += this.pspm[row][col]; + } + delta = 0.1; + if (isNaN(row_sum) || (row_sum > 1 && (row_sum - 1) > delta) || + (row_sum < 1 && (1 - row_sum) > delta)) { + throw new Error("INVALID_SUM"); + } + } + // copy pssm + if (pssm != null) { + this.pssm = []; + for (row = 0; row < this.motif_length; row++) { + this.pssm[row] = []; + for (col = 0; col < this.alph_length; col++) { + this.pssm[row][col] = pssm[row][col]; + } + } + } + } + } +}; + +Pspm.prototype.copy = function() { + "use strict"; + return new Pspm(this); +}; + +Pspm.prototype.reverse = function() { + "use strict"; + var x, y, temp, temp_trim; + //reverse + x = 0; + y = this.motif_length-1; + while (x < y) { + temp = this.pspm[x]; + this.pspm[x] = this.pspm[y]; + this.pspm[y] = temp; + x++; + y--; + } + // reverse pssm (if defined) + if (typeof this.pssm !== "undefined") { + //reverse + x = 0; + y = this.motif_length-1; + while (x < y) { + temp = this.pssm[x]; + this.pspm[x] = this.pssm[y]; + this.pssm[y] = temp; + x++; + y--; + } + } + //swap triming + temp_trim = this.ltrim; + this.ltrim = this.rtrim; + this.rtrim = temp_trim; + return this; //allow function chaining... +}; + +Pspm.prototype.reverse_complement = function(alphabet) { + "use strict"; + var x, y, temp, i, row, c, temp_trim; + if (this.alph_length != alphabet.get_size_core()) { + throw new Error("The alphabet size does not match the size of the pspm."); + } + if (!alphabet.has_complement()) { + throw new Error("The specified alphabet can not be complemented."); + } + // reverse motif + this.reverse(); + //complement + for (x = 0; x < this.motif_length; x++) { + row = this.pspm[x]; + for (i = 0; i < row.length; i++) { + c = alphabet.get_complement(i); + if (c < i) continue; + temp = row[i]; + row[i] = row[c]; + row[c] = temp; + } + } + // complement pssm (if defined) + if (typeof this.pssm !== "undefined") { + //complement + for (x = 0; x < this.motif_length; x++) { + row = this.pssm[x]; + for (i = 0; i < row.length; i++) { + c = alphabet.get_complement(i); + if (c < i) continue; + temp = row[i]; + row[i] = row[c]; + row[c] = temp; + } + } + } + return this; //allow function chaining... +}; + +Pspm.prototype.get_stack = function(position, alphabet, ssc) { + "use strict"; + var row, stack_ic, alphabet_ic, stack, i, sym; + if (this.alph_length != alphabet.get_size_core()) { + throw new Error("The alphabet size does not match the size of the pspm."); + } + row = this.pspm[position]; + stack_ic = this.get_stack_ic(position, alphabet); + if (ssc) stack_ic -= this.get_error(alphabet); + alphabet_ic = alphabet.get_ic(); + stack = []; + for (i = 0; i < this.alph_length; i++) { + sym = new Symbol(i, row[i]*stack_ic/alphabet_ic, alphabet); + if (sym.get_scale() <= 0) { + continue; + } + stack.push(sym); + } + stack.sort(compare_symbol); + return stack; +}; + +Pspm.prototype.get_stack_ic = function(position, alphabet) { + "use strict"; + var row, H, i; + if (this.alph_length != alphabet.get_size_core()) { + throw new Error("The alphabet size does not match the size fo the pspm."); + } + row = this.pspm[position]; + H = 0; + for (i = 0; i < this.alph_length; i++) { + if (row[i] === 0) { + continue; + } + H -= (row[i] * (Math.log(row[i]) / Math.LN2)); + } + return alphabet.get_ic() - H; +}; + +Pspm.prototype.get_error = function(alphabet) { + "use strict"; + if (this.nsites === 0) { + return 0; + } + return (alphabet.get_size_core()-1) / (2 * Math.LN2 * this.nsites); +}; + +Pspm.prototype.get_motif_length = function() { + "use strict"; + return this.motif_length; +}; + +Pspm.prototype.get_alph_length = function() { + "use strict"; + return this.alph_length; +}; + +Pspm.prototype.get_left_trim = function() { + "use strict"; + return this.ltrim; +}; + +Pspm.prototype.get_right_trim = function() { + "use strict"; + return this.rtrim; +}; + +Pspm.prototype.as_best_match = function(alphabet) { + "use strict"; + var match, odds, best_odds, best_index; + var i, j; + match = ""; + for (i = 0; i < this.motif_length; i++) { + best_index = 0; + best_odds = this.pspm[i][0] / alphabet.get_bg_freq(0); + for (j = 1; j < this.alph_length; j++) { + odds = this.pspm[i][j] / alphabet.get_bg_freq(j); + if (odds > best_odds) { + best_odds = odds; + best_index = j; + } + } + match += alphabet.get_symbol(best_index); + } + return match; +}; + +Pspm.prototype.as_count_matrix = function() { + "use strict"; + var count, count_text, text; + var i, j; + text = ""; + for (i = 0; i < this.motif_length; i++) { + if (i !== 0) { + text += "\n"; + } + for (j = 0; j < this.alph_length; j++) { + if (j !== 0) { + text += " "; + } + count = Math.round(this.nsites * this.pspm[i][j]); + count_text = "" + count; + // pad up to length of 4 + if (count_text.length < 4) { + text += (new Array(5 - count_text.length)).join(" ") + count_text; + } else { + text += count_text; + } + } + } + return text; +}; + +Pspm.prototype.as_probability_matrix = function() { + "use strict"; + var text; + var i, j; + text = ""; + for (i = 0; i < this.motif_length; i++) { + if (i !== 0) { + text += "\n"; + } + for (j = 0; j < this.alph_length; j++) { + if (j !== 0) { + text += " "; + } + text += this.pspm[i][j].toFixed(6); + } + } + return text; +}; + +Pspm.prototype.as_score_matrix = function(alphabet, pseudo) { + "use strict"; + var me, score, out, row, col, score_text; + me = this; + if (typeof this.pssm === "undefined") { + if (!(typeof alphabet === "object" && alphabet != null && alphabet instanceof Alphabet)) { + throw new Error("The alphabet is required to generate the pssm."); + } + if (typeof pseudo === "undefined") { + pseudo = 0.01; + } else if (typeof pseudo !== "number" || pseudo < 0) { + throw new Error("Expected positive number for pseudocount"); + } + score = function(row, col) { + "use strict"; + var p, bg, p2; + p = me.pspm[row][col]; + bg = alphabet.get_bg_freq(col); + p2 = (p * me.nsites + bg * pseudo) / (me.nsites + pseudo); + return (p2 > 0 ? Math.round((Math.log(p2 / bg) / Math.LN2) * 100) : -10000); + }; + } else { + score = function(row, col) { + "use strict"; + return me.pssm[row][col]; + }; + } + out = ""; + for (row = 0; row < this.motif_length; row++) { + for (col = 0; col < this.alph_length; col++) { + if (col !== 0) { + out += " "; + } + score_text = "" + score(row, col); + // pad out to 6 characters + if (score_text.length < 6) { + out += (new Array(7 - score_text.length)).join(" ") + score_text; + } else { + out += score_text; + } + } + out += "\n"; + } + return out; +} + +Pspm.prototype.as_pspm = function() { + "use strict"; + return "letter-probability matrix: alength= " + this.alph_length + + " w= " + this.motif_length + " nsites= " + this.nsites + + " E= " + (typeof this.evalue === "number" ? + this.evalue.toExponential() : this.evalue) + "\n" + + this.as_probability_matrix(); +}; + +Pspm.prototype.as_pssm = function(alphabet, pseudo) { + "use strict"; + return "log-odds matrix: alength= " + this.alph_length + + " w= " + this.motif_length + + " E= " + (typeof this.evalue == "number" ? + this.evalue.toExponential() : this.evalue) + "\n" + + this.as_score_matrix(alphabet, pseudo); +}; + +Pspm.prototype.as_meme = function(options) { + var with_header, with_pspm, with_pssm, version, alphabet, bg_source, pseudocount, strands; + var out, alen, i; + // get the options + if (typeof options !== "object" || options === null) { + options = {}; + } + with_header = (typeof options["with_header"] === "boolean" ? options["with_header"] : false); + with_pspm = (typeof options["with_pspm"] === "boolean" ? options["with_pspm"] : false); + with_pssm = (typeof options["with_pssm"] === "boolean" ? options["with_pssm"] : false); + if (!with_pspm && !with_pssm) with_pspm = true; + if (with_header) { + if (typeof options["version"] === "string" && /^\d+(?:\.\d+){0,2}$/.test(options["version"])) { + version = options["version"]; + } else if (typeof options["version"] === "number") { + version = options["version"].toFixed(0); + } else { + version = "4"; + } + if (typeof options["strands"] === "number" && options["strands"] === 1) { + strands = 1; + } else { + strands = 2; + } + if (typeof options["bg_source"] === "string") { + bg_source = options["bg_source"]; + } else { + bg_source = "unknown source"; + } + if (typeof options["alphabet"] === "object" && options["alphabet"] != null + && options["alphabet"] instanceof Alphabet) { + alphabet = options["alphabet"]; + } else { + throw new Error("The alphabet is required to generate the header."); + } + } + // now create the output + out = ""; + if (with_header) { + out = "MEME version " + version + "\n\n"; + out += alphabet.as_meme() + "\n"; + if (alphabet.has_complement()) { // assume DNA has both strands unless otherwise specified + out += "strands: " + (strands === 1 ? "+" : "+ -") + "\n\n"; + } + out += "Background letter frequencies (from " + bg_source + "):\n"; + alen = alphabet.get_size_core(); + for (i = 0; i < alen; i++) { + if (i !== 0) { + if (i % 9 === 0) { // maximum of nine entries per line + out += "\n"; + } else { + out += " "; + } + } + out += alphabet.get_symbol(i) + " " + alphabet.get_bg_freq(i).toFixed(3); + } + } + out += "\n\n"; + out += "MOTIF " + this.name + (this.alt == null ? "" : " " + this.alt); + if (with_pssm) { + out += "\n\n"; + out += this.as_pssm(options["alphabet"], options["pseudocount"]); + } + if (with_pspm) { + out += "\n\n"; + out += this.as_pspm(); + } + return out; +} + +Pspm.prototype.toString = function() { + "use strict"; + var str, i, row; + str = ""; + for (i = 0; i < this.pspm.length; i++) { + row = this.pspm[i]; + str += row.join("\t") + "\n"; + } + return str; +}; + +function parse_pspm_properties(str) { + "use strict"; + var parts, i, eqpos, before, after, properties, prop, num, num_re; + num_re = /^((?:[+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)|inf)$/; + parts = trim(str).split(/\s+/); + // split up words containing = + for (i = 0; i < parts.length;) { + eqpos = parts[i].indexOf("="); + if (eqpos != -1) { + before = parts[i].substr(0, eqpos); + after = parts[i].substr(eqpos+1); + if (before.length > 0 && after.length > 0) { + parts.splice(i, 1, before, "=", after); + i += 3; + } else if (before.length > 0) { + parts.splice(i, 1, before, "="); + i += 2; + } else if (after.length > 0) { + parts.splice(i, 1, "=", after); + i += 2; + } else { + parts.splice(i, 1, "="); + i++; + } + } else { + i++; + } + } + properties = {}; + for (i = 0; i < parts.length; i += 3) { + if (parts.length - i < 3) { + throw new Error("Expected PSPM property was incomplete. "+ + "Remaing parts are: " + parts.slice(i).join(" ")); + } + if (parts[i+1] !== "=") { + throw new Error("Expected '=' in PSPM property between key and " + + "value but got " + parts[i+1]); + } + prop = parts[i].toLowerCase(); + num = parts[i+2]; + if (!num_re.test(num)) { + throw new Error("Expected numeric value for PSPM property '" + + prop + "' but got '" + num + "'"); + } + properties[prop] = num; + } + return properties; +} + +function parse_pspm_string(pspm_string) { + "use strict"; + var header_re, lines, first_line, line_num, col_num, alph_length, + motif_length, nsites, evalue, pspm, i, line, match, props, parts, + j, prob; + header_re = /^letter-probability\s+matrix:(.*)$/i; + lines = pspm_string.split(/\n/); + first_line = true; + line_num = 0; + col_num = 0; + alph_length; + motif_length; + nsites; + evalue; + pspm = []; + for (i = 0; i < lines.length; i++) { + line = trim(lines[i]); + if (line.length === 0) { + continue; + } + // check the first line for a header though allow matrices without it + if (first_line) { + first_line = false; + match = header_re.exec(line); + if (match !== null) { + props = parse_pspm_properties(match[1]); + if (props.hasOwnProperty("alength")) { + alph_length = parseFloat(props["alength"]); + if (alph_length != 4 && alph_length != 20) { + throw new Error("PSPM property alength should be 4 or 20" + + " but got " + alph_length); + } + } + if (props.hasOwnProperty("w")) { + motif_length = parseFloat(props["w"]); + if (motif_length % 1 !== 0 || motif_length < 1) { + throw new Error("PSPM property w should be an integer larger " + + "than zero but got " + motif_length); + } + } + if (props.hasOwnProperty("nsites")) { + nsites = parseFloat(props["nsites"]); + if (nsites <= 0) { + throw new Error("PSPM property nsites should be larger than " + + "zero but got " + nsites); + } + } + if (props.hasOwnProperty("e")) { + evalue = props["e"]; + if (evalue < 0) { + throw new Error("PSPM property evalue should be " + + "non-negative but got " + evalue); + } + } + continue; + } + } + pspm[line_num] = []; + col_num = 0; + parts = line.split(/\s+/); + for (j = 0; j < parts.length; j++) { + prob = parseFloat(parts[j]); + if (prob != parts[j] || prob < 0 || prob > 1) { + throw new Error("Expected probability but got '" + parts[j] + "'"); + } + pspm[line_num][col_num] = prob; + col_num++; + } + line_num++; + } + if (typeof motif_length === "number") { + if (pspm.length != motif_length) { + throw new Error("Expected PSPM to have a motif length of " + + motif_length + " but it was actually " + pspm.length); + } + } else { + motif_length = pspm.length; + } + if (typeof alph_length !== "number") { + alph_length = pspm[0].length; + if (alph_length != 4 && alph_length != 20) { + throw new Error("Expected length of first row in the PSPM to be " + + "either 4 or 20 but got " + alph_length); + } + } + for (i = 0; i < pspm.length; i++) { + if (pspm[i].length != alph_length) { + throw new Error("Expected PSPM row " + i + " to have a length of " + + alph_length + " but the length was " + pspm[i].length); + } + } + return {"pspm": pspm, "motif_length": motif_length, + "alph_length": alph_length, "nsites": nsites, "evalue": evalue}; +} +//====================================================================== +// end Pspm object +//====================================================================== + +//====================================================================== +// start Logo object +//====================================================================== + +var Logo = function(alphabet, options) { + "use strict"; + this.alphabet = alphabet; + this.fine_text = ""; + this.x_axis = 1; + this.y_axis = true; + this.xlate_nsyms = 1; + this.xlate_start = null; + this.xlate_end = null; + this.pspm_list = []; + this.pspm_column = []; + this.rows = 0; + this.columns = 0; + if (typeof options === "string") { + // the old method signature had fine_text here so we support that + this.fine_text = options; + } else if (typeof options === "object" && options != null) { + this.fine_text = (typeof options.fine_text === "string" ? options.fine_text : ""); + this.x_axis = (typeof options.x_axis === "boolean" ? (options.x_axis ? 1 : 0) : 1); + if (options.x_axis_hidden != null && options.x_axis_hidden) this.x_axis = -1; + this.y_axis = (typeof options.y_axis === "boolean" ? options.y_axis : true); + this.xlate_nsyms = (typeof options.xlate_nsyms === "number" ? options.xlate_nsyms : this.xlate_nsyms); + this.xlate_start = (typeof options.xlate_start === "number" ? options.xlate_start : this.xlate_start); + this.xlate_end = (typeof options.xlate_end === "number" ? options.xlate_end : this.xlate_end); + } +}; + +Logo.prototype.add_pspm = function(pspm, column) { + "use strict"; + var col; + if (typeof column === "undefined") { + column = 0; + } else if (column < 0) { + throw new Error("Column index out of bounds."); + } + this.pspm_list[this.rows] = pspm; + this.pspm_column[this.rows] = column; + this.rows++; + col = column + pspm.get_motif_length(); + if (col > this.columns) { + this.columns = col; + } +}; + +Logo.prototype.get_columns = function() { + "use strict"; + return this.columns; +}; + +Logo.prototype.get_xlate_nsyms = function() { + "use strict"; + return this.xlate_nsyms; +}; + +Logo.prototype.get_xlate_start = function() { + "use strict"; + return (this.xlate_start != null ? this.xlate_start : 0); +}; + +Logo.prototype.get_xlate_end = function() { + "use strict"; + return (this.xlate_end != null ? this.xlate_end : this.columns * this.xlate_nsyms); +}; + +Logo.prototype.get_xlate_columns = function() { + "use strict"; + return this.get_xlate_end() - this.get_xlate_start(); +}; + +Logo.prototype.get_rows = function() { + "use strict"; + return this.rows; +}; + +Logo.prototype.get_pspm = function(row_index) { + "use strict"; + if (row_index < 0 || row_index >= this.rows) { + throw new Error("INDEX_OUT_OF_BOUNDS"); + } + return this.pspm_list[row_index]; +}; + +Logo.prototype.get_offset = function(row_index) { + "use strict"; + if (row_index < 0 || row_index >= this.rows) { + throw new Error("INDEX_OUT_OF_BOUNDS"); + } + return this.pspm_column[row_index]; +}; + +Logo.prototype._as_eps_data = function(ssc, errbars) { + var i, j, pos, stack_pos, pspm, stack, sym, out; + out = ""; + for (i = 0; i < this.rows; i++) { + out += "\nStartLine\n"; + // Indent + for (j = 0; j < this.pspm_column[i]; j++) { + out += "() startstack\nendstack\n\n"; + } + pspm = this.pspm_list[i]; + if (pspm.get_left_trim() > 0) { + out += "MuteColour\nDrawTrimEdge\n" + pspm.get_left_trim() + " DrawTrimBg\n"; + } + for (pos = 0; pos < pspm.get_motif_length(); pos++) { + if (pos != 0 && pos == pspm.get_left_trim()) { // enable full colour + out += "DrawTrimEdge\nRestoreColour\n"; + } else if (pos == (pspm.get_motif_length() - pspm.get_right_trim())) { + out += "MuteColour\n" + pspm.get_right_trim() + " DrawTrimBg\n"; + } + out += "(" + (pos + 1) + ") startstack\n"; + stack = pspm.get_stack(pos, this.alphabet, ssc); + for (stack_pos = 0; stack_pos < stack.length; stack_pos++) { + sym = stack[stack_pos]; + out += " " + (sym.get_scale() * this.alphabet.get_ic()) + " (" + sym.get_symbol() + ") numchar\n"; + } + if (errbars) { + out += " " + pspm.get_error(this.alphabet) + " Ibeam\n"; + } + out += "endstack\n\n"; + } + if (pspm.get_right_trim() > 0 || pspm.get_left_trim() == pspm.get_motif_length()) { + out += "RestoreColour\n"; + } + out += "EndLine\n"; + } + return out; +}; + +Logo.prototype.as_eps = function(options) { + "use strict"; + if (this.xlate_nsyms != 1) throw new Error("Unsupported setting xlate_nsyms for EPS"); + if (this.xlate_start != null) throw new Error("Unsupported setting xlate_start for EPS"); + if (this.xlate_end != null) throw new Error("Unsupported setting xlate_end for EPS"); + + var LOGOHEIGHT = 7.5; // default height of line in cm + var cm2pts, height, width, now, ssc, errbars; + if (typeof options === "undefined") { + options = {}; + } + cm2pts = 72 / 2.54; + if (typeof options.logo_height == "number") { + height = options.logo_height; + } else { + height = LOGOHEIGHT * this.rows; + } + if (typeof options.logo_width == "number") { + width = options.logo_width; + } else { + width = this.columns + 2; + } + now = new Date(); + ssc = (typeof options.ssc == "boolean" ? options.ssc : false); + errbars = (typeof options.show_error_bar == "boolean" ? options.show_error_bar : ssc); + var values = { + "LOGOHEIGHT": height, + "LOGOWIDTH": width, + "BOUNDINGHEIGHT": Math.round(height * cm2pts), + "BOUNDINGWIDTH": Math.round(width * cm2pts), + "LOGOLINEHEIGHT": (height / this.rows), + "CHARSPERLINE": this.columns, + "BARBITS": this.alphabet.get_ic(), + "LOGOTYPE": (this.alphabet.has_complement() ? "NA" : "AA"), + "CREATIONDATE": now.getDate() + "." + (now.getMonth() + 1) + "." + now.getFullYear() + " " + now.getHours() + ":" + now.getMinutes() + ":" + now.getSeconds(), + "ERRORBARFRACTION": (typeof options.error_bar_fraction == "number" ? options.error_bar_fraction : 1.0), + "TICBITS": (typeof options.ticbits == "number" ? options.ticbits : 1.0), + "TITLE": (typeof options.title == "string" ? options.title : ""), + "FINEPRINT": (typeof options.fineprint == "string" ? options.fineprint : this.fine_text), + "XAXISLABEL": (typeof options.xaxislabel == "string" ? options.xaxislabel : ""), + "YAXISLABEL": (typeof options.yaxislabel == "string" ? options.yaxislabel : "bits"), + "SSC": ssc, + "YAXIS": (typeof options.show_y_axis == "boolean" ? options.show_y_axis : this.y_axis), + "SHOWENDS": (typeof options.show_ends == "boolean" ? options.show_ends : false), + "ERRBAR": errbars, + "OUTLINE": (typeof options.show_outline == "boolean" ? options.show_outline : false), + "NUMBERING": (typeof options.show_numbering == "boolean" ? options.show_numbering : this.x_axis != 0), + "SHOWINGBOX": (typeof options.show_box == "boolean" ? options.show_box : false), + "CREATOR": (typeof options.creator == "string" ? options.creator : "motif_logo.js"), + "FONTSIZE": (typeof options.label_font_size == "number" ? options.label_font_size : 12), + "TITLEFONTSIZE": (typeof options.title_font_size == "number" ? options.title_font_size : 12), + "SMALLFONTSIZE": (typeof options.small_font_size == "number" ? options.small_font_size : 6), + "TOPMARGIN" : (typeof options.top_margin == "number" ? options.top_margin : 0.9), + "BOTTOMMARGIN": (typeof options.bottom_margin == "number" ? options.bottom_margin : 0.9), + "COLORDICT": this.alphabet._as_eps_dict(), + "DATA": this._as_eps_data(ssc, errbars) + }; + // now this requires that the script containing the template has been imported! + return motif_logo_template(values); +}; + +//====================================================================== +// end Logo object +//====================================================================== + +// calculate the exact size (in pixels) of an object drawn on the +// canvas assuming that the background of the canvas is transparent. +function canvas_bounds(ctx, cwidth, cheight) { + "use strict"; + var data, r, c, top_line, bottom_line, left_line, right_line, + txt_width, txt_height; + + // extract the image data + data = ctx.getImageData(0, 0, cwidth, cheight).data; + + // set initial values + top_line = -1; bottom_line = -1; left_line = -1; right_line = -1; + txt_width = 0; txt_height = 0; + + // Find the top-most line with a non-transparent pixel + for (r = 0; r < cheight; r++) { + for (c = 0; c < cwidth; c++) { + if (data[r * cwidth * 4 + c * 4 + 3]) { + top_line = r; + break; + } + } + if (top_line != -1) { + break; + } + } + + // Only bother looking if we found at least one set pixel... + if (top_line != -1) { + + //find the last line with a non-transparent pixel + for (r = cheight-1; r >= top_line; r--) { + for(c = 0; c < cwidth; c++) { + if(data[r * cwidth * 4 + c * 4 + 3]) { + bottom_line = r; + break; + } + } + if (bottom_line != -1) { + break; + } + } + // calculate height + txt_height = bottom_line - top_line + 1; + + // Find the left-most line with a non-transparent pixel + for (c = 0; c < cwidth; c++) { + for (r = top_line; r <= bottom_line; r++) { + if (data[r * cwidth * 4 + c * 4 + 3]) { + left_line = c; + break; + } + } + if (left_line != -1) { + break; + } + } + + //find the right most line with a non-transparent pixel + for (c = cwidth-1; c >= left_line; c--) { + for(r = top_line; r <= bottom_line; r++) { + if(data[r * cwidth * 4 + c * 4 + 3]) { + right_line = c; + break; + } + } + if (right_line != -1) { + break; + } + } + txt_width = right_line - left_line + 1; + } + + //return the bounds + return {bound_top: top_line, bound_bottom: bottom_line, + bound_left: left_line, bound_right: right_line, width: txt_width, + height: txt_height}; +} + +//====================================================================== +// start RasterizedAlphabet +//====================================================================== + +// Rasterize Alphabet +// 1) Measure width of text at default font for all symbols in alphabet +// 2) sort in width ascending +// 3) Drop the top and bottom 10% (designed to ignore outliers like 'W' and 'I') +// 4) Calculate the average as the maximum scaling factor (designed to stop I becoming a rectangular blob). +// 5) Assume scale of zero would result in width of zero, interpolate scale required to make perfect width font +// 6) Draw text onto temp canvas at calculated scale +// 7) Find bounds of drawn text +// 8) Paint on to another canvas at the desired height (but only scaling width to fit if larger). +var RasterizedAlphabet = function(alphabet, logo_scale, font, width) { + "use strict"; + var default_size, safety_pad, canvas, ctx, middle, baseline, widths, sizes, + i, sym, size, tenpercent, avg_width, scale, + target_width, target_height; + //variable prototypes + this.alphabet = alphabet; + this.scale = logo_scale; + this.sym_cache = {}; + this.stack_num_cache = []; + this.scale_num_cache = []; + // size of canvas + default_size = 60; // size of measuring canvas + safety_pad = 20; // pixels to pad around so we don't miss the edges + // create a canvas to do our measuring + canvas = document.createElement("canvas"); + if (!canvas.getContext) throw new Error("No canvas support"); + canvas.width = default_size + 2 * safety_pad; + canvas.height = default_size + 2 * safety_pad; + middle = Math.round(canvas.width / 2); + baseline = Math.round(canvas.height - safety_pad); + ctx = canvas.getContext('2d'); + if (!supports_text(ctx)) throw new Error("Canvas does not support text"); + ctx.font = font; + ctx.textAlign = "center"; + ctx.translate(middle, baseline); + // list of widths + widths = []; + sizes = []; + //now measure each letter in the alphabet + for (i = 0; i < alphabet.get_size_core(); ++i) { + // reset the canvas + ctx.clearRect(0, 0, canvas.width, canvas.height); + ctx.fillStyle = alphabet.get_colour(i); + // draw the test text + ctx.fillText(alphabet.get_symbol(i), 0, 0); + //measure + size = canvas_bounds(ctx, canvas.width, canvas.height); + if (size.width === 0) throw new Error("Invisible symbol!"); + widths.push(size.width); + sizes[i] = size; + } + //sort the widths + widths.sort(function(a,b) {return a - b;}); + //drop 10% of the items off each end + tenpercent = Math.floor(widths.length / 10); + for (i = 0; i < tenpercent; ++i) { + widths.pop(); + widths.shift(); + } + //calculate average width + avg_width = 0; + for (i = 0; i < widths.length; ++i) { + avg_width += widths[i]; + } + avg_width /= widths.length; + // calculate the target width + target_width = width * this.scale * 2; + // calculate scales + for (i = 0; i < alphabet.get_size_core(); ++i) { + sym = alphabet.get_symbol(i); + size = sizes[i]; + // calculate scale + scale = target_width / Math.max(avg_width, size.width); + // estimate scaled height + target_height = size.height * scale; + // create an appropriately sized canvas + canvas = document.createElement("canvas"); + canvas.width = target_width; + canvas.height = target_height + safety_pad * 2; + // calculate the middle + middle = Math.round(canvas.width / 2); + // calculate the baseline + baseline = Math.round(canvas.height - safety_pad); + // get the context and prepare to draw the rasterized text + ctx = canvas.getContext('2d'); + ctx.font = font; + ctx.fillStyle = alphabet.get_colour(i); + ctx.textAlign = "center"; + ctx.translate(middle, baseline); + ctx.save(); + ctx.scale(scale, scale); + // draw the text + ctx.fillText(sym, 0, 0); + ctx.restore(); + this.sym_cache[sym] = {"image": canvas, "size": canvas_bounds(ctx, canvas.width, canvas.height)}; + } +}; + +RasterizedAlphabet.prototype.get_alphabet = function() { + return this.alphabet; +}; + +RasterizedAlphabet.prototype.get_scale = function() { + return this.scale; +}; + +RasterizedAlphabet.prototype.draw_stack_sym = function(ctx, letter, dx, dy, dWidth, dHeight) { + "use strict"; + var entry, image, size; + entry = this.sym_cache[letter]; + image = entry.image; + size = entry.size; + ctx.drawImage(image, 0, size.bound_top -1, image.width, size.height+1, dx, dy, dWidth, dHeight); +}; + +RasterizedAlphabet.prototype.draw_stack_num = function(ctx, font, stack_width, index) { + var image, image_ctx, text_length; + if (index >= this.stack_num_cache.length) { + image = document.createElement("canvas"); + // measure the text + image_ctx = image.getContext('2d'); + image_ctx.save(); + image_ctx.font = font; + text_length = image_ctx.measureText("" + (index + 1)).width; + image_ctx.restore(); + // resize the canvas to fit + image.width = Math.ceil(stack_width); + image.height = Math.ceil(text_length); + // draw the text + image_ctx = image.getContext('2d'); + image_ctx.translate(Math.round(stack_width / 2), 0); + image_ctx.font = font; + image_ctx.textBaseline = "middle"; + image_ctx.textAlign = "right"; + image_ctx.rotate(-(Math.PI / 2)); + image_ctx.fillText("" + (index + 1), 0, 0); + this.stack_num_cache[index] = image; + } else { + image = this.stack_num_cache[index]; + } + ctx.drawImage(image, 0, 0); +} + +RasterizedAlphabet.prototype.draw_scale_num = function(ctx, font, num) { + var image, image_ctx, text_size, m_length; + if (num >= this.scale_num_cache.length) { + image = document.createElement("canvas"); + // measure the text + image_ctx = image.getContext('2d'); + image_ctx.font = font; + text_size = image_ctx.measureText("" + num); + if (text_size.actualBoundingBoxAscent && text_size.actualBoundingBoxDesent) { + // resize the canvas to fit + image.width = Math.ceil(text_size.width); + image.height = Math.ceil(text_size.actualBoundingBoxAscent + text_size.actualBoundingBoxDesent); + // draw the text + image_ctx = image.getContext('2d'); + image_ctx.font = font; + image_ctx.textAlign = "right"; + image_ctx.fillText("" + num, image.width, text_size.actualBoundingBoxAscent); + } else { + // measure width of 'm' to approximate height, we double it later anyway + m_length = image_ctx.measureText("m").width; + // resize the canvas to fit + image.width = Math.ceil(text_size.width); + image.height = Math.ceil(2 * m_length); + // draw the text + image_ctx = image.getContext('2d'); + image_ctx.font = font; + image_ctx.textAlign = "right"; + image_ctx.textBaseline = "middle"; + image_ctx.fillText("" + num, image.width, m_length); + } + this.scale_num_cache[num] = image; + } else { + image = this.scale_num_cache[num]; + } + ctx.drawImage(image, -image.width, -Math.round(image.height / 2)) +} + +//====================================================================== +// end RasterizedAlphabet +//====================================================================== + +//====================================================================== +// start LogoMetrics object +//====================================================================== + +var LogoMetrics = function(ctx, logo_columns, logo_rows, has_names, has_finetext, x_axis, y_axis) { + "use strict"; + var i, row_height; + //variable prototypes + this.pad_top = (has_names ? 5 : 0); + this.pad_left = (y_axis ? 10 : 0); + this.pad_right = (has_finetext ? 15 : 0); + this.pad_bottom = 0; + this.pad_middle = 20; + this.name_height = 14; + this.name_font = "bold " + this.name_height + "px Times, sans-serif"; + this.name_spacer = 0; + this.y_axis = y_axis; + this.y_label = "bits"; + this.y_label_height = 12; + this.y_label_font = "bold " + this.y_label_height + "px Helvetica, sans-serif"; + this.y_label_spacer = 3; + this.y_num_height = 12; + this.y_num_width = 0; + this.y_num_font = "bold " + this.y_num_height + "px Helvetica, sans-serif"; + this.y_tic_width = 5; + this.stack_pad_left = 0; + this.stack_font = "bold 25px Helvetica, sans-serif"; + this.stack_height = 90; + this.stack_width = 26; + this.stacks_pad_right = 5; + this.x_axis = x_axis; + this.x_num_above = 2; + this.x_num_height = 12; + this.x_num_width = 0; + this.x_num_font = "bold " + this.x_num_height + "px Helvetica, sans-serif"; + this.fine_txt_height = 6; + this.fine_txt_above = 2; + this.fine_txt_font = "normal " + this.fine_txt_height + "px Helvetica, sans-serif"; + this.letter_metrics = new Array(); + this.summed_width = 0; + this.summed_height = 0; + //calculate the width of the y axis numbers + ctx.font = this.y_num_font; + for (i = 0; i <= 2; i++) { + this.y_num_width = Math.max(this.y_num_width, ctx.measureText("" + i).width); + } + //calculate the width of the x axis numbers (but they are rotated so it becomes height) + if (x_axis == 1) { + ctx.font = this.x_num_font; + for (i = 1; i <= logo_columns; i++) { + this.x_num_width = Math.max(this.x_num_width, ctx.measureText("" + i).width); + } + } else if (x_axis == 0) { + this.x_num_height = 4; + this.x_num_width = 4; + } else { + this.x_num_height = 0; + this.x_num_width = 0; + } + + //calculate how much vertical space we want to draw this + //first we add the padding at the top and bottom since that's always there + this.summed_height += this.pad_top + this.pad_bottom; + //all except the last row have the same amount of space allocated to them + if (logo_rows > 1) { + row_height = this.stack_height + this.pad_middle; + if (has_names) { + row_height += this.name_height; + //the label is allowed to overlap into the spacer + row_height += Math.max(this.y_num_height/2, this.name_spacer); + //the label is allowed to overlap the space used by the other label + row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above); + } else { + row_height += this.y_num_height/2; + //the label is allowed to overlap the space used by the other label + row_height += Math.max(this.y_num_height/2, this.x_num_height + this.x_num_above); + } + this.summed_height += row_height * (logo_rows - 1); + } + //the last row has the name and fine text below it but no padding + this.summed_height += this.stack_height + (this.y_axis ? this.y_num_height/2 : 0); + + var fine_txt_total = (has_finetext ? this.fine_txt_height + this.fine_txt_above : 0); + if (has_names) { + this.summed_height += fine_txt_total + this.name_height; + this.summed_height += Math.max((this.y_axis ? this.y_num_height/2 : 0), + this.x_num_height + this.x_num_above + this.name_spacer); + } else { + this.summed_height += Math.max((this.y_axis ? this.y_num_height/2 : 0), + this.x_num_height + this.x_num_above + fine_txt_total); + } + + //calculate how much horizontal space we want to draw this + //first add the padding at the left and right since that's always there + this.summed_width += this.pad_left + this.pad_right; + if (this.y_axis) { + //add on the space for the y-axis label + this.summed_width += this.y_label_height + this.y_label_spacer; + //add on the space for the y-axis + this.summed_width += this.y_num_width + this.y_tic_width; + } + //add on the space for the stacks + this.summed_width += (this.stack_pad_left + this.stack_width) * logo_columns; + //add on the padding after the stacks (an offset from the fine text) + this.summed_width += this.stacks_pad_right; + +}; + +//====================================================================== +// end LogoMetrics object +//====================================================================== + +//found this trick at http://talideon.com/weblog/2005/02/detecting-broken-images-js.cfm +function image_ok(img) { + "use strict"; + // During the onload event, IE correctly identifies any images that + // weren't downloaded as not complete. Others should too. Gecko-based + // browsers act like NS4 in that they report this incorrectly. + if (!img.complete) { + return false; + } + // However, they do have two very useful properties: naturalWidth and + // naturalHeight. These give the true size of the image. If it failed + // to load, either of these should be zero. + if (typeof img.naturalWidth !== "undefined" && img.naturalWidth === 0) { + return false; + } + // No other way of checking: assume it's ok. + return true; +} + +function supports_text(ctx) { + "use strict"; + if (!ctx.fillText) { + return false; + } + if (!ctx.measureText) { + return false; + } + return true; +} + +//draws the scale, returns the width +function draw_scale(ctx, metrics, alphabet_ic, raster) { + "use strict"; + var tic_height, i; + tic_height = metrics.stack_height / alphabet_ic; + ctx.save(); + ctx.translate(metrics.y_label_height, metrics.y_num_height/2); + //draw the axis label + ctx.save(); + ctx.font = metrics.y_label_font; + ctx.translate(0, metrics.stack_height/2); + ctx.rotate(-(Math.PI / 2)); + ctx.textAlign = "center"; + ctx.fillText("bits", 0, 0); + ctx.restore(); + + ctx.translate(metrics.y_label_spacer + metrics.y_num_width, 0); + + //draw the axis tics + ctx.save(); + ctx.translate(0, metrics.stack_height); + for (i = 0; i <= alphabet_ic; i++) { + //draw the number + ctx.save(); + ctx.translate(-1, 0); + raster.draw_scale_num(ctx, metrics.y_num_font, i); + ctx.restore(); + //draw the tic + ctx.fillRect(0, -1, metrics.y_tic_width, 2); + //prepare for next tic + ctx.translate(0, -tic_height); + } + ctx.restore(); + + ctx.fillRect(metrics.y_tic_width - 2, 0, 2, metrics.stack_height) + + ctx.restore(); +} + +function draw_stack_num(ctx, metrics, row_index, raster) { + "use strict"; + ctx.save(); + ctx.translate(0, Math.round(metrics.stack_height + metrics.x_num_above)); + if (metrics.x_axis == 1) { + raster.draw_stack_num(ctx, metrics.x_num_font, metrics.stack_width, row_index); + } else if (metrics.x_axis == 0) { + // draw dots instead of the numbers (good for small logos) + ctx.beginPath(); + var radius = Math.round(metrics.x_num_height / 2); + ctx.arc(Math.round(metrics.stack_width / 2), radius, radius, 0, 2 * Math.PI, false); + ctx.fill(); + } + ctx.restore(); +} + +function draw_stack(ctx, metrics, symbols, raster) { + "use strict"; + var preferred_pad, sym_min, i, sym, sym_height, pad; + preferred_pad = 0; + sym_min = 5; + + ctx.save();//1 + ctx.translate(0, metrics.stack_height); + for (i = 0; i < symbols.length; i++) { + sym = symbols[i]; + sym_height = metrics.stack_height * sym.get_scale(); + + pad = preferred_pad; + if (sym_height - pad < sym_min) { + pad = Math.min(pad, Math.max(0, sym_height - sym_min)); + } + sym_height -= pad; + + //translate to the correct position + ctx.translate(0, -(pad/2 + sym_height)); + + //draw + raster.draw_stack_sym(ctx, sym.get_symbol(), 0, 0, metrics.stack_width, sym_height); + //translate past the padding + ctx.translate(0, -(pad/2)); + } + ctx.restore();//1 +} + +function draw_dashed_line(ctx, pattern, start, x1, y1, x2, y2) { + "use strict"; + var x, y, len, i, dx, dy, tlen, theta, mulx, muly, lx, ly; + dx = x2 - x1; + dy = y2 - y1; + tlen = Math.pow(dx*dx + dy*dy, 0.5); + theta = Math.atan2(dy,dx); + mulx = Math.cos(theta); + muly = Math.sin(theta); + lx = []; + ly = []; + for (i = 0; i < pattern; ++i) { + lx.push(pattern[i] * mulx); + ly.push(pattern[i] * muly); + } + i = start; + x = x1; + y = y1; + len = 0; + ctx.beginPath(); + while (len + pattern[i] < tlen) { + ctx.moveTo(x, y); + x += lx[i]; + y += ly[i]; + ctx.lineTo(x, y); + len += pattern[i]; + i = (i + 1) % pattern.length; + x += lx[i]; + y += ly[i]; + len += pattern[i]; + i = (i + 1) % pattern.length; + } + if (len < tlen) { + ctx.moveTo(x, y); + x += mulx * (tlen - len); + y += muly * (tlen - len); + ctx.lineTo(x, y); + } + ctx.stroke(); +} + +function draw_trim_background(ctx, metrics, left_start, left_end, left_divider, right_start, right_end, right_divider) { + "use strict"; + var left_size = left_end - left_start; + var right_size = right_end - right_start; + var line_x; + + ctx.save();//s8 + ctx.fillStyle = "rgb(240, 240, 240)"; + if (left_size > 0) { + ctx.fillRect(left_start * metrics.stack_width, 0, left_size * metrics.stack_width, metrics.stack_height); + } + if (right_size > 0) { + ctx.fillRect(right_start * metrics.stack_width, 0, right_size * metrics.stack_width, metrics.stack_height); + } + ctx.fillStyle = "rgb(51, 51, 51)"; + if (left_size > 0 && left_divider) { + line_x = (left_end * metrics.stack_width) - 0.5; + draw_dashed_line(ctx, [3], 0, line_x, 0, line_x, metrics.stack_height); + } + if (right_size > 0 && right_divider) { + line_x = (right_start * metrics.stack_width) + 0.5; + draw_dashed_line(ctx, [3], 0, line_x, 0, line_x, metrics.stack_height); + } + ctx.restore();//s8 +} + +function size_logo_on_canvas(logo, canvas, show_names, scale) { + "use strict"; + var draw_name, draw_finetext, metrics; + draw_name = (typeof show_names === "boolean" ? show_names : (logo.get_rows() > 1)); + draw_finetext = (logo.fine_text.length > 0); + if (canvas.width !== 0 && canvas.height !== 0) { + return; + } + metrics = new LogoMetrics(canvas.getContext('2d'), + logo.get_xlate_columns(), logo.get_rows(), draw_name, draw_finetext, logo.x_axis, logo.y_axis); + if (typeof scale == "number") { + //resize the canvas to fit the scaled logo + canvas.width = metrics.summed_width * scale; + canvas.height = metrics.summed_height * scale; + } else { + if (canvas.width === 0 && canvas.height === 0) { + canvas.width = metrics.summed_width; + canvas.height = metrics.summed_height; + } else if (canvas.width === 0) { + canvas.width = metrics.summed_width * (canvas.height / metrics.summed_height); + } else if (canvas.height === 0) { + canvas.height = metrics.summed_height * (canvas.width / metrics.summed_width); + } + } +} + +function draw_logo_on_canvas(logo, canvas, show_names, scale) { + "use strict"; + var i, draw_name, draw_finetext, ctx, metrics, raster, pspm_i, pspm, + offset, col_index, motif_position, ssc; + ssc = false; + draw_name = (typeof show_names === "boolean" ? show_names : (logo.get_rows() > 1)); + draw_finetext = (logo.fine_text.length > 0); + ctx = canvas.getContext('2d'); + //assume that the user wants the canvas scaled equally so calculate what the best width for this image should be + metrics = new LogoMetrics(ctx, logo.get_xlate_columns(), logo.get_rows(), draw_name, draw_finetext, logo.x_axis, logo.y_axis); + if (typeof scale == "number") { + //resize the canvas to fit the scaled logo + canvas.width = metrics.summed_width * scale; + canvas.height = metrics.summed_height * scale; + } else { + if (canvas.width === 0 && canvas.height === 0) { + scale = 1; + canvas.width = metrics.summed_width; + canvas.height = metrics.summed_height; + } else if (canvas.width === 0) { + scale = canvas.height / metrics.summed_height; + canvas.width = metrics.summed_width * scale; + } else if (canvas.height === 0) { + scale = canvas.width / metrics.summed_width; + canvas.height = metrics.summed_height * scale; + } else { + scale = Math.min(canvas.width / metrics.summed_width, canvas.height / metrics.summed_height); + } + } + // cache the raster based on the assumption that we will be drawing a lot + // of logos the same size and alphabet + if (typeof draw_logo_on_canvas.raster_cache === "undefined") { + draw_logo_on_canvas.raster_cache = []; + } + for (i = 0; i < draw_logo_on_canvas.raster_cache.length; i++) { + raster = draw_logo_on_canvas.raster_cache[i]; + if (raster.get_alphabet().equals(logo.alphabet) && + Math.abs(raster.get_scale() - scale) < 0.1) break; + raster = null; + } + if (raster == null) { + raster = new RasterizedAlphabet(logo.alphabet, scale, metrics.stack_font, metrics.stack_width); + draw_logo_on_canvas.raster_cache.push(raster); + } + ctx = canvas.getContext('2d'); + ctx.save();//s1 + ctx.scale(scale, scale); + ctx.save();//s2 + ctx.save();//s7 + //create margin + ctx.translate(Math.round(metrics.pad_left), Math.round(metrics.pad_top)); + for (pspm_i = 0; pspm_i < logo.get_rows(); ++pspm_i) { + pspm = logo.get_pspm(pspm_i); + offset = logo.get_offset(pspm_i); + //optionally draw name if this isn't the last row or is the only row + if (draw_name && (logo.get_rows() == 1 || pspm_i != (logo.get_rows()-1))) { + ctx.save();//s4 + ctx.translate(Math.round(metrics.summed_width/2), Math.round(metrics.name_height)); + ctx.font = metrics.name_font; + ctx.textAlign = "center"; + ctx.fillText(pspm.name, 0, 0); + ctx.restore();//s4 + ctx.translate(0, Math.round(metrics.name_height + + Math.min(0, metrics.name_spacer - metrics.y_num_height/2))); + } + //draw scale + if (logo.y_axis) draw_scale(ctx, metrics, logo.alphabet.get_ic(), raster); + ctx.save();//s5 + //translate across past the scale + if (logo.y_axis) { + ctx.translate(Math.round(metrics.y_label_height + metrics.y_label_spacer + + metrics.y_num_width + metrics.y_tic_width), Math.round(metrics.y_num_height / 2)); + } + //draw the trimming background + if (pspm.get_left_trim() > 0 || pspm.get_right_trim() > 0) { + var left_start = offset * logo.get_xlate_nsyms(); + var left_end = (offset + pspm.get_left_trim()) * logo.get_xlate_nsyms(); + var left_divider = true; + if (left_end < logo.get_xlate_start() || left_start > logo.get_xlate_end()) { + // no overlap + left_start = 0; + left_end = 0; + left_divider = false; + } else { + if (left_start < logo.get_xlate_start()) { + left_start = logo.get_xlate_start(); + } + if (left_end > logo.get_xlate_end()) { + left_end = logo.get_xlate_end(); + left_divider = false; + } + left_start -= logo.get_xlate_start(); + left_end -= logo.get_xlate_start(); + if (left_end < left_start) { + left_start = 0; + left_end = 0; + left_divider = false; + } + } + var right_end = (offset + pspm.get_motif_length()) * logo.get_xlate_nsyms(); + //var right_start = right_end - (pspm.get_left_trim() * logo.get_xlate_nsyms()); + var right_start = right_end - (pspm.get_right_trim() * logo.get_xlate_nsyms()); + var right_divider = true; + if (right_end < logo.get_xlate_start() || right_start > logo.get_xlate_end()) { + // no overlap + right_start = 0; + right_end = 0; + right_divider = false; + } else { + if (right_start < logo.get_xlate_start()) { + right_start = logo.get_xlate_start(); + right_divider = false; + } + if (right_end > logo.get_xlate_end()) { + right_end = logo.get_xlate_end(); + } + right_start -= logo.get_xlate_start(); + right_end -= logo.get_xlate_start(); + if (right_end < right_start) { + right_start = 0; + right_end = 0; + right_divider = false; + } + } + draw_trim_background(ctx, metrics, left_start, left_end, left_divider, right_start, right_end, right_divider); + } + //draw letters + var xlate_col; + for (xlate_col = logo.get_xlate_start(); xlate_col < logo.get_xlate_end(); xlate_col++) { + ctx.translate(metrics.stack_pad_left,0); + col_index = Math.floor(xlate_col / logo.get_xlate_nsyms()); + if (xlate_col % logo.get_xlate_nsyms() == 0) { + if (col_index >= offset && col_index < (offset + pspm.get_motif_length())) { + motif_position = col_index - offset; + draw_stack_num(ctx, metrics, motif_position, raster); + draw_stack(ctx, metrics, pspm.get_stack(motif_position, logo.alphabet, ssc), raster); + } + } else { + if (col_index >= offset && col_index < (offset + pspm.get_motif_length())) { + ctx.save();// s5.1 + ctx.translate(0, Math.round(metrics.stack_height)); + // TODO draw a dot or dash or something to indicate continuity of the motif + ctx.restore(); //s5.1 + } + } + ctx.translate(Math.round(metrics.stack_width), 0); + } + ctx.restore();//s5 + ////optionally draw name if this is the last row but isn't the only row + if (draw_name && (logo.get_rows() != 1 && pspm_i == (logo.get_rows()-1))) { + //translate vertically past the stack and axis's + ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height + + Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width + metrics.name_spacer)); + + ctx.save();//s6 + ctx.translate(metrics.summed_width/2, metrics.name_height); + ctx.font = metrics.name_font; + ctx.textAlign = "center"; + ctx.fillText(pspm.name, 0, 0); + ctx.restore();//s6 + ctx.translate(0, metrics.name_height); + } else { + //translate vertically past the stack and axis's + ctx.translate(0, metrics.y_num_height/2 + metrics.stack_height + + Math.max(metrics.y_num_height/2, metrics.x_num_above + metrics.x_num_width)); + } + //if not the last row then add middle padding + if (pspm_i != (logo.get_rows() -1)) { + ctx.translate(0, metrics.pad_middle); + } + } + ctx.restore();//s7 + if (logo.fine_text.length > 0) { + ctx.translate(metrics.summed_width - metrics.pad_right, metrics.summed_height - metrics.pad_bottom); + ctx.font = metrics.fine_txt_font; + ctx.textAlign = "right"; + ctx.fillText(logo.fine_text, 0,0); + } + ctx.restore();//s2 + ctx.restore();//s1 +} + +function create_canvas(c_width, c_height, c_id, c_title, c_display) { + "use strict"; + var canvas = document.createElement("canvas"); + //check for canvas support before attempting anything + if (!canvas.getContext) { + return null; + } + var ctx = canvas.getContext('2d'); + //check for html5 text drawing support + if (!supports_text(ctx)) { + return null; + } + //size the canvas + canvas.width = c_width; + canvas.height = c_height; + canvas.id = c_id; + canvas.title = c_title; + canvas.style.display = c_display; + return canvas; +} + +function logo_1(alphabet, fine_text, pspm) { + "use strict"; + var logo = new Logo(alphabet, fine_text); + logo.add_pspm(pspm); + return logo; +} + +function logo_2(alphabet, fine_text, target, query, query_offset) { + "use strict"; + var logo = new Logo(alphabet, fine_text); + if (query_offset < 0) { + logo.add_pspm(target, -query_offset); + logo.add_pspm(query); + } else { + logo.add_pspm(target); + logo.add_pspm(query, query_offset); + } + return logo; +} + +/* + * Specifies an alternate source for an image. + * If the image with the image_id specified has + * not loaded then a generated logo will be used + * to replace it. + * + * Note that the image must either have dimensions + * or a scale must be set. + */ +function alternate_logo(logo, image_id, scale) { + "use strict"; + var image = document.getElementById(image_id); + if (!image) { + alert("Can't find specified image id (" + image_id + ")"); + return; + } + //if the image has loaded then there is no reason to use the canvas + if (image_ok(image)) { + return; + } + //the image has failed to load so replace it with a canvas if we can. + var canvas = create_canvas(image.width, image.height, image_id, image.title, image.style.display); + if (canvas === null) { + return; + } + //draw the logo on the canvas + draw_logo_on_canvas(logo, canvas, null, scale); + //replace the image with the canvas + image.parentNode.replaceChild(canvas, image); +} + +/* + * Specifes that the element with the specified id + * should be replaced with a generated logo. + */ +function replace_logo(logo, replace_id, scale, title_txt, display_style) { + "use strict"; + var element = document.getElementById(replace_id); + if (!replace_id) { + alert("Can't find specified id (" + replace_id + ")"); + return; + } + //found the element! + var canvas = create_canvas(50, 120, replace_id, title_txt, display_style); + if (canvas === null) { + return; + } + //draw the logo on the canvas + draw_logo_on_canvas(logo, canvas, null, scale); + //replace the element with the canvas + element.parentNode.replaceChild(canvas, element); +} + +/* + * Fast string trimming implementation found at + * http://blog.stevenlevithan.com/archives/faster-trim-javascript + * + * Note that regex is good at removing leading space but + * bad at removing trailing space as it has to first go through + * the whole string. + */ +function trim (str) { + "use strict"; + var ws, i; + str = str.replace(/^\s\s*/, ''); + ws = /\s/; i = str.length; + while (ws.test(str.charAt(--i))); + return str.slice(0, i + 1); +} +</script> + <script> +var current_motif = 0; +var dreme_alphabet = new Alphabet(data.alphabet, data.control_db.freqs); + +/* + * Create a pspm for the given motif data + */ +function motif_pspm(m) { + return new Pspm(m.pwm, m.id, 0, 0, m.nsites, m.evalue); +} + +/* + * Create a count matrix from the given motif data + */ +function motif_count_matrix(motif) { + return motif_pspm(motif).as_count_matrix(); +} + +/* + * Create a probablity matrix from the given motif data + */ +function motif_prob_matrix(motif) { + return motif_pspm(motif).as_probability_matrix(); +} + +/* + * Create a minimal meme format motif from the given motif data + */ +function motif_minimal_meme(motif) { + return motif_pspm(motif).as_meme({ + "with_header": true, + "with_pspm": true, + "with_pssm": false, + "version": data["version"], + "alphabet": dreme_alphabet, + "strands": (data.options.revcomp ? 2 : 1) + }); +} + +/* + * Fill in a template variable + */ +function set_tvar(template, tvar, value) { + var node; + node = find_child(template, tvar); + if (node === null) { + throw new Error("Template does not contain variable " + tvar); + } + node.innerHTML = ""; + if (typeof value !== "object") { + node.appendChild(document.createTextNode(value)); + } else { + node.appendChild(value); + } +} + +/* + * Make a canvas with the motif logo drawn on it. + */ +function make_logo(motif, height, rc) { + var pspm = new Pspm(motif["pwm"]); + if (rc) pspm = pspm.copy().reverse_complement(dreme_alphabet); + var logo = new Logo(dreme_alphabet); + logo.add_pspm(pspm, 0); + var canvas = document.createElement('canvas'); + canvas.height = height; + canvas.width = 0; + draw_logo_on_canvas(logo, canvas, false); + return canvas; +} + +/* + * Create a button designed to contain a single symbol + */ +function make_sym_btn(symbol, title, action) { + var box, sbox; + box = document.createElement("div"); + box.tabIndex = 0; + box.className = "sym_btn"; + sbox = document.createElement("span"); + if (typeof symbol == "string") { + sbox.appendChild(document.createTextNode(symbol)); + } else { + sbox.appendChild(symbol); + } + box.appendChild(sbox); + box.title = title; + box.addEventListener('click', action, false); + box.addEventListener('keydown', action, false); + return box; +} + +/* + * Create a pair of text spans with different classes. + * This is useful when using CSS to only display one of them. + */ +function text_pair(txt1, cls1, txt2, cls2) { + var container, part1, part2; + container = document.createElement("span"); + part1 = document.createElement("span"); + part1.appendChild(document.createTextNode(txt1)); + part1.className = cls1; + container.appendChild(part1); + part2 = document.createElement("span"); + part2.appendChild(document.createTextNode(txt2)); + part2.className = cls2; + container.appendChild(part2); + return container; +} + +/* + * Make a colourised sequence. + */ +function make_seq(seq) { + var i, j, letter, lbox, sbox; + sbox = document.createElement("span"); + for (i = 0; i < seq.length; i = j) { + letter = seq.charAt(i); + for (j = i+1; j < seq.length; j++) { + if (seq.charAt(j) !== letter) { + break; + } + } + lbox = document.createElement("span"); + lbox.style.color = dreme_alphabet.get_colour(dreme_alphabet.get_index(letter)); + lbox.appendChild(document.createTextNode(seq.substring(i, j))); + sbox.appendChild(lbox); + } + return sbox; +} + +/* + * Create a description element taking into account the newlines in the source text. + */ +function make_description(text) { + var i, j, lines, p; + var container = document.createElement("div"); + var paragraphs = text.split(/\n\n+/); + for (i = 0; i < paragraphs.length; i++) { + lines = paragraphs[i].split(/\n/); + p = document.createElement("p"); + p.appendChild(document.createTextNode(lines[0])); + for (j = 1; j < lines.length; j++) { + p.appendChild(document.createElement("br")); + p.appendChild(document.createTextNode(lines[j])); + } + container.appendChild(p); + } + return container; +} + +/* + * Make the table header for the discovered motifs. + */ +function make_motif_header() { + var row = document.createElement("tr"); + add_text_header_cell(row, "", "", "motif_ordinal"); + add_text_header_cell(row, "Motif", "pop_motifs_word", "motif_word"); + add_text_header_cell(row, "Logo", "pop_motifs_logo", "motif_logo"); + if (data.options.revcomp) { + add_text_header_cell(row, "RC Logo", "pop_motifs_rc_logo", "motif_logo"); + } + add_text_header_cell(row, "E-value", "pop_motifs_evalue", "motif_evalue"); + add_text_header_cell(row, "Unerased E-value", "pop_motifs_uevalue", "motif_evalue"); + add_text_header_cell(row, "More", "pop_more", "motif_more"); + add_text_header_cell(row, "Submit/Download", "pop_submit_dl", "motif_submit"); + row.className = "more"; + return row; +} + +/* + * Make a compact motif summary row for the discovered motifs. + */ +function make_motif_row(tbody, ordinal, motif) { + var row = document.createElement("tr"); + add_text_cell(row, "" + ordinal + ".", "motif_ordinal"); + add_text_cell(row, motif["id"], "motif_word"); + add_cell(row, make_logo(motif, 50, false), "motif_logo"); + if (data.options.revcomp) { + add_cell(row, make_logo(motif, 50, true), "motif_logo"); + } + add_text_cell(row, motif["evalue"], "motif_evalue"); + add_text_cell(row, motif["unerased_evalue"], "motif_evalue"); + add_cell(row, make_sym_btn(text_pair("\u21A7", "less", "\u21A5", "more"), "Show more information.", function(e) { toggle_class(tbody, "collapsed"); }, "\u21A5", ""), "motif_more"); + add_cell(row, make_sym_btn("\u21E2", "Submit the motif to another MEME Suite program or download it.", function(e) { action_show_outpop(e, ordinal); }), "motif_submit"); + return row; +} + +/* + * Make a sortable table of enriched matching rows. + */ +function make_motif_words(motif) { + var row, i, match; + var table = document.createElement("table"); + var thead = document.createElement("thead"); + row = document.createElement("tr"); + add_text_header_cell(row, "Word", "pop_match_word", "match_word", function(e) {sort_table(this, compare_words);}); + add_text_header_cell(row, "Positives", "pop_match_pos", "match_count", function(e) {sort_table(this, compare_counts);}); + add_text_header_cell(row, "Negatives", "pop_match_neg", "match_count", function(e) {sort_table(this, compare_counts);}); + add_text_header_cell(row, "P-value", "pop_match_pval", "match_evalue", function(e) {sort_table(this, compare_evalues);}); + add_text_header_cell(row, "E-value", "pop_match_eval", "match_evalue", function(e) {sort_table(this, compare_evalues);}); + thead.appendChild(row); + table.appendChild(thead); + var tbody = document.createElement("tbody"); + for (i = 0; i < motif.matches.length; i++) { + match = motif.matches[i]; + row = document.createElement("tr"); + add_cell(row, make_seq(match.seq), "match_word"); + add_text_cell(row, match.p + " / " + data.sequence_db.count, "match_count"); + add_text_cell(row, match.n + " / " + data.control_db.count, "match_count"); + add_text_cell(row, match.pvalue, "match_evalue"); + add_text_cell(row, match.evalue, "match_evalue"); + tbody.appendChild(row); + } + table.appendChild(tbody); + return table; +} + +/* + * Make an expanded view of a discovered motif. + */ +function make_motif_exp(tbody, ordinal, motif) { + "use strict"; + var box, pspm, logo_box; + box = $("tmpl_motif_expanded").cloneNode(true); + toggle_class(box, "template", false); + box.id = ""; + find_child(box, "tvar_logo").appendChild(make_logo(motif, 150, false)); + if (data.options.revcomp) { + find_child(box, "tvar_rclogo").appendChild(make_logo(motif, 150, true)); + } + set_tvar(box, "tvar_p", motif["p"]); + set_tvar(box, "tvar_p_total", data.sequence_db.count); + set_tvar(box, "tvar_n", motif["n"]); + set_tvar(box, "tvar_n_total", data.control_db.count); + set_tvar(box, "tvar_pvalue", motif["pvalue"]); + set_tvar(box, "tvar_evalue", motif["evalue"]); + set_tvar(box, "tvar_uevalue", motif["unerased_evalue"]); + set_tvar(box, "tvar_words", make_motif_words(motif)); + var cell = document.createElement("td"); + cell.colSpan = 8; + cell.appendChild(box); + var row = document.createElement("tr"); + row.className = "more"; + row.appendChild(cell); + return row; +} + +/* + * Convert a string containing a scientific number into the log of that number + * without having an intermediate representation of the number. + * This is intended to avoid underflow problems with the tiny evalues that + * MEME and DREME can create. + */ +function sci2log(scinum) { + "use strict"; + var ev_re, match, sig, exp; + ev_re = /^(.*)e(.*)$/; + if (match = ev_re.exec(scinum)) { + sig = parseFloat(match[1]); + exp = parseInt(match[2]); + return Math.log(sig) + (exp * Math.log(10)); + } + return 0; +} + +/* + * Create a table of discovered motifs. A fresh table body is used for each + * motif to make hiding/showing rows with css easier. + */ +function make_motifs() { + "use strict"; + var i, row, tbody, motif, ordinal; + // make the motifs table + var container = $("motifs"); + container.innerHTML = ""; // clear content + var table = document.createElement("table"); + // add a header that is always shown + var thead = document.createElement("thead"); + thead.appendChild(make_motif_header()); + table.appendChild(thead); + for (i = 0; i < data.motifs.length; i++) { + ordinal = i + 1; + motif = data.motifs[i]; + tbody = document.createElement("tbody"); + tbody.className = "collapsed"; + tbody.appendChild(make_motif_row(tbody, ordinal, motif)); + tbody.appendChild(make_motif_exp(tbody, ordinal, motif)); + // create a following header for every row except the last one + if ((i + 1) < data.motifs.length) tbody.appendChild(make_motif_header()); + table.appendChild(tbody); + } + container.appendChild(table); +} + +/* + * Create a table showing all the alphabet symbols, their names and frequencies. + */ +function make_alpha_bg(alph, freqs) { + function colour_symbol(index) { + var span = document.createElement("span"); + span.appendChild(document.createTextNode(alph.get_symbol(index))); + span.style.color = alph.get_colour(index); + span.className = "alpha_symbol"; + return span; + } + var table, thead, tbody, row, th, span, i; + // create table + table = document.createElement("table"); + table.className = "inputs"; + // create header + thead = document.createElement("thead"); + table.appendChild(thead); + row = thead.insertRow(thead.rows.length); + if (alph.has_complement()) { + add_text_header_cell(row, "Name", "pop_alph_name"); + add_text_header_cell(row, "Bg.", "pop_alph_control"); + add_text_header_cell(row, ""); + add_text_header_cell(row, ""); + add_text_header_cell(row, ""); + add_text_header_cell(row, "Bg.", "pop_alph_control"); + add_text_header_cell(row, "Name", "pop_alph_name"); + } else { + add_text_header_cell(row, ""); + add_text_header_cell(row, "Name", "pop_alph_name"); + add_text_header_cell(row, "Bg.", "pop_alph_control"); + } + // add alphabet entries + tbody = document.createElement("tbody"); + table.appendChild(tbody); + if (alph.has_complement()) { + for (i = 0; i < alph.get_size_core(); i++) { + var c = alph.get_complement(i); + if (i > c) continue; + row = tbody.insertRow(tbody.rows.length); + add_text_cell(row, alph.get_name(i)); + add_text_cell(row, "" + freqs[i].toFixed(3)); + add_cell(row, colour_symbol(i)); + add_text_cell(row, "~"); + add_cell(row, colour_symbol(c)); + add_text_cell(row, "" + freqs[c].toFixed(3)); + add_text_cell(row, alph.get_name(c)); + } + } else { + for (i = 0; i < alph.get_size_core(); i++) { + row = tbody.insertRow(tbody.rows.length); + add_cell(row, colour_symbol(i)); + add_text_cell(row, alph.get_name(i)); + add_text_cell(row, "" + freqs[i].toFixed(3)); + } + } + return table; +} + +/* + * Updates the format download text in the popup. + * This is called when either the format or current motif changes. + */ +function update_outpop_format(index) { + var motif = data.motifs[index]; + var fn = [motif_count_matrix, motif_prob_matrix, motif_minimal_meme]; + var suffix = ["_counts.txt", "_freqs.txt", ".meme"]; + var format = parseInt($("text_format").value); + var text = fn[format](motif); + prepare_download(text, "text/plain", motif.id + suffix[format], $("outpop_text_dl")); + $("outpop_text").value = text; +} + +/* + * Updates the motif logos and format download text in the popup. + * This is called whenever the current motif changes. + */ +function update_outpop_motif(index) { + "use strict"; + var motifs, motif, pspm, logo, canvas, num; + motifs = data["motifs"]; + if (index < 0 || index >= motifs.length) {return;} + current_motif = index; + motif = motifs[index]; + pspm = new Pspm(motif["pwm"]); + logo = new Logo(dreme_alphabet, ""); + logo.add_pspm(pspm, 0); + canvas = $("outpop_logo"); + canvas.width = canvas.width; // clear canvas + draw_logo_on_canvas(logo, canvas, false); + canvas = $("outpop_logo_rc"); + canvas.width = canvas.width; // clear rc canvas + if (data.options.revcomp) { + pspm.reverse_complement(dreme_alphabet); + logo = new Logo(dreme_alphabet, ""); + logo.add_pspm(pspm, 0); + draw_logo_on_canvas(logo, canvas, false); + } + num = $("outpop_num"); + num.innerHTML = ""; + num.appendChild(document.createTextNode("" + (index + 1))); + update_outpop_format(index); +} + + +/* + * Initialise and display the download popup. + */ +function action_show_outpop(e, ordinal) { + "use strict"; + function init() { + "use strict"; + var close_btn, next_btn, prev_btn, cancel_btn, do_btn; + var tab1, tab2, tab3; + var pnl1, pnl2, pnl3; + var format_list; + var tbl_submit, inputs, i, default_prog; + close_btn = $("outpop_close"); + close_btn.addEventListener("click", action_hide_outpop, false); + close_btn.addEventListener("keydown", action_hide_outpop, false); + next_btn = $("outpop_next"); + next_btn.addEventListener("click", action_outpop_next, false); + next_btn.addEventListener("keydown", action_outpop_next, false); + prev_btn = $("outpop_prev"); + prev_btn.addEventListener("click", action_outpop_prev, false); + prev_btn.addEventListener("keydown", action_outpop_prev, false); + cancel_btn = $("outpop_cancel"); + cancel_btn.addEventListener("click", action_hide_outpop, false); + do_btn = $("outpop_do"); + do_btn.addEventListener("click", action_outpop_submit, false); + tab1 = $("outpop_tab_1"); + tab1.tabIndex = 0; + tab1.addEventListener("click", action_outpop_tab, false); + tab1.addEventListener("keydown", action_outpop_tab, false); + tab2 = $("outpop_tab_2"); + tab2.tabIndex = 0; + tab2.addEventListener("click", action_outpop_tab, false); + tab2.addEventListener("keydown", action_outpop_tab, false); + tab3 = $("outpop_tab_3"); + tab3.tabIndex = 0; + tab3.addEventListener("click", action_outpop_tab, false); + tab3.addEventListener("keydown", action_outpop_tab, false); + pnl1 = $("outpop_pnl_1"); + pnl2 = $("outpop_pnl_2"); + pnl3 = $("outpop_pnl_3"); + toggle_class(tab1, "activeTab", true); + toggle_class(tab2, "activeTab", false); + toggle_class(tab3, "activeTab", false); + pnl1.style.display = "block"; + pnl2.style.display = "none"; + pnl3.style.display = "none"; + format_list = $("text_format"); + format_list.addEventListener("change", action_outpop_format, false); + // setup program selection + tbl_submit = $("programs"); + // when not dna, hide the inputs for programs that require dna motifs + toggle_class(tbl_submit, "alphabet_dna", dreme_alphabet.has_complement());//TODO FIXME alphabet_dna is a bad name for a field when allowing custom alphabets + // add a click listener for the radio buttons + inputs = tbl_submit.querySelectorAll("input[type='radio']"); + for (i = 0; i < inputs.length; i++) { + inputs[i].addEventListener("click", action_outpop_program, false); + } + // ensure that a default program option is selected for DNA and Protein + default_prog = document.getElementById(dreme_alphabet.has_complement() ? "submit_tomtom" : "submit_fimo"); + default_prog.checked = true; + action_outpop_program.call(default_prog); + // disable reverse-complement when not DNA + $("logo_rc_option").disabled = !dreme_alphabet.has_complement(); + // set errorbars on when ssc is on + $("logo_ssc").addEventListener("change", action_outpop_ssc, false); + } + // store the focused element + action_hide_outpop.last_active = document.activeElement; + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + // hide the help popup + help_popup(); + // on first load initilize the popup + if (!action_show_outpop.ready) { + init(); + action_show_outpop.ready = true; + } + update_outpop_motif(ordinal - 1); + // display the download popup + $("grey_out_page").style.display = "block"; + $("download").style.display = "block"; + $("outpop_close").focus(); +} + +/* + * Hide the download popup. + */ +function action_hide_outpop(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + $("download").style.display = "none"; + $("grey_out_page").style.display = "none"; + if (typeof action_hide_outpop.last_active !== "undefined") { + action_hide_outpop.last_active.focus(); + } +} + +/* + * Show the next motif in the download popup. + */ +function action_outpop_next(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + update_outpop_motif(current_motif + 1); +} + +/* + * Show the previous motif in the download popup. + */ +function action_outpop_prev(e) { + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + update_outpop_motif(current_motif - 1); +} + +/* + * Highlight the selected row in the program list. + */ +function action_outpop_program() { + "use strict"; + var table, tr, rows, i; + tr = find_parent_tag(this, "TR"); + table = find_parent_tag(tr, "TABLE"); + rows = table.querySelectorAll("tr"); + for (i = 0; i < rows.length; i++) { + toggle_class(rows[i], "selected", rows[i] === tr); + } +} + +/* + * Enable error bars when small sample correction is enabled. + */ +function action_outpop_ssc() { + "use strict"; + $("logo_err").value = $("logo_ssc").value; +} + +/* + * Submit the motif to the selected program. + */ +function action_outpop_submit(e) { + "use strict"; + var form, input, program, motifs; + // find out which program is selected + var radios, i; + radios = document.getElementsByName("program"); + program = "fimo"; // default to fimo, since it works with all alphabet types + for (i = 0; i < radios.length; i++) { + if (radios[i].checked) program = radios[i].value; + } + + motifs = motif_minimal_meme(data.motifs[current_motif]); + form = document.createElement("form"); + form.setAttribute("method", "post"); + form.setAttribute("action", site_url + "/tools/" + program); + + input = document.createElement("input"); + input.setAttribute("type", "hidden"); + input.setAttribute("name", "motifs_embed"); + input.setAttribute("value", motifs); + form.appendChild(input); + + document.body.appendChild(form); + form.submit(); + document.body.removeChild(form); +} + +/* + * Download the format text. + * Wire the link containing the data URI text to a download button so it looks + * the same as the server submit stuff. + */ +function action_outpop_download_motif(e) { + $("outpop_text_dl").click(); +} + +/* + * Download the motif logo. + * The EPS format can be calculated locally in Javascript + */ +function action_outpop_download_logo(e) { + "use strict"; + var pspm, logo, eps; + var logo_rc, logo_ssc, logo_width, logo_height; + var motif = data.motifs[current_motif]; + if ($("logo_format").value == "0") { // EPS + logo_rc = ($("logo_rc").value == "1"); + logo_ssc = ($("logo_ssc").value == "1"); + logo_width = parseFloat($("logo_width").value); + if (isNaN(logo_width) || !isFinite(logo_width) || logo_width <= 0) logo_width = null; + logo_height = parseFloat($("logo_height").value); + if (isNaN(logo_height) || !isFinite(logo_height) || logo_height <= 0) logo_height = null; + // create a PSPM from the motif + pspm = motif_pspm(motif); + if (logo_rc) pspm.reverse_complement(dreme_alphabet); + logo = new Logo(dreme_alphabet); + logo.add_pspm(pspm, 0); + eps = logo.as_eps({"ssc": logo_ssc, "logo_width": logo_width, "logo_height": logo_height}); + prepare_download(eps, "application/postscript", motif.id + ".eps"); + } else { + $("logo_motifs").value = motif_minimal_meme(motif); + $("logo_form").submit(); + } +} + +/* + * Change the selected tab in the download popup. + */ +function action_outpop_tab(e) { + "use strict"; + var tab1, tab2, tab3, pnl1, pnl2, pnl3, do_btn; + if (!e) e = window.event; + if (e.type === "keydown") { + if (e.keyCode !== 13 && e.keyCode !== 32) { + return; + } + // stop a submit or something like that + e.preventDefault(); + } + tab1 = $("outpop_tab_1"); + tab2 = $("outpop_tab_2"); + tab3 = $("outpop_tab_3"); + pnl1 = $("outpop_pnl_1"); + pnl2 = $("outpop_pnl_2"); + pnl3 = $("outpop_pnl_3"); + do_btn = $("outpop_do"); + + toggle_class(tab1, "activeTab", (this === tab1)); + toggle_class(tab2, "activeTab", (this === tab2)); + toggle_class(tab3, "activeTab", (this === tab3)); + pnl1.style.display = ((this === tab1) ? "block" : "none"); + pnl2.style.display = ((this === tab2) ? "block" : "none"); + pnl3.style.display = ((this === tab3) ? "block" : "none"); + do_btn.value = ((this === tab1) ? "Submit" : "Download"); + do_btn.removeEventListener("click", action_outpop_submit, false); + do_btn.removeEventListener("click", action_outpop_download_logo, false); + do_btn.removeEventListener("click", action_outpop_download_motif, false); + if (this === tab1) { + do_btn.addEventListener("click", action_outpop_submit, false); + } else if (this === tab2) { + do_btn.addEventListener("click", action_outpop_download_motif, false); + } else { + do_btn.addEventListener("click", action_outpop_download_logo, false); + } +} + +/* + * Update the text in the download format popup. + */ +function action_outpop_format() { + update_outpop_format(current_motif); +} + +/* + * Find all text nodes in the given container. + */ +function text_nodes(container) { + var textNodes = []; + var stack = [container]; + // depth first search to maintain ordering when flattened + while (stack.length > 0) { + var node = stack.pop(); + if (node.nodeType == Node.TEXT_NODE) { + textNodes.push(node); + } else { + for (var i = node.childNodes.length-1; i >= 0; i--) { + stack.push(node.childNodes[i]); + } + } + } + return textNodes; +} + +/* + * Get the text out of a specific text node. + */ +function node_text(node) { + if (node === undefined) { + return ''; + } else if (node.textContent) { + return node.textContent; + } else if (node.innerText) { + return node.innerText; + } else { + return ''; + } +} + +/* + * Get the text contained within the element. + */ +function elem_text(elem, separator) { + if (separator === undefined) separator = ''; + return text_nodes(elem).map(node_text).join(separator); +} + +/* + * Sort all rows in the first table body based on the column of the given element and the comparison function. + * The sort is not very fast and is intended for small tables only. + */ +function sort_table(colEle, compare_function) { + //find the parent of colEle that is either a td or th + var i, j; + var cell = colEle; + while (true) { + if (cell == null) return; + if (cell.nodeType == Node.ELEMENT_NODE && + (cell.tagName.toLowerCase() == "td" || cell.tagName.toLowerCase() == "th")) { + break; + } + cell = cell.parentNode; + } + //find the parent of cell that is a tr + var row = cell; + while (true) { + if (row == null) return; + if (row.nodeType == Node.ELEMENT_NODE && row.tagName.toLowerCase() == "tr") { + break; + } + row = row.parentNode; + } + //find the parent of row that is a table + var table = row; + while (true) { + if (table == null) return; + if (table.nodeType == Node.ELEMENT_NODE && table.tagName.toLowerCase() == "table") { + break; + } + table = table.parentNode; + } + var column_index = cell.cellIndex; + // do a bubble sort, because the tables are so small it doesn't matter + var change; + var trs = table.tBodies[0].getElementsByTagName('tr'); + var already_sorted = true; + var reverse = false; + while (true) { + do { + change = false; + for (i = 0; i < trs.length -1; i++) { + var v1 = elem_text(trs[i].cells[column_index]); + var v2 = elem_text(trs[i+1].cells[column_index]); + if (reverse) { + var tmp = v1; + v1 = v2; + v2 = tmp; + } + if (compare_function(v1, v2) > 0) { + exchange(trs[i], trs[i+1], table); + change = true; + already_sorted = false; + trs = table.tBodies[0].getElementsByTagName('tr'); + } + } + } while (change); + if (reverse) break;// we've sorted twice so exit + if (!already_sorted) break;// sort did something so exit + // when it's sorted one way already then sort the opposite way + reverse = true; + } + // put arrows on the headers + var headers = table.tHead.getElementsByTagName('tr'); + for (i = 0; i < headers.length; i++) { + for (j = 0; j < headers[i].cells.length; j++) { + var cell = headers[i].cells[j]; + var arrows = cell.getElementsByClassName("sort_arrow"); + var arrow; + if (arrows.length == 0) { + arrow = document.createElement("span"); + arrow.className = "sort_arrow"; + cell.insertBefore(arrow, cell.firstChild); + } else { + arrow = arrows[0]; + } + arrow.innerHTML = ""; + if (j == column_index) { + arrow.appendChild(document.createTextNode(reverse ? "\u25B2" : "\u25BC")); + } + } + } +} + +/* + * Swap two rows in a table. + */ +function exchange(oRowI, oRowJ, oTable) { + var i = oRowI.rowIndex; + var j = oRowJ.rowIndex; + if (i == j+1) { + oTable.tBodies[0].insertBefore(oRowI, oRowJ); + } if (j == i+1) { + oTable.tBodies[0].insertBefore(oRowJ, oRowI); + } else { + var tmpNode = oTable.tBodies[0].replaceChild(oRowI, oRowJ); + if(typeof(oRowI) != "undefined") { + oTable.tBodies[0].insertBefore(tmpNode, oRowI); + } else { + oTable.appendChild(tmpNode); + } + } +} + +/* + * Compare two E-values which may be very small. + */ +function compare_evalues(v1, v2) { + var e1 = sci2log(v1); + var e2 = sci2log(v2); + if (e1 < e2) return -1; + else if (e1 > e2) return 1; + return 0; +} + +/* + * Compare two counts. + */ +function compare_counts(v1, v2) { + var re = /(\d+)\s*\/\s*\d+/; + var m1 = re.exec(v1); + var m2 = re.exec(v2); + if (m1 == null && m2 == null) return 0; + if (m1 == null) return -1; + if (m2 == null) return 1; + return parseInt(m2[1]) - parseInt(m1[1]); +} + +/* + * Compare two sequence words. + */ +function compare_words(v1, v2) { + return v1.localeCompare(v2); +} + + +</script> + <style> +/* The following is the content of meme.css */ +body { background-color:white; font-size: 12px; font-family: Verdana, Arial, Helvetica, sans-serif;} + +div.help { + display: inline-block; + margin: 0px; + padding: 0px; + width: 12px; + height: 13px; + cursor: pointer; + background-image: url(data:image/gif;base64,R0lGODlhDAANAIABANR0AP///yH5BAEAAAEALAAAAAAMAA0AAAIdhI8Xy22MIFgv1DttrrJ7mlGNNo4c+aFg6SQuUAAAOw==); +} + +div.help:hover { + background-image: url(data:image/gif;base64,R0lGODlhDAANAKEAANR0AP///9R0ANR0ACH+EUNyZWF0ZWQgd2l0aCBHSU1QACH5BAEAAAIALAAAAAAMAA0AAAIdDGynCe3PgoxONntvwqz2/z2K2ImjR0KhmSIZUgAAOw==); +} + +p.spaced { line-height: 1.8em;} + +span.citation { font-family: "Book Antiqua", "Palatino Linotype", serif; color: #004a4d;} + +p.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;} + +td.jump { font-size: 13px; color: #ffffff; background-color: #00666a; + font-family: Georgia, "Times New Roman", Times, serif;} + +a.jump { margin: 15px 0 0; font-style: normal; font-variant: small-caps; + font-weight: bolder; font-family: Georgia, "Times New Roman", Times, serif;} + +h2.mainh {font-size: 1.5em; font-style: normal; margin: 15px 0 0; + font-variant: small-caps; font-family: Georgia, "Times New Roman", Times, serif;} + +h2.line {border-bottom: 1px solid #CCCCCC; font-size: 1.5em; font-style: normal; + margin: 15px 0 0; padding-bottom: 3px; font-variant: small-caps; + font-family: Georgia, "Times New Roman", Times, serif;} + +h4 {border-bottom: 1px solid #CCCCCC; font-size: 1.2em; font-style: normal; + margin: 10px 0 0; padding-bottom: 3px; font-family: Georgia, "Times New Roman", Times, serif;} + +h5 {margin: 0px} + +a.help { font-size: 9px; font-style: normal; text-transform: uppercase; + font-family: Georgia, "Times New Roman", Times, serif;} + +div.pad { padding-left: 30px; padding-top: 5px; padding-bottom: 10px;} + +div.pad1 { margin: 10px 5px;} + +div.pad2 { margin: 25px 5px 5px;} +h2.pad2 { padding: 25px 5px 5px;} + +div.pad3 { padding: 5px 0px 10px 30px;} + +div.box { border: 2px solid #CCCCCC; padding:10px; overflow: hidden;} + +div.bar { border-left: 7px solid #00666a; padding:5px; margin-top:25px; } + +div.subsection {margin:25px 0px;} + +img {border:0px none;} + +th.majorth {text-align:left;} +th.minorth {font-weight:normal; text-align:left; width:8em; padding: 3px 0px;} +th.actionth {font-weight:normal; text-align:left;} + +.explain h5 {font-size:1em; margin-left: 1em;} + +div.doc {margin-left: 2em; margin-bottom: 3em;} + +th.trainingset { + border-bottom: thin dashed black; + font-weight:normal; + padding:0px 10px; +} +div.pop_content { + position:absolute; + z-index:50; + width:300px; + padding: 5px; + background: #E4ECEC; + font-size: 12px; + font-family: Arial; + border-style: double; + border-width: 3px; + border-color: #AA2244; + display:none; +} + +div.pop_content > *:first-child { + margin-top: 0px; +} + +div.pop_content h1, div.pop_content h2, div.pop_content h3, div.pop_content h4, +div.pop_content h5, div.pop_content h6, div.pop_content p { + margin: 0px; +} + +div.pop_content p + h1, div.pop_content p + h2, div.pop_content p + h3, +div.pop_content p + h4, div.pop_content p + h5, div.pop_content p + h6 { + margin-top: 5px; +} + +div.pop_content p + p { + margin-top: 5px; +} + +div.pop_content > *:last-child { + margin-bottom: 0px; +} + +div.pop_content div.pop_close { + /* old definition */ + float:right; + bottom: 0; +} + +div.pop_content span.pop_close, div.pop_content span.pop_back { + display: inline-block; + border: 2px outset #661429; + background-color: #CCC; + padding-left: 1px; + padding-right: 1px; + padding-top: 0px; + padding-bottom: 0px; + cursor: pointer; + color: #AA2244; /*#661429;*/ + font-weight: bold; +} + +div.pop_content span.pop_close:active, div.pop_content span.pop_back:active { + border-style: inset; +} + +div.pop_content span.pop_close { + float:right; + /*border: 2px outset #AA002B;*/ + /*color: #AA2244;*/ +} + +div.pop_content:not(.nested) .nested_only { + display: none; +} + +div.pop_back_sec { + margin-bottom: 5px; +} + +div.pop_close_sec { + margin-top: 5px; +} + +table.hide_advanced tr.advanced { + display: none; +} +span.show_more { + display: none; +} +table.hide_advanced span.show_more { + display: inline; +} +table.hide_advanced span.show_less { + display: none; +} + + +/***************************************************************************** + * Program logo styling + ****************************************************************************/ +div.prog_logo { + border-bottom: 0.25em solid #0f5f60; + height: 4.5em; + width: 24em; + display:inline-block; +} +div.prog_logo img { + float:left; + width: 4em; + border-style: none; + margin-right: 0.2em; +} +div.prog_logo h1, div.prog_logo h1:hover, div.prog_logo h1:active, div.prog_logo h1:visited { + margin:0; + padding:0; + font-family: Arial, Helvetica, sans-serif; + font-size: 3.2em; + line-height: 1em; + vertical-align: top; + display: block; + color: #026666; + letter-spacing: -0.06em; + text-shadow: 0.04em 0.06em 0.05em #666; +} +div.prog_logo h2, div.prog_logo h2:hover, div.prog_logo h2:active, div.prog_logo h2:visited { + display: block; + margin:0; + padding:0; + font-family: Helvetica, sans-serif; + font-size: 0.9em; + line-height: 1em; + letter-spacing: -0.06em; + color: black; +} + +div.big.prog_logo { + font-size: 18px; +} + +</style> + <style> +/* dreme output specific css */ +div.header { + position: relative; + overflow: hidden; + margin-top: 15px; + margin-bottom: 5px; + margin-right: 3px; + margin-left: 3px; +} +div.header > h2 { + font-size: 1.5em; + font-style: normal; + margin: 0; + font-variant: small-caps; + font-family: Georgia, "Times New Roman", Times, serif; +} +div.header > span { + position: absolute; + right: 0; + bottom: 0; +} + +div.template { + position: absolute; + z-index: 1; + left: 0; + top: 0; + visibility: hidden; +} + +div.sym_btn { + display:inline-block; + text-decoration: underline; + cursor: pointer; + font-size: 20px; + line-height:20px; + text-align: center; + width: 20px; + height: 20px; + color: blue; +} +div.sym_btn:hover { + color: white; + background-color: blue; +} + +div.sym_btn.positioned { + position: absolute; + top: 0px; +} + +div.box + div.box { + margin-top: 5px; +} + +th.motif_ordinal { + +} +td.motif_ordinal { + text-align: right; + padding-right: 10px; + font-weight: bold; + font-size: large; +} +th.motif_word { + padding-right: 10px; +} +td.motif_word { + font-size:15px; + font-family: 'Courier New', Courier, monospace; + padding-right: 10px; +} +th.motif_logo { + padding-right: 10px; +} +td.motif_logo { + padding-right: 10px; +} +th.motif_evalue { + text-align:right; + padding-right: 10px; +} +td.motif_evalue { + text-align: right; + white-space: nowrap; + padding-right: 20px; +} +th.motif_more { + padding: 0 5px; +} +td.motif_more { + text-align: center; + padding: 0 5px; +} +th.motif_submit { + padding: 0 5px; +} +td.motif_submit { + text-align: center; + padding: 0 5px; +} +th.match_word { + padding-right: 10px; +} +td.match_word { + padding-right: 10px; + font-weight: bold; + font-size: large; + font-family: 'Courier New', Courier, monospace; +} +th.match_evalue, th.match_count { + text-align: right; + padding-right: 10px; +} +td.match_evalue, td.match_count { + text-align: right; + white-space: nowrap; + padding-right: 20px; +} + +div.tabArea { + font-size: 80%; + font-weight: bold; +} + +.norc div.tabArea { + display: none; +} + +span.tab, span.tab:visited { + cursor: pointer; + color: #888; + background-color: #ddd; + border: 2px solid #ccc; + padding: 2px 1em; + text-decoration: none; +} +span.tab.middle { + border-left-width: 0px; +} +div.tabArea.base span.tab { + border-top-width: 0px; +} +div.tabArea.top span.tab { + border-bottom-width: 0px; +} + +span.tab:hover { + background-color: #bbb; + border-color: #bbb; + color: #666; +} +span.tab.activeTab, span.tab.activeTab:hover, span.tab.activeTab:visited { + background-color: white; + color: black; + cursor: default; +} +div.tabMain { + border: 2px solid #ccc; + background-color: white; + padding: 10px; +} +div.tabMain.base { + margin-top: 5px; + display: inline-block; + max-width: 98%; +} + +div.tabMain.top { + margin-bottom: 5px; +} + +div.grey_background { + position:fixed; + z-index: 8; + background-color: #000; + -ms-filter: "progid:DXImageTransform.Microsoft.Alpha(Opacity=50)"; + opacity: 0.5; + left: 0; + top: 0; + width: 100%; + height: 100%; +} + +div.popup_wrapper { + position:fixed; + z-index:9; + width:100%; + height:0; + top:50%; + left:0; +} + +div.popup { + width: 600px; + z-index:9; + margin-left: auto; + margin-right: auto; + padding: 5px; + background-color: #FFF; + border-style: double; + border-width: 5px; + border-color: #00666a; + position:relative; +} +div.close { + cursor: pointer; + border: 1px solid black; + width:15px; + height:15px; + line-height:15px; /* this causes vertical centering */ + text-align:center; + background-color:#FFF; + color:#000; + font-size:15px; + font-family:monospace; +} + +div.close:hover { + color:#FFF; + background-color:#000; +} + +div.navnum { + width:100%; + height:20px; + line-height:20px; + text-align:center; + font-size:medium; +} + +div.navarrow { + font-size: 30px; + text-decoration:none; + cursor: pointer; + -moz-user-select: none; + -webkit-user-select: none; + -ms-user-select: none; +} + +div.navarrow > span.inactive { + display: inline; +} +div.navarrow > span.active { + display: none; +} + +div.navarrow:hover > span.active { + display: inline; +} +div.navarrow:hover > span.inactive { + display: none; +} + +table.programs { + width: 100%; +} + +table.programs tr { + background-color: #EFE; +} + +table.programs tr.selected { + background-color: #262; + color: #FFF; +} + +table.programs tr.dna_only { + display: none; +} + +table.programs.alphabet_dna tr.dna_only { + display: table-row; +} + +table.inputs { + margin-top: 20px; + border-collapse:collapse; +} +table.inputs * td, table.inputs * th { + padding-left: 15px; + padding-right: 15px; + padding-top: 1px; + padding-bottom: 1px; +} + +/* program settings */ +span.strand_none, span.strand_given, span.strand_both { + display: none; +} +td.none span.strand_none, td.given span.strand_given, td.both span.strand_both { + display: inline; +} + +/* show the expanded motif only when the collapsed one is hidden */ +tbody *.less, tbody.collapsed *.more { + display: none; +} + +tbody.collapsed *.less { + display: inline; +} + +</style> + </head> + <body data-scrollpad="true"> + <!-- --> + <div id="grey_out_page" class="grey_background" style="display:none;"> + </div> + + <!-- Help popups --> + <div class="pop_content" id="pop_"> + <p>Help poup.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_motifs_word"> + <p> + The name of the motif uses the IUPAC codes for nucleotides which has + a different letter to represent each of the 15 possible combinations. + </p> + <p> + The name is itself a representation of the motif though the position + weight matrix is not directly equalivant as it is generated from the + sites found that matched the letters given in the name. + </p> + <p> + <a id="doc_alphabets_url" href="#"> + Read more about the MEME suite's use of the IUPAC alphabets. + </a> + <script>$("doc_alphabets_url").href = site_url + "/doc/alphabets.html";</script> + </p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_logo"> + <p>The logo of the motif.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_rc_logo"> + <p>The logo of the reverse complement motif.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_evalue"> + <p>The E-value is the enrichment p-value times the number of candidate + motifs tested.</p> + <p>The enrichment p-value is calculated using Fisher's Exact Test for + enrichment of the motif in the positive sequences.</p> + <p>Note that the counts used in Fisher's Exact Test are made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motifs_uevalue"> + <p>The E-value of the motif calculated without erasing the sites of + previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_more"> + <p>Show more information on the motif.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_submit_dl"> + <p>Submit your motif to another MEME Suite program or download your motif.</p> + <h5>Supported Programs</h5> + <dl> + <dt>Tomtom</dt> + <dd>Tomtom is a tool for searching for similar known motifs. + </dd> + <dt>MAST</dt> + <dd>MAST is a tool for searching biological sequence databases for + sequences that contain one or more of a group of known motifs. + </dd> + <dt>FIMO</dt> + <dd>FIMO is a tool for searching biological sequence databases for + sequences that contain one or more known motifs. + </dd> + <dt>GOMO</dt> + <dd>GOMO is a tool for identifying possible roles (Gene Ontology + terms) for DNA binding motifs. + </dd> + <dt>SpaMo</dt> + <dd>SpaMo is a tool for inferring possible transcription factor + complexes by finding motifs with enriched spacings. + </dd> + </dl> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_positives"> + <p># positive sequences matching the motif / # positive sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_negatives"> + <p># negative sequences matching the motif / # negative sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_pvalue"> + <p>The p-value of Fisher's Exact Test for enrichment of the motif in + the positive sequences.</p> + <p>Note that the counts used in Fisher's Exact Test are made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_evalue"> + <p>The E-value is the motif p-value times the number of candidate motifs + tested.</p> + <p>Note that the p-value was calculated with counts made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_motif_uevalue"> + <p>The E-value of the motif calculated without erasing the sites of + previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_word"> + <p>All words matching the motif whose uncorrected p-value is less than + <span id="help_add_pv_thresh"></span>.</p> + <script>$("help_add_pv_thresh").innerHTML = data.options.add_pv_thresh;</script> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_pos"> + <p># positive sequences with matches to the word / # positive sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_neg"> + <p># negative sequences with matches to the word / # negative sequences.</p> + <p>Note these counts are made after erasing sites that match previously + found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_pval"> + <p>The p-value of Fisher's Exact Test for enrichment of the word in + the positive sequences.</p> + <p>Note that the counts used in Fisher's Exact Test are made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_match_eval"> + <p>The word p-value times the number of candidates tested.</p> + <p>Note that the p-value was calculated with counts made after + erasing sites that match previously found motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_seq_source"> + <p>The sequence file used by DREME to find the motifs.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_seq_alph"> + <p>The alphabet of the sequences.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + <div class="pop_content" id="pop_seq_count"> + <p>The count of the sequences.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_alph_name"> + <p>The name of the alphabet symbol.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <div class="pop_content" id="pop_alph_control"> + <p>The frequency of the alphabet symbol in the control dataset.</p> + <div class="pop_close">[<a href="javascript:help_popup()">close</a> ]</div> + </div> + + <!-- templates --> + + <div class="template box expanded_motif" id="tmpl_motif_expanded"> + <div> + <span class="tvar_logo"></span> + <span class="tvar_rclogo"></span> + </div> + <h4>Details</h4> + <table class="details"> + <thead> + <tr> + <th class="match_count">Positives <div class="help" data-topic="pop_motif_positives"></div></th> + <th class="match_count">Negatives <div class="help" data-topic="pop_motif_negatives"></div></th> + <th class="match_evalue">P-value <div class="help" data-topic="pop_motif_pvalue"></div></th> + <th class="match_evalue">E-value <div class="help" data-topic="pop_motif_evalue"></div></th> + <th class="match_evalue">Unerased E-value <div class="help" data-topic="pop_motif_uevalue"></div></th> + </tr> + </thead> + <tbody> + <tr> + <td class="match_count"> + <span class="tvar_p"></span> / <span class="tvar_p_total"></span> + </td> + <td class="match_count"> + <span class="tvar_n"></span> / <span class="tvar_n_total"></span> + </td> + <td class="tvar_pvalue match_evalue"></td> + <td class="tvar_evalue match_evalue"></td> + <td class="tvar_uevalue match_evalue"></td> + </tr> + </tbody> + </table> + <h4>Enriched Matching Words</h4> + <div class="tvar_words"></div> + </div> + + + <div class="popup_wrapper"> + <div class="popup" style="display:none; top: -150px;" id="download"> + <div> + <div style="float:right; "> + <div id="outpop_close" class="close" tabindex="0">x</div> + </div> + <h2 class="mainh" style="margin:0; padding:0;">Submit or Download</h2> + <div style="clear:both"></div> + </div> + <div style="height:100px"> + <div style="float:right; width: 30px;"> + <div id="outpop_prev" class="navarrow" tabindex="0"> + <span class="inactive">⇧</span><span class="active">⬆</span> + </div> + <div id="outpop_num" class="navnum"></div> + <div id="outpop_next" class="navarrow" tabindex="0"> + <span class="inactive">⇩</span><span class="active">⬇</span> + </div> + </div> + <div id="logo_box" style="height: 100px; margin-right: 40px;"> + <canvas id="outpop_logo" height="100" width="250"></canvas> + <canvas id="outpop_logo_rc" height="100" width="250"></canvas> + </div> + </div> + <div> + <!-- tabs start --> + <div class="tabArea top"> + <span id="outpop_tab_1" class="tab">Submit Motif</span><span + id="outpop_tab_2" class="tab middle">Download Motif</span><span + id="outpop_tab_3" class="tab middle">Download Logo</span> + </div> + <div class="tabMain top"> + <!-- Submit to another program --> + <div id="outpop_pnl_1"> + <h4 class="compact">Submit to program</h4> + <table id="programs" class="programs"> + <tr class="dna_only"> + <td><input type="radio" name="program" value="tomtom" id="submit_tomtom"></td> + <td><label for="submit_tomtom">Tomtom</label></td> + <td><label for="submit_tomtom">Find similar motifs in + published libraries or a library you supply.</label></td> + </tr> + <tr> + <td><input type="radio" name="program" value="fimo" id="submit_fimo"></td> + <td><label for="submit_fimo">FIMO</label></td> + <td><label for="submit_fimo">Find motif occurrences in + sequence data.</label></td> + </tr> + <tr> + <td><input type="radio" name="program" value="mast" id="submit_mast"></td> + <td><label for="submit_mast">MAST</label></td> + <td><label for="submit_mast">Rank sequences by affinity to + groups of motifs.</label></td> + </tr> + <tr class="dna_only"> + <td><input type="radio" name="program" value="gomo" id="submit_gomo"></td> + <td><label for="submit_gomo">GOMo</label></td> + <td><label for="submit_gomo">Identify possible roles (Gene + Ontology terms) for motifs.</label></td> + </tr> + <tr class="dna_only"> + <td><input type="radio" name="program" value="spamo" id="submit_spamo"></td> + <td><label for="submit_spamo">SpaMo</label></td> + <td><label for="submit_spamo">Find other motifs that are + enriched at specific close spacings which might imply the existance of a complex.</label></td> + </tr> + </table> + </div> + <!-- download text format --> + <div id="outpop_pnl_2"> + <div> + <label for="text_format">Format:</label> + <select id="text_format"> + <option value="0">Count Matrix</option> + <option value="1">Probability Matrix</option> + <option value="2">Minimal MEME</option> + </select> + </div> + <textarea id="outpop_text" name="content" + style="width:99%; white-space: pre; word-wrap: normal; overflow-x: scroll;" + rows="8" readonly="readonly" wrap="off"></textarea> + <a id="outpop_text_dl" download="meme.txt" href=""></a> + </div> + <!-- download logo format --> + <div id="outpop_pnl_3"> + <form id="logo_form" method="post" action=""> + <script>$("logo_form").action = site_url + "/utilities/generate_logo";</script> + <input type="hidden" name="program" value="DREME"/> + <input type="hidden" id="logo_motifs" name="motifs" value=""/> + <table> + <tr> + <td><label for="logo_format">Format:</label></td> + <td> + <select id="logo_format" name="png"> + <option value="1">PNG (for web)</option> + <option value="0">EPS (for publication)</option> + </select> + </td> + </tr> + <tr> + <td><label for="logo_rc">Orientation:</label></td> + <td> + <select id="logo_rc" name="rc1"> + <option value="0">Normal</option> + <option value="1" id="logo_rc_option">Reverse Complement</option> + </select> + </td> + </tr> + <tr> + <td><label for="logo_ssc">Small Sample Correction:</label></td> + <td> + <input type="hidden" id="logo_err" name="errbars" value="0"/> + <select id="logo_ssc" name="ssc"> + <option value="0">Off</option> + <option value="1">On</option> + </select> + </td> + </tr> + <tr> + <td><label for="logo_width">Width:</label></td> + <td> + <input type="text" id="logo_width" size="4" placeholder="default" name="width"/> cm + </td> + </tr> + <tr> + <td><label for="logo_height">Height:</label></td> + <td> + <input type="text" id="logo_height" size="4" placeholder="default" name="height"/> cm + </td> + </tr> + </table> + </form> + </div> + <!-- Buttons --> + <div> + <div style="float:left;"> + <input type="button" id="outpop_do" value="Submit" /> + </div> + <div style="float:right;"> + <input id="outpop_cancel" type="button" value="Cancel" /> + </div> + <div style="clear:both;"></div> + </div> + </div> + </div> + </div> + </div> + + + + <!-- Page starts here --> + <div id="top" class="pad1"> + <div class="prog_logo big"> + <img src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAIAAAACACAYAAADDPmHLAAAAAXNSR0IArs4c6QAAAAZiS0dEAP8A/wD/oL2nkwAAAAlwSFlzAAAPYQAAD2EBqD+naQAAAAd0SU1FB9wLGwYBMoyhiwgAACAASURBVHja7Z13fFRV9sC/503JpIeaKFVREBQVEEFFQVcUuyDouuraFoVV17IrayPjDP4U3XXXhrpiXxuKKF1dV8WCiEgXRUAQlJIYAilMf+f3x3szmVSSkICyOR/eh8wr9717z7mn3XPOhRZogRbYLQiQJiJGy1D8D0LHjh1/XrZsmQK9gU3Ap0mE0QL7KTx411136Z///GdV1ZhpmvrYY4+pqsZUVceNG6dAz5Zh2j/hnpKSEtM0TVVVrfq/qmosFtMxY8Yo8CPQHejucDjyfm0dbZFp1WGaxmJ3ppSWSiQUIhQKIWJxehGhpKSE1LQ0uvfowQHZ2exYt65D8dq1qzUaXR2LxTYCP7UM4a8MVFWA9mY0+nLhmjV63LHH6vMvvKATJkzQfn366CtPPKEDjjtOV61apeeedZZqMKgaCKju2KFmYaFqJKJaWqqqqoACR/9a+u5sQT+IiD77zDPbKCnR00aOZPHSpcydO5fLf/972rdvTzgcZsEnnzDmqquYPmsW/PxzxbMOB4NPOokRZ5+tB3XrJsAUYKmqOkQkVuVVKUBGDRbGz/vSvPlfBHcVDpB7XP/+Gz9/5x1mzJ/P1i1buPbaa1m/fj1du3alW5curPvqqxobCoVCpKSkIO3a1Wc89bCuBy51OZwu1RgiBqGYGf1uw09/Bd5t4QDNT+wKfPXoxIl9jzm6gkt/OmsWn3/4oRIMyrfLlzPuzjvp27cvHTt2ZNGXX+K/7baaW8zJITM1lflz5wL8ZtWqVWm9evXaVcv7Q2cN6hM68tAuR2MIhirFpUEef+MdBFK1RQQ0v6g/MC9PLxk5Uq+/7joIBECSJmwwKKqKR4RTTjyR0885h2effZaNa9Ywa9YstKQkoQzGwSwuJhwIwK5ddO3a9b+9evWqjQPoSf16qUOQles2gYLL5WDaBwu5dtSw8L/eeKdFB2huaJWTo0NOOMF8wOs1qiG/QhfghtGj+dMNN4DblhJlZVBaWg35AIYI7NgBbjcbNmwwjz766I+WLl16OfCDfUs3YB3AAdke6d7tYNR2Jv6wuZA2rbIwxbFPxfD/jBn4t7vv5uUnnzRsTNelEEIoBKWl1qH1YM7hMAXffWcsWbBgMLAB+AgoAtYC5SJCp86dUTPG89M/ACASi1mDH4u2+AH2Bvzhpps+p3Xrmi+mp2Oa5h613y4nh1WLFuHxeHTq1KmDVbWVqjJjxozU4cOH88rsj1FXKteMOh3D4eQ/ny/hjnwfn32zyWUYxtAWK6D54YW1X355WbcePSr32elk1EUX8cYbb1gzvvG+BEzA2b49msQ1RARVZe7cuTzzjwl079qB6R8s4PhThjF58mQADjroIDZs2CAtBLAXFMEaTwaDe4R8ALKzEbcbVUVVE4hP/t/lctGnTx9+c8op3HvffQm9YubMmZx77rlic2Rzbw7I/5oreNzJgwapqqI7dqA7d1pHSUnyVG5Uw0MGD6agoCCB7IQ+kcQFIpEIkydPZszYsQmuoaqEw2H95JNPdOHChTHgervJT4DTWzhA08OjwGWT7r8/u3xXhckei8W47c47obwcMjMtsy9OEHUojdhI/M2oUXwwb16dIqKqJVFaWkJmZlal60OGDJk7b968M1SVsWPH8uSTTxYC7WmBvQIbV6xcGQK0aM0a3bRsmW5fu1b1559NLSzUakdBgXXYawC7A0CXLVtW7fzMmTOrnTNNU03T1OXLl5u1ia4WaA4lQbXVmDFjcoFcIHfJ0qUXqKqaBQXVCMC0kZ+MtNogEAjoli1bar0ef/bee++tiXDMFszsQ+jbt+/r1111leqOHZWJIBBQ7913azgc1qaAeABCVUKqQgBvAO8BL7RgZu9xhd6nnnpqNLpzp8559VXVkhL9ZOZM/X79+j1Bdm1sP2KaZix+rqioSBctWqSqejPw2KhRo+IPxjp06KC0rOg2p82AkE8O4zkbiAJ6ySWXVJLRjUW2qmqrVq30+eefr3RrFWYQf4+pqjpq1Khq7zYMY4/0g5agxppgPCnARcC1GPRFSUF5gAn0VNVz69vMkiVLWLNmDRdeeGGt93Tu3JmNGzfu1slkGAZbt24lNze30jWHw4Fpmo3GYwv7SIY7GYKD8UA/INteQFaKEL7iqBNPPPHYhjTXp08f+vTpU+O1rVu38sc//pE5c+ZgmiaGUbtLJu5HqMNdfYXT6VwdjUY/b+EAdXm9DMNlmmYrAA/I6SKe6ao/JM38v2Pw52oPrgV9Seu06RugTzT62ZogNzeXbdu2ISIYhpFmmmagxRNYC7Gbptlnw5Il29Z/9dW2H1ev3jpddQPwQ79+/f5k32NNsSpStdeSXonZ99JLL+0RAkWEG2+8samUU7Zt2xb3KKppmptbREAd43Vwly5fdDniCLS42DoRDILb3fnRiRPzLzzrrIdVlX9MeoKCw36GSMUIpaWlJVh0UVHRHiPt4YcfbhqKruxyFiDUIsfrhpWAfjprlpplZVZUb1UHTyBgRfnGD1Xt0KlTvR0++xIcDodecMEFCvxDVXv/79nrM2lnzuAanUWdnV8InzocDu104IGqO3aY+vPPWqOrt7BQdds2jcRijTLzmsg5VO93RCyCNa+88kotKCgosTnC6f8rIkD/PGcsQ044AYAZL9XOgkdfdlnxibEYuzZvjkpOjrN1q1Yc1Llz4p4Lzz+fcePH21qBidMwGDhwIA8++CAn2O1XZcWjR4/mmmuuoX///k2ruIjw9ttvc/755+9enjudAGIYBu3atctUVXr16vXOqlWrOovIpv169pszeX/yP/9Z+0xOPqLRymy+yvHp7Nl61tChetbQoTpt6tRaF2x+qSLh6quvTvw9adIkE3hrw4YNjv3WDNSZDEZ5/6Hl9zhvGjsWzKZbOykH0tu2Tdjie9H9XCmYpCHPjR49mqeffjqZi5iq+jQwVkTM/c4MVCUfcM564y6u+8ufmxRRV1xxxb6xWUUSR0Ofa2clqdgSzOTVV181otHoNTNnzjxjv9MBzBl0EeUUNeD9e2Dkfc/z53xPnUGeN4wezcFHHlmvwX1j1iwAJk6cuNf7tmLFit16CavCww8/jMPhSHZ+sWDBAi688EL97W9/O0tVPSIS2m9EgDmda8XgSRRFKvqjigooQh85h+Xx819BaxO2nQ/ODGAjrA5A9WyeTA4kg1y2UCnO75cOJ510Eh9//HGN10aOHKmLFi2a98MPP5y834gAEYaikIx8+7wAhpr8oabnpgMvA5/Av4C+1Y5bWMRoIJUXBg0apL8G5KsqH3/8cY0iUFWZOnWqnHfeeUNUtcPeJoBUwFPHkdoYbqQ+BBiitYVMWYs57iqnYskv0trEoGlzjXGMX7du3R3RaNMlcDz55JN1c7VGKrFVg1DjiE++duutt6phGAtV1dhbBHBW6+zM0iM6tSkccFTPwv6HH1o44KiehUd0ap34PahPr0Kga4MJ4CjOUWgjUgvxKIiDc8yZpMVPReEkrZ/uk2hz69atr7344ot2i3sOY8aMqRXJt99+e40yf9q0aU2iRHbs2FEGDhx4wPr1689sbiXwcDEck3My044ePWKo4dRwRjQUILPtgZRt34rDeTCxWJSs1rk8PmUOKSkeCYWCDSR5OiXQpLYggLCCS8TCv0CmmBWELtDNThPeKZBdzzdtuPrqqyU1NVXPPPNMsrKyqs26hkJtil12dnaN7HvEiBEN1kPatGnD9OnTOe+88yqdnzRpkoiIpzk5wMnZGWkrhxxz+HG3XHRqqsPplPKyMlxZ7dkVCODMaEtZeRlpOe3419S5dOt8ANFYrDHy/5i4wocgKH9Xg0MFvkiewVolqNKexu+p5TFIq+/7fve733Wcm5PzStzbJyK43e4mHbjbbrutmgyvmmdQX+jatSu1ia4tW7asbS4O0Mntcn5wxx9GaUlJiQQiiivFQKNhHAaEy8pwuj1kt8njqTfepXvXA+nToyvzvlzZCK2HYxGsf8oKPNxunE5U3+Kv6uBdBI8qHlEOB76sLiBQA04GfPV840/dIPDEV1/dd5lhXP0TLAmrzveIyKlnnXV3z549uSknp/Qf27dnDh06lGHDhu2RLG+M4ygOmzZt4swzz+SCCy6o8f7PPvtsS3MRwPI22Zn61LT3JRwoQw0noIg4UP0Wp8uNwzAQEbp3PZDB/Xqxs2xXwzs8B6dGcNvs3BST2+V0ogAynI/N6SwTYYCCC8FTnQEkwNEwqYNDwbgZCoAPROSBL6CLMXv2rctmz85eC5suX7Yss3fv5lmMi0QiqGo1ziMiZGdns2LFCjp37kynTp3w+/01EoqtDJY0FwEEI6FAzgF5OQw6vi/ZuZ2qsDTFYRj4n5pKSXmAwcc0cqBCHC0ODrFlf1TdLK6CqWUKA5IxvhwkDCfsoSY3AHhCLQKIZ+x4gNgy0KOgpP9RR5kh1QNVVZrafEx28lRF7M6dO+vFXbZt2zYzLiKbRQfof2QvBg/sh5HZlrJdAcp2BSgPBO0jRFnAUvaGDuhNWKVR+XhacQiwQkJsq9RRk9fFVgvjKCgHUTjY/j0TCNOApItnraacWAUgNgI9kr4n8Hu4HejxCVwhIufbkT9ah07RoD5PmTIFwzBqVCDrS2hjxozh0ksvzW1WP4DGPTGqlO/4GTEMMGMJRBticGiXA4hEYxAO1J17V7sCmJpkq70vw6shsrwWV6fadPGFQkSg+6dW9a7dQtuK7glgSAXxuA3IFbgnaQhmPvroo2kvvviiTJkyhfnz51ebsa+++mqD+nzRRRdVUxAbsu6hqvztb3/ToqKi9LfeessNuJqFAFJcTsx4UqXhsIY8o03i7x+3FfH1uk10ymvbKOTbLP4uxEaFWb3CVtw5ZP9f0yw37OttU6mkI9QK7SALONh+7geFTp9bhHBI8jsdkGkTQeDyyy+XRy6++MCJQ4aQ4jJwuxy4nQYOw2DqM4/w6KOPNsi/EJ/p4XCYYDCIiDBz5sz6IF9FhKysLFHVZ4YPH74DiDQLAfxnwTI8bhcA6QceCmrCrh1JyFGcDgebC7ZbMe+N0XohB0BNtkuUFdUNapYqrBTlWnawIPnRKm8z+sHO+rzTsPP3HfCdAcUKrRwWAcTZglj0WNmpNV+15OgLYMLYU/nsoYP4+w0D6NPzIFYu/YqbLDEhDZ3NW7duZf369agq55xzTr0IZ+TIkfTs2fMqEflns4qAXcEQD7000+pQeBehcMTqY0paJXZkGILDYbDw63UYTkcjGQGFMrJ6oUXjZEKEOEHOZbJcTsy+1wW018revtKvbGKqr3SzxYgA6tiNFxFg1nhy+x4coaA0g+8Lc1mxqSsOw8CMmYrAIYcc8pWIMGHCBD744IN4mjGzZ8+u9UM6d+5Mz5496yP7TWDh+PHj5c0337z5m2++eS75YnNYAUuBYcUlZRTtLKNtNjhTMyAWhkAJVCm57zAMPl60ktRUD4FG+Nu1jjUEYxQlVe51A22A4hDsTIEihdxwPXUAJ7QywWXP9gKgvQluhSyjMmEkOqmzOBqTawpLiKalf+WcumQkaZ7VRCMRwsEyycnKCq9bt+4e4G2v1wswbs2aNfcfcsghnH322XsU26CqFBQUGHl5eZMsCca/apSDTQxnAEsNw+Bfb7yDw+nAiIYs5ljDfguC4HQ5oQEeOX2LTsDRtgqwraHjIrDhBNgKfA+kOmFIPblNOhADchXuAGKm1auOSRbJarGqh6PT6YPJuTj4dvgDrPv7zJNp3+pHwsEQS77bqNlpLkrLylxVfBEP9OvXL7t169bFzzzzTKMJIO4YysvLU9216wWgNRDYGwQAdrFkj8dj6WmGUaupVx4MIohCDXK8ts45SMewuJdq40usaoUdbzRABDgU3hZrrwBxWs/GrdJLgamAQ+dyACnI1PlDNslZW5Z/tvxC98at82MSLg+nOwkhEvnHy+8QicYEeDP5JSUlJSXFxcVnXH311Yfcd999DepTfJFpxIgRiAgbFi+Oh8gJtWnCzQBvJ3ynBdvrObkaKPs18aDRAIRrfcVHLc9nWRYoOTbCU0LWgpJD4Zn+VoiBiIGDCA+tWt/5xElPnb/11uzhOfD6tNUb1sy654XZcx+c8v5MPPpM4Q0l5yb67k36tnyuwcsaYN2bb7652lbidzvjwUpIFZFvZ8yY8U9AFi1bJpgmpw4e7Hn8iSfa7y0C2BFXmMLRmGUFZOVZXKBKR9I8KbYzr/khDVphKYJxKGggAXSsgWhjapmBAfueoKTQ86ftbd4cNvZv342KPtj3b/4FC4C/AOfbxygC/BGYjJerKymY+dyNn6fwsR1g8eLFh4kFNdr+yev9IsLAgQMBnjFN8xawah8RCjH12Wfd2dnZf9pbBHCl9U1JXj61TfHUrEZX4tpTiMJRgEcrMPiuzbu7NcDqSDYHDCzF0p0w5WBtaSDd3fGKDwdc1/rO464bt+kZbmRrjY35yQMW4+VBNNH0kYnr3sS5/r17917bt29fzjzzzER0kmmaiAiHdu/OgL59WfzBB0QikUqv+L/HHoNWrcjOztY/33jjnap6dnNbAYmPq8S2DAcYTUdvWuGTq7PAnzmdozEpM4azNsmMe99G5nr791H1fGerJCL4RKCvEzpbcSd8Y99jOohFx7cfNf/JS9Yu5C4b+V5yUcZWoiA/d+NjCV4mIVxGPjvwVzJJ7yGfUvxMXLly5aH2uRduvfXW30+bNo1Vq1bN9Hg8Zxd8842069TJKoAdDlf65uVLl743b/bsUwcff7zx1xtvVBE5CpjV7ARAJbepQGlBHaK+gSqA4BZLoIeBGnOAzHcRCeJVAy9wElbd3jgU1TyhdwuH2Q+8HYMrndaagClgKBTbDao4gtnzTlr93YZ/sslm688AF+InM2l2tyKfAEIaPo7HyybCDALgrwzEzTx8pPR6rJesYlXyN1z+97///fKMjAyXx+OJANF2HTo4CNSaFX76I5Mn6+Djj+emcePkhWnTzli6ePH/NbcIALghMcBij7DhqHGkXbYTyOPxXFw/9sJVGveKhqkWSWK+TT8JsdJGfk1UmdKYDomle84Pw4VRCKj1uyPQmQo38I8pMe75eGqSVePnanxJyAfwUYyfVOAa+3enj679aMW9H99bFLwn+Ln6NWKapq66flWNxFlWVhZpqNiipIQ+3bufoKr/anYCcDqdyypZ+6oEgoGqwbuEI1Fuu/J8cjLTFOhUrw4ZpCS5X6uy/KEYzEfoJdVV/Y72gMQX0x0NHIc0gc3HQ2SQlXi5zrAcLO74esMxML8//LsBQ/U1+TyOFx3yxJCH7njjjpM9Lo+ISIZhGPVhjY7vvv66Tg722cKF4HKBKrfecIOKyEnNTgAulyvJTWmha9eW7xEUl9NRKcwpHImi2mCTrDboIVW2hEl65veSNCkUFoiFyH71fGc/S5dMNBKxiSgSg28bOVSfIUxC+fCREY+s59GKHIZ6Qu+1dRealq0FBectWLBAAXr26SM9DjnksCVLlvTdGzoAYhgEy3bgycgmvU0eGijhgHatq/mw60fsu9ccpGK5tyZiidp/L7bPXwakaP11ALcJHye1G8WS/+4YBBs1QD4U+Bo45U/+PzXK9e5yuSq6XD3aWIEZp40cKSUbNyrl5fLa5Mn06dMnrVk5gL0Vm+XtKy4EEVLSMkGEDZsLKsKi7aybmy85m2CwYWOoDSeUDvbfZQthmgF3S8NCvdVIcqfO5oznT2POfxww5Xj4jn0Dg6KRSJyd0uGgg2q8qbSs7IzNP/0ksViMjPR0Jk+e3LwcQERmqypqmrTueDCoJpb+K0W0CIgKu4JNU91E6yYE077+qgGt1FoXkPrQ0nJwhaBrhUqxsN/duLIBTz+YyL6DBWaSuR0Oh2vMZDZEPuzQu3eJqmYempe3CXikua2ADBGxAkOo0AUioSrmSkome6sWssI2+0vi9nz8w7IWWG7eWmGXpVekAz/Cyr5geCD2M5hL+IWAmiaFRUU1LiCZqiERWSYiAaDL3jADUVW6dcy1RlmsSOBoMgGoWg6iRkYFST3PKbDQ0tYHUF0/UIEsl4XcOtcRBCKTuMYNWg6aB/IK9Iv9UghARKo5gqrg46SsrKz2e8MVXAnHoJDexqbS5HAMgWBZk7J7Tfo/mfdErb46arLt6/MuAzmojPSVU7i4OwT7gsyDfr+oqlyqWrHbWS1QUlJSvldcwTWlMZmmSVp2a3YW7UiSylEUSE9NaeIPoFwAFdJFCRh7mAp/LLo5j9e+DZAxEPgDHFP6S0G8y+UCtxsxDFrl5OAwjB9i9UwwbRYCSE1NTVFV0jzuauxZq85XO7Pz+Rkf4XanEA7Xf1JJ7d66dUQZpk7mohyCtQCkdbUT3s1YCItag7YB9wg4KvhLmvnDkmoR2/L/jfo+21wi4OGYaeqNvzuLmGnaYeL2QDprZlE/7yhtsC9Aa+7RQkyOM0awNp4cqyYxo3osQPJvtxN+U/fbytdD/zN/aciPm9zxgwZyuuYiAAUkGAoTLN2BiAFlRVbwlMOdUFhcTme1Ldb2WBE6h4XG+RRW0gOcGAYcYfdXbeSLwncmPG/fuxsZNHj3PNXLoc2K6b9wYigSupwbGNug527nZrxMx8uBe4sAKsynnUVWSFgSbYgITofBh4u+xu1qvBTanQEvlf9ok6R6isKiGBzeiJjCuuD4ZhvIfN7DyTtRjT6vj+gk7iJGvrUEXQdBtsPL53qvrsbHefjYvNcJoE3nQzFj8awgC11tsjO57OzB/PDTNis82jSJRmON4TMOcXNCXaZbTQShMMMJJw5M8utT+e+KJmJEGvBF/ya/0rJz04Gf05hIevq49C4dHuwgOkEnTr94+pXG3UYxXsprQH4PrEDQITEz1mGvKoGVNP9YLCGI4/hwuxw899qHiQCRcCRK6a5Ag6phYWn4DkyOISnAIXFtFjlqkpcsEW1q+MgDI3tXlIOOV1o+A3im0uRQbuGeKtE8Xt6ASkEoG/BhpeH6MPEyGS95+GqJAtpTeIiNm9kssk3ye3ftfT3wb5SX8PIZJrOZwL3cxFCUTvh5FqB/Xv8ruZNcHDyBn6K9SgAJuW6HhyngcDj3SN5rZQO+ZtYRpZc4yNDqzy5OQj6KpS9QOd4PDCbhY2MVNjwNHyOqEMQBeNmAcjF+PsdysZ6FFR3cfJDKSyu2rTDwsxYvxUC7Nultvp7749z/e+ubt7hv6H3xYNO3T+t2WtclY5fcszeVwKpmScULDQc7Nm+o17NL4IAaiUoxRHfLHQ6KZ2mQTlShVy3WY827bFRFvsWGR9Rw3xZ8dMXP53h5Dx8BlEnNrvr7+R5hjv0NrVCuL7qtqMexHY+VNFcaqvoR+UTxcf7EoRPz97YVUAnh5TsqZ25Z6wG1Y3ARdPsSvozC+Fq8iy8ma/k1EolB3wSq04hRS9yfNOVChDKKfD7GT64d5CE1yOamLBjQm3y+sAniIfJR8vnD+Nnjh8pd0gc/zqlfTxXqSH5tdgIQh5NYknPHNGO07nCQlRHkMFizcUul+7+EEQrLgWMEMudXDuOOY62Iiiz002tBRq5URnQ8O2JHLZ/q+XRPRaKfnfg5iXyOAYIog2v4rqvx8h7eSvpG48BHCD8D8NolboQr8PM0afyH/yP7uSXP6cjDR6qIPLbPCKDs581ktM2rpIkbTjfZGWm4nE4Wrfo+ce30aPQ0gdelIk1suLPCfKvNDGxXTfGciaHKwBruj5kwt5bmfmoSVuAlHcGNn1uQJI+cl1S8BPDzND5Ow5fIB2gKOAkvgo8X8LIVH4KXdVf2uVLI54p94QhKhP6nt26PiGHrAla9gFgsyvUXDSMQDNOv18EJVt5F9US1F2xs5LqB3+7GE5ii06tk95aSJkJ2LSKiqkNnrcIcAy48sWZTsKGzshyYZn/gNXjJJp8XUVrjs4paNDn4OBl4CC9ulP72uW54KUCYXdejzWYFHNyhPSJimYGGEzSGQ6Ns27KJtq1y2BUKgcbo0eVAAqEwrbMyMIp3uqtYbS7g8M/BcVwVbV8FEUUx6KIx+gIfJC5mcCbQVuIpRy5q3WHTgMIoXNKPKra0lwwUL5L0XqsYXVHco4iSDfyIn8cT8t0K8boLL0OB2cBDwN0Im5uV1fqI70S1KencbncdbzYC2Fq0w1oRVAVPBlq+nSlzP+LIzq1p1+aYRKZQLFEfUCv7kSvs80tdcC8VSRyIEFOTXRikq5WVcYr5Jh8aF6Dm2xgoN2Hlo/5HlFOD82kLdsx9FehnvW5HFXOvLVao9yuAQRTFQRQoRVmAUGqXoC0CnHgZh9IJpTtesvDxNF6eQ/Hhr+Id9HIYVuyBAEvwsU/jCZptLSAQClcIanEQDEdZvbmYEjMlYRq63W6m/OdzAqEwRTvLksmgIMlec8bssiwJ2Mk6YGVivV8ZKS477l7JQ+hjhyGEENAwTir0it33WSgGvkH4FlhVMr4kHViG8D1CayAHP53x0wc/vfHRFZgBPAisw0suEKiG/HwUK5l0FfD1HiE/n3FNgahm4QDJAaEgEA3iSXFxxx9GgghqmoghqEKq221XXDLi4rnIztm7LE4ADhgO/DfR4qWY5vREHJGqcChwhU5nKvCICh5bh1ibrAQohBywsR7sNEZS8GeWL+sTVT1fRKYnIWAW8Cx+W977GW4j/jzgRdTOcfAyFzgN2IKvCU1AaRrcNRcHGNOtY57l7bM9gPEUIVEzyTsIwXAET4qb1tnpcc3RNGGjWCHcaiPy5K9qswbssvCi/E2Fb9XgAtFEINKcKq7gsEKjQpAqId9C+NkIHrxMJZ8rbcLZBrwOvIcQxcst+DgDHw58VTyNzQVeO9MI4E+cz1+rW0PNzgFEhB8LiiqigtQEhxuJhSElA8JWZdBIOMzFw04gEAqT17YV5s/FCEwOw/1uuFEgw9L36Bi1qm58DqBvISqsUOhvl4lVxMrSTSDf0hVMtf6PU44a0wAADOxJREFUn3I2qcD18YqtJ1js3Y/gs7dq86JNMuO9OFBS8e+GcL38AZiAz/ae3sIgfVD/DVwo98veNwMPaJNTMdMjAUhrXaurWFUZecoATNMkBl96rLy7Fyo8v2Q54KoEgQ1HxeRf8ZTqeLl4iXMEQTD5UiN8KyDFy+gOuAVGD6SGlbOmYcmLbUSk2cUeXE3UsgehG16OrOJFrIrVc/FxAF4EL7dKpqwTkUzJl6v3jR+g0lqAQLicJKldjWNErcgh0wFb+kFU4Lvk5VyF3E+pZEerUPtSrQg7RXAA6wrnkgrc1h9ea0YzrJ9tBu6yZ36sidotx8cylP/aJibkEyJ5BTSfyfiIb2t/JcpoRXfh5SGEW+pyPze7J9CMRSzEh8vt11X+lnhmcHFJGbtgmwkLbYTPxpbX9hMnpVvr2xb2f2IpymqtzUOovI6DHRRzZHgbT/SHvze7/PUlqZy+Jk528NMOr+3UEYL4WJbk2ppuE8Ig4EH8dMfaMfRW/Gys61uanQBKCjYj8WqhalZUDgXEcLD42/VEojEem/IuLpcz8aUGbLft7PipzCgk0seN64iqEJUaOI/d/Eo5n1K5nED/2v3/vzaovnI5nmKdoGWMYxTwHj5a4eVRfLyOb/fBLM1OAK7UNKLhoB2IZev0CfvOwdpNW4nFYjgEypTCATbCTYvdB5NYhgGc+kVyAoda8Xw1sIAdmKxkfwMf99j6Raatb/TAYCxw76Aeg/6CnzTyeRz4x742AxOQ2ToPrSNGPVEvwDA40TTzAeZDZwP+A/TQCnkPMESS6wka/KhKTLWyG1FMJhvDKWV/BCUdtXZCE6QNPl57/MvHp8/fNH+aPaAd8FV4TfeZK7hCyzdxuOrOVkn1uGmdlU7fguDOhTBArLp58Uze5AQfF3AmtoUg5bxDGisQjrb3CUSEsLIXAjL2FfjZBTyLl+s0omNV9XC5XT5iIifjJYqvYTjdK9vGWYtCUWKRcC1EAqaVMpYr8K5ABxvzPyu8lMQFDIE+iXZ/S7kq/1TTrk5v7Rs03TiXH9jfQXno5d++/FdLg+YW8nkJu0DnL44A4gpf8eYNSKisxpKx9se8FN/JS+FHE07TuPPHeqrs2zwrGijJ3HsT4d9qEkL5gihj+F8AofCSIy+ZLSJiHGCkImTga7jes3cIQBwI0LZL90T5uNQUN0n1+uJOI6ddSvI7gcEDYEnMEgfrDNh16ZVMuOyaymvqci7l4uCPAscS5UQZYVXr+kWCFw/5XNpErT2Bl3mQKA/bqHLre4cAnCnWHLZdww7D4PE33sPpMDBVCYYjyRtHLVc49RirkDMu+DkTplx/Mb5VnVmFn8+q0ddZlMl5LDdGNCiGf19o8UHgVbw82ARtTQBOAejVvtdCfAxvHAHk4yOfmXjrXTO/8X7BlIxEQfUtQ4sItg9y5KGdMU0zTsWLIzDk2KSghmPAPOxe5n9+KFvxVY///xUqcTEaUBl9N0QQA/j6uq+vNk1zTuMkSYU78SWEQpQZ+PlwT74rNTVVO7RvzUWnHR93BliewMxcKN2G4XDwwLzpDOvQhz7du7Jm4xZ6z/n46xNUj64WljWeS1Bi3NOMbtx9AfHFoyYA0zQLDcNot2ciwM+l+LgZYSNeFC+X4G1qEWFxggm5r+PY6CAtxY0gvDx7Hk+53RdUQ76X36HsqIz8+Zn7iTkn5DeByPJiNhb5NesAPtbZixkLgbHkN5VHTatSLa/O+RhPiguny8VmkUiVGTKSGC7uSQ5qXDQK3K79hgsIfcnn/AZwjYer/P4C355NUqfdkA+pISJWWY6fI8hnIjALP5820htklYhRZYO7gKtWnMorfMp5pwwkGI4kfAVJbP8iYDJBKuLJ+eIWYCZEOmCtE/z6wccK8rmMpP0V6pjpU/BxUdLvl/FZNY/2nAD8NdfUxcsg8ilE6IFyCV5W4KvfDluVIFwOqZmwcyuSYmA4LKI9uEP76hWtLLb/AlBi+Ym/NICnQB8FvRKMf+5nFv3h9UD+DnxJSnp+EwWb7NYM9PEpftqhBBC6AB3twMbdTPgqhWAMB5QUgOEg3eXh6TffQ0Qo2F6FlsZzMcrLdrybsOVQB+gLIK+CXAuOt2BA4X6Ffj9nkV9rsgp4ObkS8r1kIPRtqtcb9fzIAPA8ynm28vJinaJNhEAwnCAGQwwrLkuVVzM/AXFgqtIxtyLML3RuaBjCYwl1IepciCttEX89+Wt6z/kdyELo+2UT59b9UnSBTnWoTq/ZiBe8DEK5CB9L9i4BWNxgJX7uxctHwH/JR/FyYhJbOiX+ZyQa5dQB1qbQhsNBSeFPliQIlFVgT8HjdlG0s8yOCMZEWWR/1TpWn5rJc08fyf0fLGHFsC/gmOftJw8mn6f2G+RbBH2pHcxRVel7Fz/xfX4PQTkFfxPkFO6RJ9DHEPy8gHAqMA8vx9lX1sRr0LicTuZ9ZW1yoKaJM8WDqsmM7C+4qei8Srs0/LClEIfDIGVGynsIp+HmFe5eOJVpvkugJAbGRXDsU/ZglaL0wZ8U+frrVwQVH0uRiiLUSVCSxAmm4cff1K937sGH/9f2JBaTz834eZ58lgNHqipOO9RLVUnNbGU5AtOzeOfdJXhS3PHVPwxDCF4TRLbLQGLi5a4VCrumoOEfIethkDH2bFhUbdOFX+aMdgC/QdmF8AJWfkFOPcLCT8FLb3yVts9bYre5EpLkfjwFLZ9DgG74G7913p7HA/hpRT7r8PIwPrLx8qg8IDbRWmG7ajggFkVRHA4rUbRjbmvmZixma7diPE95UId+ESyb1xVCr8Gx38PCiRC8CU6M4OXf+DjmVzKjY8B7NpK6JbHzOVh7FK/Cz4QanvwUrVjqTngKrXE9osq9t5DPQIQVifI0+4wALCLoRj4R8jkaMEzsDaPsAD1JyYRdxYm9/qKeGMHLggzddjzlgRCPx94lFnr8jyAvQb/vYeEEcE7Ce2w7YAE+OjdgBrpQ2iEU1icmrllZe+UxOrMScoUsfElRSz6ieHkT7L4KP9Rg++cA3yRi/5tEBHiTskkra58K5FCRVJFVp+3px0U+EZQRsQGxQ9Z/UnCa3RErGFSE7Fg6ZZlBUtJcXLJtCAK0ykq3zcZYAI5dAgvvwBF7lbuOPQblM6TyTty78ZTFgHeAMfALthYsS6ojXlYB1wMz8KGChBQFL2vw0ZX8JP+Ml09QzsHfdMiPc4D7azFNFDgQiODjbnuAb0bwxNGKcritqMzBzyybCFbHesZSnfMrPLYhwrgEWpmZzB+0mq7rc3FJ5eVrd9qNzwWdb9/K1cMGk7F9O7ABfz02dsznLWA7wiZ8jVsT30dE8CPQCS9DUd4ARuoOvfH292/X+96574JEZpFVfHKUbYI3eXSz7IadrrQR3BqlE0IaVkxeCJ+dj5/PowijgFyUE4AhrlmuAZGzI+fesXkkgrI6awcHl+XwwAFvcvyMXmwpLOZ3ZwyC9Na4gsXc88xbRA+68TPOes4gs+hKrMIQB9jf9yjCw/iS4vy8ZAPHAq/gox2/ZogrdF6+xcdhtnjItJXHTsBIfM2X0+DcjRw7ogbNcztwpR2eHEM5AR834KUz8APCBZEhkb84J7pY/4dtFLp2MiDSn+ScTDNeNNL2GEZvimA8mPeymVW0EFiDErMVIAOftRN3Jflp+c4v+NUjP1lX8HEYXhaggM8eLC/rsfYoajYCkEZSbW+U9ggG8B5KCTADP5fhZYkUSh5l5LXrlMXBgVx+Ez0JgqXMT/+G0vcCDO53OKkeD2ZaNs+lvc62B0rR0bHbtJ1+AzjxMy1pZjyFtd9uJjAK+BTffpPoUZNIU1tHUGAw/hr9A/vYD1DZVhW8HIdyDfkoyunaVt+lLRRHykihE0TDoCZhiWCq0io7g03fLufLo8ro9+khvNd9GeHW0ZsQXsbHX2wl9HK7ysZMhEvw8R/2d7C8gr9JKIp7xQvd9J24C2UGWLlrKeoiKjFu2zycmGny3oIVnH1aX/xZr3PnllGoKve2mUrqI6ndAuMCG7Ayf0pQyvGTQQs0KzRHUOgw/CyPk9ag8p5cuv0UAhKh+KfvibYx+XDV19y5ZRTRcIiH8mbieMZJcHRwNMpbKCUoHVqQ/2slAB+D8CKe+z0XuF9wU2IGOCCYzbK0DSw8ooRdrYJsWlWEAu+3W4G37CLMo00Q0hA+x4/gb+aKWi3QrBwAfKiIFOKEHms74ED4MHsF3QMHkvdjNtt3lmkwFObbnVujTy59d6drvnOjpmm0Vp9EC/zKCMAGx2ZHzAyHYmXbC2JXLTgilrOmNHZc58xYaSDMP16cPsN4zXHk+sHbMsO7wl1wM67Jc+pboJmsgPrBAlXNKy8uIJN0XA7LMxiOmfGNnQpLS8tIeO/2cb28FmiBFmiBFmiBFmiBFmiBFmiBFmiB/wH4f+jryq6sRdUDAAAAAElFTkSuQmCC" alt="DREME Logo"/> + <h1>DREME</h1> + <h2>Discriminative Regular Expression Motif Elicitation</h2> + </div> + <p class="spaced"> + For further information on how to interpret these results or to get a + copy of the MEME software please access + <a href="http://meme.nbcr.net/">http://meme.nbcr.net</a>. + </p> + <p> + If you use DREME in your research please cite the following paper:<br /> + <span class="citation"> + Timothy L. Bailey, "DREME: Motif discovery in transcription factor ChIP-seq data", <i>Bioinformatics</i>, <b>27</b>(12):1653-1659, 2011. + <a href="http://bioinformatics.oxfordjournals.org/content/27/12/1653">[full text]</a> + </span> + </p> + </div> + <!-- navigation --> + <div class="pad2"> + <a class="jump" href="#motifs_sec">Discovered Motifs</a> + | + <a class="jump" href="#inputs_sec">Inputs & Settings</a> + | + <a class="jump" href="#info_sec">Program information</a> + </div> + <!-- alert the user when their browser is not up to the task --> + <noscript><h1 style="color:red">Javascript is required to view these results!</h1></noscript> + <h1 id="html5_warning" style="color:red; display:none;">Your browser does not support canvas!</h1> + <script> + if (!window.HTMLCanvasElement) $("html5_warning").style.display = "block"; + </script> + <!-- description --> + <div id="description_section" style="display:none"> + <div id="description" class="header"> + <h2>Description</h2> + </div> + <div id="description_text" class="box"> + </div> + </div> + <script> + if (data.description) { + $("description_text").innerHTML = ""; + $("description_text").appendChild(make_description(data.description)); + $("description_section").style.display = "block"; + } + </script> + <!-- motifs --> + <div id="motifs_sec" class="header"> + <h2>Discovered Motifs</h2> + <span><a href="#inputs_sec">Next</a> <a href="#">Top</a></span> + </div> + <div id="motifs" class="box"> + <p>No motifs were discovered!</p> + </div> + <script>make_motifs();</script> + <!-- inputs and settings --> + <div id="inputs_sec" class="header"> + <h2>Inputs & Settings</h2> + <span><a href="#motifs_sec">Previous</a> <a href="#info_sec">Next</a> <a href="#">Top</a></span> + </div> + <div class="box"> + <h4>Sequences</h4> + <table id="seq_info" class="inputs"> + <tr><th>Source <div class="help" data-topic="pop_seq_source"></div></th> + <th>Alphabet <div class="help" data-topic="pop_seq_alph"></div></th> + <th>Sequence Count <div class="help" data-topic="pop_seq_count"></div></th> + </tr> + <tr> + <td id="ins_seq_source"></td> + <td id="ins_seq_alphabet"></td> + <td id="ins_seq_count"></td> + </tr> + </table> + <script> + { + var db = data.sequence_db; + $("ins_seq_source").innerHTML = db.file; + $("ins_seq_alphabet").innerHTML = dreme_alphabet.get_alphabet_name(); + $("ins_seq_count").innerHTML = db.count; + } + </script> + <h4>Control Sequences</h4> + <table id="seq_info" class="inputs"> + <tr><th>Source <div class="help" data-topic="pop_seq_source"></div></th> + <th>Sequence Count <div class="help" data-topic="pop_seq_count"></div></th> + </tr> + <tr> + <td id="ins_cseq_source"></td> + <td id="ins_cseq_count"></td> + </tr> + </table> + <script> + { + var db = data.control_db; + if (db.from == "shuffled") { + $("ins_cseq_source").innerHTML = "Shuffled Sequences"; + } else { + $("ins_cseq_source").innerHTML = db.file; + } + $("ins_cseq_count").innerHTML = db.count; + } + </script> + <h4>Background</h4> + <span id="alpha_bg"></span> + <script> + { + $("alpha_bg").appendChild(make_alpha_bg(dreme_alphabet, data.control_db.freqs)); + } + </script> + <h4>Other Settings</h4> + <table id="tbl_settings" class="inputs hide_advanced"> + <tr> + <th>Strand Handling</th> + <td id="opt_strand"> + <span class="strand_none">This alphabet only has one strand</span> + <span class="strand_given">Only the given strand is processed</span> + <span class="strand_both">Both the given and reverse complement strands are processed</span> + </td> + </tr> + <tr><th># REs to Generalize</th><td id="opt_ngen"></td></tr> + <tr><th>Shuffle Seed</th><td id="opt_seed"></td></tr> + <tr><th>E-value Threshold</th><td id="opt_stop_evalue"></td></tr> + <tr><th>Max Motif Count</th><td id="opt_stop_count"></td></tr> + <tr><th>Max Run Time</th><td id="opt_stop_time"></td></tr> + </table> + <script> + { + $("opt_strand").className = (dreme_alphabet.has_complement() ? (data.options.revcomp ? "both" : "given") : "none"); + $("opt_ngen").innerHTML = data.options.ngen; + $("opt_seed").innerHTML = data.options.seed; + $("opt_stop_evalue").innerHTML = data.options.stop.evalue; + $("opt_stop_count").innerHTML = (typeof data.options.stop.count == "number" ? data.options.stop.count : "No maximum motif count."); + $("opt_stop_time").innerHTML = (typeof data.options.stop.time == "number" ? data.options.stop.time + " seconds." : "No maximum running time."); + } + </script> + </div> + <!-- list information on this program --> + <div id="info_sec" class="bar" style="position:relative"> + <div style="position: absolute; right: 0;"><a href="#inputs_sec">Previous</a> <a href="#">Top</a></div> + <div class="subsection"> + <h5 id="version">DREME version</h5> + <span id="ins_version"></span> + (Release date: <span id="ins_release"></span>)<br> + </div> + <script> + $("ins_version").innerHTML = data["version"]; + $("ins_release").innerHTML = data["release"]; + </script> + <div class="subsection"> + <h5 id="reference">Reference</h5> + <span class="citation"> + Timothy L. Bailey, "DREME: Motif discovery in transcription factor ChIP-seq data", <i>Bioinformatics</i>, <b>27</b>(12):1653-1659, 2011. + <a href="http://bioinformatics.oxfordjournals.org/content/27/12/1653">[full text]</a> + </span> + </div> + <div class="subsection"> + <h5 id="command">Command line</h5> + <textarea id="cmd" rows="3" style="width:100%;" readonly="readonly"> + </textarea> + <script>$("cmd").value = data["cmd"].join(" ");</script> + </div> + </div> + + </body> +</html>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/dreme2.txt Wed Apr 25 12:12:22 2018 -0400 @@ -0,0 +1,68 @@ +# DREME 4.12.0 +# command: dreme -oc dreme_out_adv -rna -norc -p dreme_test_sites.fa -e 0.00001 -mink 4 -maxk 10 +# positives: 1000 from dreme_test_sites.fa (Thu Apr 19 19:09:45 CEST 2018) +# negatives: 1000 from shuffled positives +# host: ThinkPad-T450s +# when: Tue Apr 24 18:44:36 CEST 2018 + +MEME version 4.12.0 + +ALPHABET "RNA" RNA-LIKE +A "Adenine" CC0000 +C "Cytosine" 0000CC +G "Guanine" FFB300 +U "Uracil" 008000 +N "Any base" = ACGU +X = ACGU +. = ACGU +V "Not U" = ACG +H "Not G" = ACU +D "Not C" = AGU +B "Not A" = CGU +M "Amino" = AC +R "Purine" = AG +W "Weak" = AU +S "Strong" = CG +Y "Pyrimidine" = CU +K "Keto" = GU +T = U +END ALPHABET + +Background letter frequencies (from dataset): +A 0.221 C 0.245 G 0.221 U 0.312 + + +MOTIF UUYUCY DREME-1 + +# Word Pos Neg P-value E-value +# BEST UUYUCY 387 210 2.6e-018 3.3e-013 +# UUUUCC 147 75 1.8e-007 2.2e-002 +# UUUUCU 155 94 2.2e-005 2.8e+000 +# UUCUCU 94 51 1.3e-004 1.7e+001 +# UUCUCC 75 42 1.1e-003 1.4e+002 + +letter-probability matrix: alength= 4 w= 6 nsites= 459 E= 3.3e-013 +0.000000 0.000000 0.000000 1.000000 +0.000000 0.000000 0.000000 1.000000 +0.000000 0.294118 0.000000 0.705882 +0.000000 0.000000 0.000000 1.000000 +0.000000 1.000000 0.000000 0.000000 +0.000000 0.474946 0.000000 0.525054 + + +MOTIF YAGG DREME-2 + +# Word Pos Neg P-value E-value +# BEST YAGG 600 416 1.1e-016 1.4e-011 +# CAGG 441 304 1.5e-010 1.8e-005 +# UAGG 232 165 1.1e-004 1.3e+001 + +letter-probability matrix: alength= 4 w= 4 nsites= 793 E= 1.4e-011 +0.000000 0.692308 0.000000 0.307692 +1.000000 0.000000 0.000000 0.000000 +0.000000 0.000000 1.000000 0.000000 +0.000000 0.000000 1.000000 0.000000 + + +# Stopping reason: E-value threshold exceeded +# Running time: 18.17 seconds
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/dreme_test_sites.fa Wed Apr 25 12:12:22 2018 -0400 @@ -0,0 +1,2000 @@ +>U2AF2_K562_rep02_1 +UCUACACAUAGGGUGUUCCUGAAAAGCCCCAUAGUGAUUGAGUCUUCAAAACCACCGAUUC +>U2AF2_K562_rep02_2 +UUGGAUAGCGGAAGCCCUGACCAGGCAUGGAGUAUCUCACAAAGUAGACGAUUCCUCUGGG +>U2AF2_K562_rep02_3 +GGUUUCGGUCUAAGUACCACCCAGAUGAGGUGGGGAAGCGUCGGCAGGAGGCCCGGGGGGC +>U2AF2_K562_rep02_4 +AAACAGGGUUUGUGGAUGCACUUAGAUGUUUGCAAUGAGCACUGUGGCUGGCAUGCCCCAG +>U2AF2_K562_rep02_5 +UCCCAUUGUUUCUGCAGAGGCAGUUGGUGUCACCAGCCAGCGACCAGUGUUUUGUCCUUUU +>U2AF2_K562_rep02_6 +UUCUACCCUCUCUAACUCCUCCCAGCAGCAAAAGGGAGACACUUCAGCUGGAACAAAAUAG +>U2AF2_K562_rep02_7 +UUCUACCCUCUCUAACUCCUCCCAGCAGCAAAAGGGAGACACUUCAGCUGGAACAAAAUAG +>U2AF2_K562_rep02_8 +UUUUCUCCCUUCCACCCACACCCUGCAGCGUCGAGGUCCUCAGCGAUCAGUUGAUGUAAUA +>U2AF2_K562_rep02_9 +GGCAGGGGAAGUGGGGAUGGCAGGACAUGGAUGGCCCUUGAGGCAUUGGCUCUGGGUGUCA +>U2AF2_K562_rep02_10 +GCAGGGGAAGUGGGGAUGGCAGGACAUGGAUGGCCCUUGAGGCAUUGGCUCUGGGUGUCAU +>U2AF2_K562_rep02_11 +UUAGUCUUUCCAUCUACAGCCCACUGGCACUCCAGGCACCUACCUACUUCAAACAAGCUCA +>U2AF2_K562_rep02_12 +UUUCUCUUUUCCUUCCACAGGGGACCGUGAUUAGGGUAUUUUCCAUUCCAGAAGGACAAAA +>U2AF2_K562_rep02_13 +AUAACUGUUUUGUCUUUCCCUCCCCCGCUUCGUUCCCAGGUUUCGGUCUAAGUACCACCCA +>U2AF2_K562_rep02_14 +UUUCAGAGAACGUUUGUCUGCCUGAUGAGAGCCACUUGGGUUAAGAAACUACCUGUGAAUA +>U2AF2_K562_rep02_15 +AUGCUUUGCAAUUGCAGCUCCUUUAUGUCUCCAAAUGAUACAAGAAGACCCGAGAAAGUGG +>U2AF2_K562_rep02_16 +UUUGCAAUUUUGCCUAGGGCCCUGGUGGUGGCAACCGCCUGUGUGCCACUGAAAAUCGUGC +>U2AF2_K562_rep02_17 +UUGCAAUUUUGCCUAGGGCCCUGGUGGUGGCAACCGCCUGUGUGCCACUGAAAAUCGUGCC +>U2AF2_K562_rep02_18 +CUAAUUUUUAAAAAGCAGCCUCUGGAGCCAGCCAUGUUUGGCACUGAAUCUUCAUGUAAGU +>U2AF2_K562_rep02_19 +UCUAAUUUUUAAAAAGCAGCCUCUGGAGCCAGCCAUGUUUGGCACUGAAUCUUCAUGUAAG +>U2AF2_K562_rep02_20 +UUUCUGUCUUCUCCUCUCUUCCUUUACACAAACUUAAACAGAAUGGAAAUGAAAACCAAGG +>U2AF2_K562_rep02_21 +AAACAGUUUCAGCUCCUGGCAUCAGCUCUAUUCAAAUCUGGUUCAGAUUUUACAGCUCUGG +>U2AF2_K562_rep02_22 +UUCUCUCUCUUCCCCUGGCUCCCUCAAGGUGAACAGCCAUAUACCAGGAAUAGGAUACCAG +>U2AF2_K562_rep02_23 +UAUAUCCUUAGUGCAGGCUGUGGAAGAACAGGUGCCAUUUGUGCCAUAGAUUAUACGUGGA +>U2AF2_K562_rep02_24 +UCCCUAAUUCUUCACCUCCCCCUCCUCUGCUGCCUCCUUGCUCUCCUCGCAGGUCAAGUUU +>U2AF2_K562_rep02_25 +AUUGUUACUCCCAGGUGCCUUCGAAACAUCUGCAAGUUUUUAGUCUUGCUCAUCCCACUCU +>U2AF2_K562_rep02_26 +CACAUUUUUUAAAAGGGCAAGUACAGGAGCAACUGCUGCUACCCAGAAAAAUGUGUGUAUU +>U2AF2_K562_rep02_27 +CACAUUUUUUAAAAGGGCAAGUACAGGAGCAACUGCUGCUACCCAGAAAAAUGUGUGUAUU +>U2AF2_K562_rep02_28 +AUUCCGUAGGUUCUAAUCUGUUCUCCCUCCUCCUCAACGUAAGUACACAGUGGAUACCCUC +>U2AF2_K562_rep02_29 +UAUUCCGUAGGUUCUAAUCUGUUCUCCCUCCUCCUCAACGUAAGUACACAGUGGAUACCCU +>U2AF2_K562_rep02_30 +ACUAAAGUUUUUUUUCCUAGUGGUUAUCAUGAGACUUAUAUAAAACAUGUUGUAUCUUAAC +>U2AF2_K562_rep02_31 +CCUCCUCUUUCUCCCUCCCUCCUUCAUUCCCUCCAUCCCUCUCUUAACAGCUUGAAGAUAA +>U2AF2_K562_rep02_32 +CCUCCUCUUUCUCCCUCCCUCCUUCAUUCCCUCCAUCCCUCUCUUAACAGCUUGAAGAUAA +>U2AF2_K562_rep02_35 +AUUUAUCCUCUUGCUUUUGCAUCUCAAAAUUUUAUCGCCUUGAAGACACGUUUCUAUGAAU +>U2AF2_K562_rep02_36 +GUCAGAAGGUAGCAGGGGCUGGGGGUUGCAGGGGGAUGUUGAGAAGAAGUGGUCCUUUGGU +>U2AF2_K562_rep02_37 +AGUCAGAAGGUAGCAGGGGCUGGGGGUUGCAGGGGGAUGUUGAGAAGAAGUGGUCCUUUGG +>U2AF2_K562_rep02_38 +UUGCUUCUCCUUUCUUCCUUCCUUCCUGCCCAGGGCCUCAUCUUUGUGGUGGACAGUAAUG +>U2AF2_K562_rep02_39 +UAGAGACUGUUUAUUUGUUUGGUGGCUGGGAUGGAACACAAGAUCUUGCUGACUUCUGGGC +>U2AF2_K562_rep02_40 +CUUAGGUAUGCCGAGCAGACAGCUGGAGGAUCCCGGGGCAGGGACACCUAGCCCGGUGCGU +>U2AF2_K562_rep02_41 +AUUCUCCUGGGUUUUUGGCAGAUGGUUGCAGUGGCAGGACCAAGGCCUAGUGAGCUAUAGC +>U2AF2_K562_rep02_42 +GCAGAUGGUUGCAGUGGCAGGACCAAGGCCUAGUGAGCUAUAGCUAAAUCUACAGUGGGAU +>U2AF2_K562_rep02_43 +CCCCGUGCCUUGCCUCCCCAGGCGUGUGACCCCCUGCCGCACGAGGAGGAGCCCUCUGAAG +>U2AF2_K562_rep02_44 +UUUACCCCACUACUAGGUAAGGGGCCUGGAUACCAAGAAGUGACUGCUCAUCUAAUCCAUA +>U2AF2_K562_rep02_45 +GAUGGUCAUUGUCCUCCAGAGCAGUGAUGGAGGAAAUACCAGCCCAGGAAGCAGCAGGGUC +>U2AF2_K562_rep02_46 +AUGGUCAUUGUCCUCCAGAGCAGUGAUGGAGGAAAUACCAGCCCAGGAAGCAGCAGGGUCA +>U2AF2_K562_rep02_47 +UAGGCCUGUGAGGCUGCCACACCCUGUGCCCCCGUGCCUUGCCUCCCCAGGCGUGUGACCC +>U2AF2_K562_rep02_48 +CAGGUCUCUCCUUACGGGGCCAGGGCAAUUUCUUUUCGUUCUUGCCCGUGUUGAACUGGGC +>U2AF2_K562_rep02_49 +UACUUCUCUUUCCCUGUCCCCAAAGCAGAUCGCCAAACUGAGGCAGCAACUACAACGCAGU +>U2AF2_K562_rep02_50 +GGCGUGUGACCCCCUGCCGCACGAGGAGGAGCCCUCUGAAGUGCCACAGCUGCGCCAGCCC +>U2AF2_K562_rep02_51 +GUGGGCAGUGGGCGAGCCAGGCUGGGGGUUGUGGGGGAGGCCUGGGUUGCAGGUUUAAGCG +>U2AF2_K562_rep02_52 +AAGUUCCACUCUUGUCCUGGGGACCCAGCUUUAACUUUAGCAUCUGGUAUGUUGAACUUAG +>U2AF2_K562_rep02_53 +UCACUCCUUCUCUUUCCUAAGACUGACUUUAUGGCCUUUCACCAAGAACAUGAAGUGCGUA +>U2AF2_K562_rep02_54 +GAGCGCAGCAAGACAGAUUAGGGGAAGGGGAGAGGAGAGACUUGGCUAGCAAAGGUCUUGU +>U2AF2_K562_rep02_55 +GGAGCGCAGCAAGACAGAUUAGGGGAAGGGGAGAGGAGAGACUUGGCUAGCAAAGGUCUUG +>U2AF2_K562_rep02_56 +CUUUCUCUUUCUCUCUUUCUCUCUCUUUCUGUCUGUCUGUCUGUCUUUCUGUCUUUCUUUC +>U2AF2_K562_rep02_57 +UGUUCUGCUUUCCUCCUUAGGCCAGGUGCUGUGUGUGCUGCCGUCUGUCUGUAUUUUCUUC +>U2AF2_K562_rep02_58 +GUGACCAGUUCUUUUGCAGGAAAUUGUUUCUGAGAAGACUGGAAGACAAGAAAUAUCCCAC +>U2AF2_K562_rep02_59 +UCUAUAUUACAGGAGAUACAACUCGUCAACGAAUCAAAUUCAGUGAUGACAGAGUAUGCAA +>U2AF2_K562_rep02_60 +UCUAUAUUACAGGAGAUACAACUCGUCAACGAAUCAAAUUCAGUGAUGACAGAGUAUGCAA +>U2AF2_K562_rep02_62 +GUAACAGAGUAAGCAGGAAAUUCACAGGAGGUCUGCUCGGCUCAGAAACACUAAAUACAAA +>U2AF2_K562_rep02_63 +GUCCUUUUCUCUGAGGAUGUGCUGCCUAGUGUCGUGGAAUCUGCCUGACCAUUGCAAGCAU +>U2AF2_K562_rep02_64 +UUCCCCAUUCCAGAUCCUGGGUGUUUGGCUGACCUACAGAUACAGGAACCAGAAAGACCCC +>U2AF2_K562_rep02_65 +AUUAACAUAAUGAACCAUAUUCAUUUCUUGGUCAGUUGUGAGCCAUUCUUUUAUUCCACUU +>U2AF2_K562_rep02_66 +AUUAACAUAAUGAACCAUAUUCAUUUCUUGGUCAGUUGUGAGCCAUUCUUUUAUUCCACUU +>U2AF2_K562_rep02_67 +CUUUUUCUUUCCUGUAUCCUUUUUAGGUUUCUAGCCAUCCAUGAGAAGGAAGUUAAUGAAA +>U2AF2_K562_rep02_68 +UUCUUUACAGGGAACACUGAAAGGUUUUGACCAGACCAUUAAUUUGAUUUUGGAUGAAAGC +>U2AF2_K562_rep02_69 +CCUCUUUUACCUAAUAGGUGGCCAGCAUCGAAAUGUUCAGCCUUUUAGUGAUGAAGAUGCA +>U2AF2_K562_rep02_70 +UUGCUUUUCACAGGCGUGGGAUCCAGGAUGGUGUCCUCUGUGAGGACUUGAACUCUGGGGC +>U2AF2_K562_rep02_71 +UUAUUCUCUCUUUCUGCAGAUGGGCUUUCUCCACAUGAUGGAGAAGAUGGCUGCCAGGUAC +>U2AF2_K562_rep02_73 +CAUUCCAUCAUCAAAGGUAUUGAUAACAGAACAUGGCGACUUGGGAAAUGGAAAGUUUUUG +>U2AF2_K562_rep02_74 +UCUCUAAAUUUUUCCCCCUACUUUCUUGCUUCUGUUUCACAUUUUUUAAAAGGGCAAGUAC +>U2AF2_K562_rep02_75 +UCUCUAAAUUUUUCCCCCUACUUUCUUGCUUCUGUUUCACAUUUUUUAAAAGGGCAAGUAC +>U2AF2_K562_rep02_76 +UUUUCAGAUUACUGAGAGUCUUCAGUUACUAGGUAAGUCGCCCCAUCCUUAUUACUCCAGG +>U2AF2_K562_rep02_77 +UUUCAGAUUACUGAGAGUCUUCAGUUACUAGGUAAGUCGCCCCAUCCUUAUUACUCCAGGU +>U2AF2_K562_rep02_80 +GCACGUGCUUUGCCCUGGGUACAGCCAGAGCCCUUCAACCCCACCUUGGACUUGAGGACCU +>U2AF2_K562_rep02_81 +AGAGGACGAAAACGAAGCUUCGUUCCUGAGGAAGAAAAACAUGAGGUUGGAAUAAGUUAAG +>U2AF2_K562_rep02_82 +UUUUUUUCCAGAGAACCAGAGGACGAAAACGAAGCUUCGUUCCUGAGGAAGAAAAACAUGA +>U2AF2_K562_rep02_86 +GGUCUAUGGUACCGUUGCUUCAGGUGAUAUCCAGGGGUUCUCCUAUGUCUUUUGAAGAUUC +>U2AF2_K562_rep02_87 +UUCUUCUCCCCUUUUUGCCCAGUUAAUCCAUAUUCAUCUGCAGAUAUGUUACCCAUGUUAC +>U2AF2_K562_rep02_88 +UUUUUGUUUUUUCCACAGAUUCCUAGAUAGGGUUGUUCAUCUGUCAUCUUAAAAGGGUUUU +>U2AF2_K562_rep02_89 +UUCUCUCUCUCUCUACAGAAUGGUCCUAGUGCCAGAUCGUGUCAUAAAAUGUGCAUUGAUA +>U2AF2_K562_rep02_90 +UUUUUGUUUUUUUUUUUGUUUUUUUCCAGAGAACCAGAGGACGAAAACGAAGCUUCGUUCC +>U2AF2_K562_rep02_92 +UUUUUUUUCUUCUGUCCUUUUGUGUGUGUCCUUCCCUCUCAUCGUUGGCCACUCAUAGAUA +>U2AF2_K562_rep02_93 +UCUUGUGUAGGUUUUUCCGUCGUGGCUGGGUGACCUUCGACCGCAGUGUUAACAUUAAAGA +>U2AF2_K562_rep02_94 +CAGUUUCUACAGACUGCCAUUGCUAUGCACGGCUGAGAUGGACAGAGUUUGCUUGUGAAUC +>U2AF2_K562_rep02_95 +AAUUUAUUUCAAAGGAUGCGAAGUACAAAACUGCUUCGGCUCAUUGACUUAGAUUUUUCAU +>U2AF2_K562_rep02_100 +UUUUCAUUUCCUUCAGAGGGCAGAGGUGGCUCAGAGAGAGGCGGAGACCUUAAGGGAACAG +>U2AF2_K562_rep02_103 +CUACAGUGUUCUCAUUCCUCAGAGCAGCCAGGAUGUGUUAUUUCAGGAGUUUGUGACAUUC +>U2AF2_K562_rep02_104 +CUACAGUGUUCUCAUUCCUCAGAGCAGCCAGGAUGUGUUAUUUCAGGAGUUUGUGACAUUC +>U2AF2_K562_rep02_105 +UAGCGAUAGGGUCUCACCAUGUUGCCCAGGCUGGUCUUGAACUCCUGGACUCAUCCUAAAG +>U2AF2_K562_rep02_106 +AGCGAUAGGGUCUCACCAUGUUGCCCAGGCUGGUCUUGAACUCCUGGACUCAUCCUAAAGU +>U2AF2_K562_rep02_109 +CUUGUUUCUUCCUAAGUAUAAGGUCUCUGAGAAGGUCUGUAGAGUGUGGCUUAGAUUCCAG +>U2AF2_K562_rep02_110 +UUGUUUCUUCCUAAGUAUAAGGUCUCUGAGAAGGUCUGUAGAGUGUGGCUUAGAUUCCAGG +>U2AF2_K562_rep02_111 +AAGUGGUCCUUUGGUCAGGGUGGGAAGCCAACAGGAUUUCCUGGUGCAUUGGAGGUGAAAG +>U2AF2_K562_rep02_112 +GAAGUGGUCCUUUGGUCAGGGUGGGAAGCCAACAGGAUUUCCUGGUGCAUUGGAGGUGAAA +>U2AF2_K562_rep02_116 +GACAGCCAGGUACCAGGUGAGCUGAGGAACCCUCUGCUUUUCCUCAGGGACUAUUGCUACU +>U2AF2_K562_rep02_117 +ACAGCCAGGUACCAGGUGAGCUGAGGAACCCUCUGCUUUUCCUCAGGGACUAUUGCUACUG +>U2AF2_K562_rep02_118 +UCAUUCCCUGCUCUAUCCCCAGGCCCAGGGCACUGCCUGAUGCAUGGUAGCACUUAUAAAU +>U2AF2_K562_rep02_119 +CUUUUUAGCUCCUUGUUUAGUCAUUCACUAAUUUCCAUACAUGAUAACGAAUUCUUCGGUG +>U2AF2_K562_rep02_121 +UUUUCUCUAUUCCAGUGGCCCUUUCUCUGCAGCUGGGCCCCACACCUACAUCCAUCCGUUU +>U2AF2_K562_rep02_122 +GCUAUGACUUCACACCUAUGGAUUCUUCUGCAGUUUAUGUGUUAAGUAGUAUGGCUCGCCA +>U2AF2_K562_rep02_123 +UUUUUGUUUUGGUGGCAGGGGAUAGGGUCUCCCUCUGUCUCCCAGGCUGGAGUGCAAUGGU +>U2AF2_K562_rep02_126 +AGGGGCAGGACAGAGCCCUUUCCUAGGGAAGCCCGGCACCCCCUGCUGUCCAGGGAAGGGG +>U2AF2_K562_rep02_127 +GAAGACCGAGGCGGUUUCAGGGGAUUGUCCCCUCCAGGGUCUGCUACACUGUCUGAAGGAG +>U2AF2_K562_rep02_128 +GGAUACCCUCUCUAUGAUCUUCAUUCUCUGGCCAUGGUGCUACAGUGUUCUCAUUCCUCAG +>U2AF2_K562_rep02_129 +GGAUACCCUCUCUAUGAUCUUCAUUCUCUGGCCAUGGUGCUACAGUGUUCUCAUUCCUCAG +>U2AF2_K562_rep02_130 +AGUGGGAGUGCGGAGGGGCUCCCGAGGGGGCUCCUGGGCCUGGUUUGAGAGAGGCCAAGAA +>U2AF2_K562_rep02_131 +AGUGGGAGUGCGGAGGGGCUCCCGAGGGGGCUCCUGGGCCUGGUUUGAGAGAGGCCAAGAA +>U2AF2_K562_rep02_132 +UUGUGUUAUUGCUUCCAGGUCAGGGGUCACCACAUUGCAAAACUUGAUCCUCUCGGAAUUA +>U2AF2_K562_rep02_133 +GUUUUCUGGUAUUUUCUAGCAUCCUUCUCACCACAGCCAUAACCCUUUUUUACUUCCAUUA +>U2AF2_K562_rep02_134 +UCUCUUUUUGCUCACCUGGGGAGUUCCUUCCCCUUUCCAUAAACUGUGGUCCCUGCAUGGC +>U2AF2_K562_rep02_138 +CACCAAUCACACUUUCGCAGUGGAGAAAGUGCUGUGACUUUCCUCGCCAGGCGCCUCCCUC +>U2AF2_K562_rep02_139 +GUUUAUCAGCCAUAGGUUGGAGGCAACAGCUGGAAAUGGCUCUUCCCCUUCAAGGUUGUAG +>U2AF2_K562_rep02_140 +UCCACUUGCAUUCAUUCUCCACUGGCCCUCCGUAUCCACAGAUUCCCGCAACCAACUGUAU +>U2AF2_K562_rep02_147 +UGUCAUUUUUUCCUUUUCCAGGCAUCCUUGUUCAUCUAGCAAUAUCUGAACUGCAGUGCAU +>U2AF2_K562_rep02_149 +CUGUUAUAGUGUGACUGUUGCUUUUUUGUCUCCUUUUCUUUUAAACAGGGUUUGUGGAUGC +>U2AF2_K562_rep02_150 +UUUUUUCUAGAGAUGGUUUCUACCCCGACUGUUUCCCAGGCUGGUCUGAACUCCUGGUCUC +>U2AF2_K562_rep02_151 +UUUUUCUAGAGAUGGUUUCUACCCCGACUGUUUCCCAGGCUGGUCUGAACUCCUGGUCUCA +>U2AF2_K562_rep02_158 +UUGAUUUUGGUUCAUCUCUUUUUAGGUCUGAUGCCUGGAGGGAGGGUCAAGCUGGUACAUA +>U2AF2_K562_rep02_159 +UUCUUUUUGUCUACCCAUCUCCCUUCAGUCUUAAUAAAAGGUCUUAAACAGUUACAUGAGA +>U2AF2_K562_rep02_165 +ACCAUUUUUUUCAGGUGAUUGAAGCAGAGCAUAUAUGAUCUCCACAUAUCAAGACUAACGG +>U2AF2_K562_rep02_166 +CAAUUUCUGUGACUGUCAACCCUCUUGUGUCCUCCUAACCUCCUUCCUCAGCUUGCAUGGA +>U2AF2_K562_rep02_169 +CCAUCACCUCUCAACCUUUGCUUCGACAGGUCUUCACUCACGAUUUAUUCCUCCAGGUCUU +>U2AF2_K562_rep02_170 +AGGCUGGGAGGCAGGGCUGAGAGGUGGCCGAGAGAGAGGAGUCGCAGAGCCGCCAGAGUGA +>U2AF2_K562_rep02_171 +ACCUUUUUUUCUUCCCAGCCUCAGGUAUGAAUCAGCAGCAUGAAAAUGGAUUUGAAUACAG +>U2AF2_K562_rep02_179 +CAUGUUCCAGCCUUGCCUUUAGGAAGGGAGGACGUUCCGACCAGCCCGUUGUUCAGGGUGG +>U2AF2_K562_rep02_180 +UGCUCAUCCCACUCUUCCUUUUACUAGGUAAGUCAAAUCUGGCUGAGUUGCCUCCGAUGGC +>U2AF2_K562_rep02_181 +CUGUUGGCCAGUUUGCUGGGGGAAGCGGGCCAGGAACCAGCCCUGGCAGAAGUGUUCCACC +>U2AF2_K562_rep02_182 +CUGUUGGCCAGUUUGCUGGGGGAAGCGGGCCAGGAACCAGCCCUGGCAGAAGUGUUCCACC +>U2AF2_K562_rep02_183 +CUUUUUCUUUUAUAUGGGGGGCCGCAAAGGCGUCGACAUUCCAGAUGGCUAUCCUGCUUCA +>U2AF2_K562_rep02_184 +UCCCUCUUUCCCGACAGCAGCUGCGGCAAGAGAGCCCUGCCCUCUCCGAGGCCUGCUCAGC +>U2AF2_K562_rep02_185 +CUUCCUGUUUCUCUCCCAUAGGAGAGGGCUGAACCCCCCUCAUCGUGUCAAGUCAAUCUCC +>U2AF2_K562_rep02_186 +GACUAUUGCUACUGAUGGAGUGUGGCCUCUCUCUCAUCCCAUCUGUAGACCUUGCCUGGAA +>U2AF2_K562_rep02_187 +GACUAUUGCUACUGAUGGAGUGUGGCCUCUCUCUCAUCCCAUCUGUAGACCUUGCCUGGAA +>U2AF2_K562_rep02_190 +CUUUUUCCCCCAUCCAACAGGCUGUGUGGUUCCGGUGCUGGUGCCGUGGAAGUGGCAAUGG +>U2AF2_K562_rep02_191 +AUCUUCUUCACCAGGCUUUUCUGAUGUGGAUCACACCUAUGCUCAAAGAACUCAGCUCUUU +>U2AF2_K562_rep02_193 +GUUCACUUGGUUUCUAGGUCUAUUCUGGAUAAGCAGGUUUUGUGAAGACAUUUAUUCUUUC +>U2AF2_K562_rep02_194 +GAUAAUAUUAUAUUUCUGAGUGACCAGACGAAAGAGAAGGAGUAGAAAGGAUGAUUCUUCU +>U2AF2_K562_rep02_196 +AUUAUUUCAUUAUCGUUUCUCUGCAACCUUUCUUCAAUGGUACUAAGCAAGACACAUCUGG +>U2AF2_K562_rep02_197 +AAGGCAUGACCUUCCUUUCUCCUUGGCAUAGGCCUUACAACACUGAGGAAAGGCCAUGGUU +>U2AF2_K562_rep02_198 +ACUUCACCAUUCCUUUCAGAAAAAAGGAGAAGAAAAGAACCUACUGAAAACAUUUCUGGUU +>U2AF2_K562_rep02_199 +UUCUCCAGCUGGUUCUUUUCAUUUUACUGCAGAGAUAUUGCCGGAUCAUGACAUAAAAGAU +>U2AF2_K562_rep02_200 +UUUUUUUUUUUUUCCCCUCGUAGGCUAUUAUUCGUGAAUUGGGUGGUAUUCCAAUUGUUGC +>U2AF2_K562_rep02_202 +CCCCCUACAGGCUUUUGUCUUAUUAAGUGAUCUACUUCUCAUCUUUAGCCCUCAGAUGAUU +>U2AF2_K562_rep02_203 +CUUUCCUUCCUUCUUUCCUCUUUUUUUCUUUCCUCCCUCCCUCCCUUUCUUUCUUCCUUCC +>U2AF2_K562_rep02_204 +CUUCUUCCUAGCUGAUAUUCAGCAAUGAGUAUACCCAGGCAGAAAACCAGAAUUGGCACCU +>U2AF2_K562_rep02_205 +CCUUCUUGUCUUCCACAGGUCUAUAGUGAGCGAGAGCUGCUACUUUUUACUUGGGCAUUCA +>U2AF2_K562_rep02_206 +UCUUUCAGCUCUGUGUUCUCGUUUUGCCCAAGACCUUUGGCUAGAGCAGAACAUAAAAGAU +>U2AF2_K562_rep02_207 +UCUCUUGUAACUCCUCAGGCAUUUCUCACAAGAGUGGCAAAGAUACAGCAGGGUGCAUUAG +>U2AF2_K562_rep02_208 +UUCUUUCAUGACCUUUUUUCUUAUUUAGAGAUCCUCCAUAGAUAAUGAAAACCUGGUUUCA +>U2AF2_K562_rep02_210 +UGUGCACACCUCACGGCAAGGGCCAGCCUGUUUCCUCCCGGUCACCUCCAAAUCUUGCUGC +>U2AF2_K562_rep02_211 +UGUGCACACCUCACGGCAAGGGCCAGCCUGUUUCCUCCCGGUCACCUCCAAAUCUUGCUGC +>U2AF2_K562_rep02_212 +UUUUUUUAAGCGUUUGGCAACAUAUUGACUGCAUGGGGAUUGAUAGGCAGCAUAUUCCUGA +>U2AF2_K562_rep02_213 +UUCCUAGGACUAGUAGAUGCUGCAGUCGAUGCAGCACCAGGAGCAGGUGUGUGUAUACCAU +>U2AF2_K562_rep02_214 +UUAUGUAUUGUUUCCCUCUUUGUUUAGCUUGAACAUGCGAAAGUGACACAGACAGAGUUGA +>U2AF2_K562_rep02_220 +UUUAUUUAUUUUCAGAGGGCGCCUCACUCUGUUGCCCAGGCUGGAGUGCAGUGGUGCAAUC +>U2AF2_K562_rep02_221 +AACCUUUGCUUCCACAGACUUUUUCAUCCCUAAGAUACUAGAAGAAGAGCAUACAUAAACG +>U2AF2_K562_rep02_222 +CUUCUUUUCUAGCUACUCUCGGAACCGCACGUUUGACACGUACAUUGGGCAGGGCUACGUG +>U2AF2_K562_rep02_223 +CUUGGGCUUCUUCUUCACAGGGUCUCAUAAGCCAUGGCACAAGACAAGAUUUGAGAGUGGC +>U2AF2_K562_rep02_231 +CUGCUACUCUUAAUCUUCUCUAAAUUUUUCCCCCUACUUUCUUGCUUCUGUUUCACAUUUU +>U2AF2_K562_rep02_232 +GCUGCUACUCUUAAUCUUCUCUAAAUUUUUCCCCCUACUUUCUUGCUUCUGUUUCACAUUU +>U2AF2_K562_rep02_233 +UAUUAUUUCUUAGGACCAGAAGUCCUUGAUGAGGAAGGAACUCAAGAAGACCUAGAGUACA +>U2AF2_K562_rep02_234 +UCCUGCUGACACCCCUUGGGCUGGAGAGGCCUCCUCUGAAAGGGAGCCCUGGGAAAGGGCU +>U2AF2_K562_rep02_235 +GUCCUGCUGACACCCCUUGGGCUGGAGAGGCCUCCUCUGAAAGGGAGCCCUGGGAAAGGGC +>U2AF2_K562_rep02_240 +UUUACUUCCAUUAGGCCGUAUAACUGGAGAGACCUGCUGCUCGUUAUAUAAUUAUCUGAUA +>U2AF2_K562_rep02_241 +UCCUCCCAAGCAGAAAAUAUCCUAGGGGCAAGCCUGUGUAUGAUGUGCCUGUUUCUGUUAU +>U2AF2_K562_rep02_246 +AACUUUUUUGUUUCUUCCUUCUCUAUCCCUUUACUUUAGCUUUUAAGUGAAUUUUGAUUUU +>U2AF2_K562_rep02_247 +UGCUUUAUUUUGGUAGUUGGCGCAGAUCAAGACUCCAUCUGAAAAAAACAAGUGUAUAUAU +>U2AF2_K562_rep02_251 +CUUUUCCCCCAUCCAACAGGCUGUGUGGUUCCAGGUGCUGGUGCCGUGGAAGUGGCAAUGG +>U2AF2_K562_rep02_256 +UAAGUUUCCCUGCCGCAGAGUGAAGCAGAUACGUGUGUGUUGGGGCAUUCGGGGCAUGGAG +>U2AF2_K562_rep02_257 +GAAUUUGGCUUUUUUGCAGGUCCCUAGCUGUUGGUAGUAAGUCCGGUUAUAAAUUUUUCUC +>U2AF2_K562_rep02_258 +CUUUUUCGUUCCAGAGCGCCGCCCUGUGCUGGGCUGCCGGGAGCUCGUCUUCAGGAACCUC +>U2AF2_K562_rep02_269 +AACCCUACAGCCUACCCGUUCCAUCCCGGGCUAUCCCAGUUCCCCACUGCCAGGGAACCCC +>U2AF2_K562_rep02_270 +CUUCCAGAUGAGAUAUCACAGAGGCUUGGGCCUAGAUUGUCAUCAGCAUACUGCUAUACUA +>U2AF2_K562_rep02_271 +UUCACUCCUUGUCACAGUGAGCACAGUAGUGCCACAGGGUCCUGGCGAGGACCUAUGAAGC +>U2AF2_K562_rep02_272 +CUAUUAUUUUACCUAUCCCUUUGUUCCUUUCCUAUUCUCUGUACUUGUAGUCUGACGUGUG +>U2AF2_K562_rep02_282 +UUGUCCCCUUCUCCACCACGUAGGAUCUGAAGAAGCUGAAGAAAAACAGGACAGUGAGAAA +>U2AF2_K562_rep02_285 +CCGUUUAUCUGUAGGAUAUUGGGAGUGUGUGGCAUGCAUCCUCAUCAUCAGGAAACUCUAA +>U2AF2_K562_rep02_286 +ACCCUUUGUCCCCACUUGCUGCCGGGAUGAGAGGUAAGCACGGACCCGCCCACCCUCUGAC +>U2AF2_K562_rep02_293 +GUUUCUCUUCCCUUCCCCCCUUCCCCUGCGGUUGUAGAGCCCGUUCUGUCCGGUCGUGGUU +>U2AF2_K562_rep02_294 +CCUGUUUUUUCUAUUCCUCUUCCUUUUCAAUGGCUUAGGUAUUGCAGUUUCUUAUUUCACA +>U2AF2_K562_rep02_295 +UUAUAAAUUUUUCUCCCUUUCUUCUGUGGAUAAGCUGGAACAGAUCUAUGAAUGCAGUAAG +>U2AF2_K562_rep02_296 +UCUUCUUCCAUUUUUAUUUCCUUCCCCAUUCAGCACCACAUGAAUCAGAAUUUUUUUGAAA +>U2AF2_K562_rep02_297 +CUGUUUCCCUAUUAUUUCCUUACUCUGCUGAACAUGUCCGCUGUUUUACCUCACUGCUCCU +>U2AF2_K562_rep02_298 +CUGUUUCCCUAUUAUUUCCUUACUCUGCUGAACAUGUCCGCUGUUUUACCUCACUGCUCCU +>U2AF2_K562_rep02_299 +UCUUCUUAUUCAGGCAACAUAAGCUUUACAACAAGGAGUUGUAUGCUGACUUCAUUGCUGC +>U2AF2_K562_rep02_300 +UCCAGACCGCUCCUGAGUGGGAGGAGGGGUUCCUGUAGCCGUUGCGUCUUCUCAAACACGG +>U2AF2_K562_rep02_301 +UACAGAGCCAUAAGUGUGAUCCUUGGUGACAGGUGGAAGAAAAUGAAGAAUGAAGAGAGAA +>U2AF2_K562_rep02_302 +UUCUUUUUCUCCUCCCCUGGCAGCAACAGCCAGGCCUGUAGCAGUGCCCUUCGGAAACCAG +>U2AF2_K562_rep02_303 +UUUUCUCACUUUUCCAGUGGUCGUAGCAGGAACAGCGUCUUGACCUCACAUCAGUGACGUG +>U2AF2_K562_rep02_304 +UGGGGAUGUCUGGAAAGGUUGUUGCCGAGGGGGCUGGGCGCAGCCACCCUGUCCCGAGCAG +>U2AF2_K562_rep02_319 +UCACUCUUUUCCCUGACCCUUGGGGCCCAGGGCCAUGGAGGGACCCUUAGGAGUUCAAUGA +>U2AF2_K562_rep02_320 +UCACUCUUUUCCCUGACCCUUGGGGCCCAGGGCCAUGGAGGGACCCUUAGGAGUUCA +>U2AF2_K562_rep02_321 +UCACUCUUUUCCCUGACCCUUGGGGCCCAGGGCCAUGGAGGGACCCUUAGGAGUUCAAUGA +>U2AF2_K562_rep02_322 +AAUGCUCAAAUUGGUUUGGGGGAGCUAUAGGAAACAGUCUCUGAAGAUGCAUAAGGGGCAG +>U2AF2_K562_rep02_323 +UCAUUGUUGAACUCCCACUUUAGCAGAUCACAGAAGAGGAGGUCAGAAAUCUGAAGCACAA +>U2AF2_K562_rep02_324 +ACUCUAAGUUUACUUCUGUUCUCCCUACACUUCCCCACGUAUAUUAUUCGAGUUAAUUUUU +>U2AF2_K562_rep02_325 +UCCUUUACUCUCAUUUCAACUUCCUCCAUAGUAUUGCUGUAAUUAAUCAAAGUAGGCAAAG +>U2AF2_K562_rep02_326 +UUUUCAGUCUUUCCCAUAAAGGUAAUGAAUUUUGGGGCACUACACAAACACUGAAUGUUAA +>U2AF2_K562_rep02_327 +CAAUAGCAGACUCCAGUUUGGGAAUUGAUCCUCUUCGGAGACCUGGACUUCACAUAAACCA +>U2AF2_K562_rep02_328 +UCAAUAGCAGACUCCAGUUUGGGAAUUGAUCCUCUUCGGAGACCUGGACUUCACAUAAACC +>U2AF2_K562_rep02_329 +UUCCUUCUAUCUUUCCCCGUCUUUUCUUCCUUCCUGUAUUGACUUGUUUUGACACAUUUGU +>U2AF2_K562_rep02_345 +CUGCUUCCUUCCCUGACAGGCGGCUGUGGUGCUUCAGGCAGCUUUCAGGGGACAUCUCACG +>U2AF2_K562_rep02_346 +AUAUAUUUUCCCUCCCUUUCUUCCUCCCCUCCCCUCCCUCGCUUCCUUCCUUCCUUCCUUU +>U2AF2_K562_rep02_347 +AUAUAUUUUCCCUCCCUUUCUUCCUCCCCUCCCCUCCCUCGCUUCCUUCCUUCCUUCCUUU +>U2AF2_K562_rep02_348 +CCUUUCUCUUUUUAGCCCCUGGAGGAACGCGCAUAGAUGAUGGUGACAAGACCAAGAUGAC +>U2AF2_K562_rep02_349 +UUAAUUUGUAGUUCCAAUGACAGGAUUUACACAGAGAGCAACUAUUGAUCCAGAACUGAAU +>U2AF2_K562_rep02_350 +UCCUUUCCUCCUCCUUUCUCCCCAUCUCCCUCCACCGCCUUUUUUUGAUUGACCAAGGAUC +>U2AF2_K562_rep02_351 +CUGUUUUAGGAUAUUAGAAAUGGCUACUCCCCAGUCAAUUUUCAUCUUUGCAAUCUGCAUU +>U2AF2_K562_rep02_352 +AAUUUGCUUCUUUCUCCCAUCAGCAUUACCUUGUGGUUUUCUUCUGCAUUUGAGACACAGU +>U2AF2_K562_rep02_365 +CUCAGAAGAGGGUUGGUAGGCCUGGGGGAUGGAUGGGGUUGCUGAAGGCCAUGGCUGAAGC +>U2AF2_K562_rep02_366 +UUUUUUUUCCUUGUCACUAGGUUCCACUAGCACAGUCAGUUUACUUUAGGUUUAUGUCUAA +>U2AF2_K562_rep02_367 +GUGUGGCGGGCAGGGCGGCUCCUGGAGGUGGGAUCUGGGUCAGAGUUACUUCAUGCAUGUC +>U2AF2_K562_rep02_368 +UUCCCAAAUGCUGGAAAAUCCUCUUUGCUAAGUUGUGUUUCUCAUGCAAAACCUGCAAUUG +>U2AF2_K562_rep02_369 +UAGUUAAUAUCUUUGUCCAUACAUCUUUCCAUGCAUCUAUGAUUGUUUCUUUAGGAAUAGA +>U2AF2_K562_rep02_370 +GGGUAACUUUUUUGCCUGUCUCCCAUCCUCCUUUACUCUCAUUUCAACUUCCUCCAUAGUA +>U2AF2_K562_rep02_371 +UUUUCUUGAUAGGACCUUGCUAAGCAGUACUCUGACAGACUAGAAUGCUGUGAAAAUGAAG +>U2AF2_K562_rep02_372 +UUUUAGCUGGAAAGUGAAAUUUCAACCACAGCAGAUGACUGCAGUUCAGAGGUAAGACUAA +>U2AF2_K562_rep02_373 +CUUCAUGUUUUGAGUUGGUUUCUAUUUUCCCUUCAUUUCAGUUAAAUCCUUAAAUAUAAUU +>U2AF2_K562_rep02_374 +UUCAUGUUUUGAGUUGGUUUCUAUUUUCCCUUCAUUUCAGUUAAAUCCUUAAAUAUAAUUU +>U2AF2_K562_rep02_375 +CUCUCCCGCUUGCCUCUGGCAGGAGCUGGGCUGGUGAUGAAGGUCAAGCAGGAGAAGCCGG +>U2AF2_K562_rep02_376 +UUUGUCUGACUUCUUUCACUUUCAGCUUACGAGGAAAUAUUUCAGUAAAAGCAGUUAAAAA +>U2AF2_K562_rep02_377 +CAACACUCUUAUAUACCAAAGUGACCUGAAGGACGGAUGCUGUGUCUUGUUUAUCUGCAUA +>U2AF2_K562_rep02_378 +GUGUCCUUUGCCUGCAGAGACCUGUCUGGGCCGCAGAGAGGAGUCUGGAGGUAGGGUCCAA +>U2AF2_K562_rep02_379 +GUGUCCUUUGCCUGCAGAGACCUGUCUGGGCCGCAGAGAGGAGUCUGGAGGUAGGGUCCAA +>U2AF2_K562_rep02_380 +CUCGUUUUCUUUUUUAGGCCUGAUCAACCCCGUAUAACCAAAGAUGUAAUUUGUUUUCAUG +>U2AF2_K562_rep02_399 +CUUCAUUGAUAGCUAACUUCUCCUUUGCCACUUACUGAACGGUCUGAUCUCUGGAGAAUUC +>U2AF2_K562_rep02_400 +UACAGUACGGGGUGGACGUGAGGAGCCGGGACGCCCGGGGCCUGACUCCACUGGCAUAUGC +>U2AF2_K562_rep02_401 +AUUUCUCUGAAUUUCUAGAUAUACACCUGAAGAAAUUGAGAAGCUCAAGGAGUAAGUUUUA +>U2AF2_K562_rep02_402 +UUCUCUCUCCUCUCUCUCGUCCUCUACCCCUGCCCCCUGGGUGUUUUUGCAGUUGGUUAGU +>U2AF2_K562_rep02_403 +UUAUUAUCCCUUGUAUGGCAGGAAAGAGUUCCUAGAGAGAGAAGACAAAGACAGUCUGUGU +>U2AF2_K562_rep02_404 +UUAGGUAAUUUCAUCUGUGCCAAAGCCUCCAGAGGACAAGCCAGAAGAUGUACAUACAAGU +>U2AF2_K562_rep02_429 +AUAUCCUUCAUUCUUUAGGCACUGUGAGCCCUGAGAUGUUCAAGAAGAUGUCCAACUCAGA +>U2AF2_K562_rep02_430 +UGUGCAUGUGUGGGUGUGUGUGGGCACAGGUGUGAGUGUGUGAGCAACAGUACCCCAUUCC +>U2AF2_K562_rep02_431 +UGUGCAUGUGUGGGUGUGUGUGGGCACAGGUGUGAGUGUGUGAGCAACAGUACCCCAUUCC +>U2AF2_K562_rep02_432 +CUUUCCCCAGCCUGACAUUUACCCCGGUAACUGCUGGGCAUUUAAAGGCUCCCAGGGGUAC +>U2AF2_K562_rep02_433 +CGUGGGAAGGGAGGCUGGGAGACAGAGGGGACAGUGGCUUCCUGGGUCUGUGAAGACUGAU +>U2AF2_K562_rep02_434 +UUCUGUCUUCCGUUUUCAGCUAAAUUCUGUCCAACGUUUAAUAAAUCAAUGGAGGAACAGG +>U2AF2_K562_rep02_435 +UUAGCUUUGCUCUACAGGUGUUGGAUGACAAGGGCUCGAGCCUCAGCGCCUGUCCUGAUUC +>U2AF2_K562_rep02_436 +ACCUUCCUUCUACCUUUGGGCUUCUGCAUUAGGCUGCUCUUGAAGUGUUUGCCGGGGCCUU +>U2AF2_K562_rep02_437 +UCUCUCCCGCAGCCCACAGAGCAGUUCAACGGGCAGGGCGCCAGCUUCAACGGGGGCAGCG +>U2AF2_K562_rep02_438 +AUUCCUUUUGCUUGUUUCACAGGGGGUUUGAAGAGGACAAAUAAGUUUUUGUUGGUUAAUU +>U2AF2_K562_rep02_439 +UAUUUUUUCCCAGUGCCGACCUCACUUUCCCCACUUGUCCGACCUGCUGCCCAGGCGUCGA +>U2AF2_K562_rep02_440 +CUUCCUGCCCUGGCUCCAUCCUCAGGGGCUCCCUGCAGACAGGGGGGGCCUUCGCCCUGGA +>U2AF2_K562_rep02_441 +UGCCACCCUUUUUUCCUUAGGGUCAAGAAGACUGACUGACAGACCAGGACCCCACCAGGGG +>U2AF2_K562_rep02_442 +UUUCUUUCUAAUCAUUUUUCACCCUUUCUUUAUUUCUUUAAUUGAGUAAUUCCAAGUAAGA +>U2AF2_K562_rep02_443 +CCCUUUUUAUCUCUAGUAACACUUGUCUCUCGCCUCAAAGUCUUCUUAGCUACACCUGCUU +>U2AF2_K562_rep02_444 +CUCCUUUUCUUUUUUAAAAGCUUGGCUACACUGUAACUAACUAGGGUUAAGAGUACCAGUA +>U2AF2_K562_rep02_445 +CUUUGCCCUGUCCGGUUCUGGCAGGUGUGUGGACCCAGGCACUGGGAAGACUCAGCGAGCC +>U2AF2_K562_rep02_2538 +UUUUUCCUUCUUUUCCCACCCCCUCCCCCUCCAUGUGAAGAUUUGGGUGCUUAACAUAUCA +>U2AF2_K562_rep02_2539 +GAUCUGGUUUUCUUCUGGGGCAUUUAUCCGUGCUGAUCUUGGUGAAUGGGGCAUGAGUCUA +>U2AF2_K562_rep02_2540 +ACUAUUUUAGGAAUCUGGAAAACCAGGGGCUCAUGUAACUGUGAAGAAGCUGUUUGUUGGC +>U2AF2_K562_rep02_2542 +AUUUUUCAUUUCGUAGGAGGGAGCAAAGGAGUUUGCUGCUGCUCUCACCGCUGAGCGGAUA +>U2AF2_K562_rep02_2543 +UUUCCCCCCAGAAAACUUUAGAAACUGUUCCUUUGGAGAGGAAAAAGGUACUCUGCCAGCA +>U2AF2_K562_rep02_2544 +GUAUUUUCCUUUGCAGAGAGAAAAGGAACAGUUCCGUAAGCUCUUUAUUGGUGGCUUAAGC +>U2AF2_K562_rep02_2546 +CCCAACCUUUUCUUCUUUCCCAACUUCCCCUUCCUUUCAUAACGUUUUAAGAAAAGUAUAU +>U2AF2_K562_rep02_2547 +GUCUUAUCCACCUUUAGGAUUGGAGAGGGAGAAAGAAAAACUGCUUUGUGUGCCAAAAGCA +>U2AF2_K562_rep02_2548 +UUGCAGCUUUUCAUGCAACACCCAACACUUAUAAGCGGAAGAACACAGAAACAGCUCUAGA +>U2AF2_K562_rep02_2549 +UACAACUGAACUUUUUUUCUUUUUAGUUACUCCACAGGAUCCGCUGAACAUAGGAUGUUGC +>U2AF2_K562_rep02_2550 +UUUUUUUCCUUUGGCAGGAAGGUGUCUUGCUGCAGGUAACUAAUGAAGAAGUGGUCAACCA +>U2AF2_K562_rep02_2551 +UUUGUGUUUUUGCAGGUUGUGGGCUGCACACUGCAGAAAGAUACAGCUGAAAAAGGGUUAG +>U2AF2_K562_rep02_2552 +GUGUUUUUUUCUGUUUGGAUGACUUUUACCCCACCACUAUUUUAGGAAUCUGGAAAACCAG +>U2AF2_K562_rep02_2553 +AUUAUGCAUUUUCUCCCCAGGUCAGCUGGCUGCCUCAUUGCCACCUCCACCUGCAGGAAGG +>U2AF2_K562_rep02_2554 +UCCUGCAGGCAUCUCUAGGUACAACAAAAUACUGCAGUUACUUCUUAAAGAAUAUGCAGUG +>U2AF2_K562_rep02_2555 +UCCCCCUCAGCUUUGUGUCCCUCCUCUAAGGAAAUGGCCCCCGCCAUCGACUGGUUGUCCU +>U2AF2_K562_rep02_2556 +AACAGUUUAUAGUAAACGUAAUCUUUUUUUGGCCCCUAACAGAUGGAUAUGGCAGUGGACG +>U2AF2_K562_rep02_2557 +UUUCCCCUCUUUGAACCAAGCCACUCCUACCUAGGAACUAAAUGGGUAUAUAUUGCCUGUU +>U2AF2_K562_rep02_2558 +UUUGUCUUUCCUCCCUGGGGACCGCUGCCACCCGUGCGGGCCGAAGCCUCGCGAAGCCGUC +>U2AF2_K562_rep02_2559 +UCCUAAUUGCCUCCUUUAUAGCAAAAGAACAUCUUCAUCCUAAAUCUUCUCUCCCAGCAUG +>U2AF2_K562_rep02_2560 +CUUUUUCCUUUACUCCUGGCAGGCUAAUAUUUUUUUAAAGAUUAUACUUCAUAUCUGUGAG +>U2AF2_K562_rep02_2561 +UUUCCAUAUUUCUAGUUCCACAGGAAAGCGAGUGACCUCGCACCUAUAUCCAUAGCAACCA +>U2AF2_K562_rep02_2562 +UACUCCACAGGAUCCGCUGAACAUAGGAUGUUGCCACAAAAUCUACCUCGUGUAUUUUUCU +>U2AF2_K562_rep02_2563 +UUUUUUUUUUUUUUUUUGUUCUUCUCCUUUAGGUGGUAAAUAAAGAUGUCCUGGACGUUUA +>U2AF2_K562_rep02_2564 +CUUCUUUUCCUUUACCCCUCUUCCUCCUGCAGGCAUCUCUAGGUACAACAAAAUACUGCAG +>U2AF2_K562_rep02_2565 +CUCCCUGCUUCUCUCCAGUCUCUCUUGUGCCCAGAUAGACCAGCCAGAGUUUGAUGUUCCC +>U2AF2_K562_rep02_2566 +UUUUUGAGAUAGGGUCUCCCUCUGUCGAACAGGCUGGAAAGUGUAGUGUGUGAUCAUCUUG +>U2AF2_K562_rep02_2568 +AAUCUAGCAUCAUAGCUCCAGCUCCCGCUGAGGAUGUGGAUACUCCUCCAAGGAAAAAGAA +>U2AF2_K562_rep02_2569 +AAGCUUAUAGCUUCAUUGCACCAUGUGUGGCAUUUGGGCGCUGUUUGGCAGUGAUGAUUGC +>U2AF2_K562_rep02_2570 +UUGGAGAGGAAAAAGGUACUCUGCCAGCAGGUCACCUCAUAUUUAAGAAUUUAAUUUCCUG +>U2AF2_K562_rep02_2571 +AUUCACUCUUGAUUCCGCAGGCUGGACAGGAAGCACGGCAGCAUCUACUCGGCUUCUGAGG +>U2AF2_K562_rep02_2572 +UCUUUGUGCCAUUUUCUUUUUUCGAUCUUUCUCAGGUAGGGAAUAAUGAAAUUUGGAUCAU +>U2AF2_K562_rep02_2573 +CAUGCCCACUCUAGGGUUCUGAUCCCACUGCAUUCUCCGUCCUUACCCAAGCCAUCACUGG +>U2AF2_K562_rep02_2575 +UCUCUCAGUUCUUCCAUUACCUUCCCCAGAGGCAAGAAGUUACCAAUUUCUUGGACUUUCA +>U2AF2_K562_rep02_2576 +CCAGCUCGCAGCUUUGCGUGGGCACCCCUUUCCCUGCAGGUGCACCUGGGAACUGGAGACC +>U2AF2_K562_rep02_2577 +UUUCCCUUCCCCAGGCUUUUUCUCCUCCGUGACAGCCAGAGUAAUCCAAAGGCAUUUGUAC +>U2AF2_K562_rep02_2578 +ACCUAAAUUAAAGCUGCCACUGCAGAGCCCCGCCAUGGAAGACACGCCGUUGGUGAUAUCG +>U2AF2_K562_rep02_2580 +UUCUCUUCUUUUUCUCACACCCAAGGGGAAGCCCUUUCCCCUUCCUUCUCUUUUCCUUUUC +>U2AF2_K562_rep02_2584 +AUUUCUUUUCUAGGUCCUACGGGAAGUGAAGGUGCUGGCAGGUCUUCAGCACCCCAAUAUU +>U2AF2_K562_rep02_2585 +UUUUUUUCCCUGCCGGAAUUUUAGCAUUGAUAUGAACCAUGGACAAGUAUAUUCUGCUGCC +>U2AF2_K562_rep02_2586 +GUUCAUCUGUCCCUUUCCAGGGGGAAGACUGUUGCUCUCAAAGAAGUAGGUUUUUGGCUGG +>U2AF2_K562_rep02_2587 +UUCUAGUUGGAGCUCAGCUGCAUGGAAGGCAGCUGCACGUGUUCGUUCCCAACCAGUGAGC +>U2AF2_K562_rep02_2589 +GUCAUUUACUUAAAUUAUUUUGGUUGUUUUUCCCUUUUUUUCCUUCUUUUCCCACCCCCUC +>U2AF2_K562_rep02_2590 +UUUUCUAGCUACUCUCAGAACCGCACGUUUGACACGUACAUUGGGCAGGGCUACGUGAUUC +>U2AF2_K562_rep02_2591 +UCUUUCCUUCCUUCCUCUUCUUUCCUCCCUUAUUUCCAGGGUCUCACCCUGUUGUCCAGGC +>U2AF2_K562_rep02_2592 +UCCUUUUAAUGCCUUCACAGGGUCAGCGCCAAACUGGAGGGGAAUGAAACACUAAAAGUUG +>U2AF2_K562_rep02_2593 +GAUUUUGUCCUUAGUUAUACUUCGAUUAAAACAUGGCUUCAGAGGCUCCUUCCUGUAAUGC +>U2AF2_K562_rep02_2594 +CUUUGAAUUAUGCUUGUGUUUUUUUCUGUUUGGAUGACUUUUACCCCACCACUAUUUUAGG +>U2AF2_K562_rep02_2595 +AGGGGUGAAUGGUGCUGAGGUGCGAGGAGAGGGAAGGACAGUAAAGAGCAGGUGGGCAGGA +>U2AF2_K562_rep02_2596 +UUAUUUCUAUUUCAGACACCAACCAUCUGCCCAGUUGAAGAUUUGCAAAAUAAUUGUUUUU +>U2AF2_K562_rep02_2597 +UCCCCUUUUAUCCAGGGUAGGUCCAGGUAAAGCCAAAGGCCUUAUCCUUAUCUACACUGCU +>U2AF2_K562_rep02_2598 +UGGCUGCCUCAUUGCCACCUCCACCUGCAGGAAGGCCAGAGGUUCUGGUGGAGUUGAUUGA +>U2AF2_K562_rep02_2599 +AGGUGGUAAAUAAAGAUGUCCUGGACGUUUACAUUGAGCAUCGGCUAAUGAUGGAGCAGCG +>U2AF2_K562_rep02_2600 +CCAAUUACAUUAGCAAACUUUGGGGGCUCAAAUGCAAGGUGGUUUUGGAUGUGGCAACCAG +>U2AF2_K562_rep02_2601 +UCUUUUUUCGCUUUUAGGAUGAUCGCUGCAAGAUCCCUUUAUUCAUGCUAAUGUCCUUUAU +>U2AF2_K562_rep02_2602 +AUUUCUCCUCAGAUAACUUCAAGUGAUGUACGAAAAGGUUUGGAGUUCAUUUUUGUGGAAA +>U2AF2_K562_rep02_2603 +UCCCUUUGCCCCUCCCAUUCCCAUAUCCUUUUUUUCUCUCCUCCAUAGACCACAUAGCCCA +>U2AF2_K562_rep02_2604 +UGUCCCAAAUCUUCUAGGUACCAGGACAUUAUUCACUCUAUUCAUCUAGCACGGAAGCCAA +>U2AF2_K562_rep02_2605 +GUGUGGCUCUGAGCUGAUUCAUUUGCUGCUCAUCGUAUAGGUGCUGCCCAGAGUAUCCUUA +>U2AF2_K562_rep02_2606 +GUAAAUAUCCAUGUGGAAAAAGUAGGGAGUGUGUUGCCCCAAACAUCUGCAAAUGUAAACC +>U2AF2_K562_rep02_2608 +UCUGCUCUUUUCCCACAGCGGGACGACCCUGGGACAGUCUCCACUGGGGCAGAUCCAGCUG +>U2AF2_K562_rep02_2609 +AAACUCAAAAGUGUUCAUUUAUUCCCAUUUCUCCUCAGAUAACUUCAAGUGAUGUACGAAA +>U2AF2_K562_rep02_2610 +UAUUGAAUAUUUUUGAUUUGUCUGCUUUUCUCUCCAUAGAAAGCUUAUAGCUUCAUUGCAC +>U2AF2_K562_rep02_2616 +UUUCUCCACCUUUUAAGGUUUUUGGCUUUCAUCGCUUUUUCUACAUGUUUUUAGCCUCACC +>U2AF2_K562_rep02_2618 +UUUCCUCUCUUUCCAGCUAAUAUGCAAGUGAACCAGUGACCUGCAGUUCUGCCCACACAGG +>U2AF2_K562_rep02_2619 +UUUUUCUCUUCCAUCAAAAUGAGUUUUAGAACUUUGCCCUGAUGUUGACAUUUUUCAUUUC +>U2AF2_K562_rep02_2621 +UCUUUGCCAAUUUUUCCUUCUUCUUUUUUUCCCCAACCUUUUCUUCUUUCCCAACUUCCCC +>U2AF2_K562_rep02_2622 +UAAGGUUGCCUUUUCCACCUUCCAUCCUGUUUCCUUAAAAACAGCAAAUAACAAUCUACAA +>U2AF2_K562_rep02_2623 +AAGGUUGCCUUUUCCACCUUCCAUCCUGUUUCCUUAAAAACAGCAAAUAACAAUCUACAAG +>U2AF2_K562_rep02_2625 +GUUUUCAUUUUGGUUUUCAGGGGAGCCCUGGAAGCUUAUGUUCAAUCAGUGAGAAGUAGAG +>U2AF2_K562_rep02_2626 +UUUGAGACGGAGUCCCGCUCUGUCACGCAGGCUGCCAGGCUGGCGUACAGUGGCGCAAUCU +>U2AF2_K562_rep02_2627 +GACAGGGUCUUGCUCUGUUGUCCAGGCUGGAGUGCGGUAGUGCUAUCACAGCUGACUGCAU +>U2AF2_K562_rep02_2628 +UUUUUUUUGCAUUUAGGCUGGAGGCAAAGCUGGAAAGGACAGUGGGAAGGCCAAGGCUAAG +>U2AF2_K562_rep02_2629 +AUUUUAUGUUUUUCCUGUCUUUUUUUUCCUUUGAGUAACGGUUUUAUCUGGGUCUGCAGUC +>U2AF2_K562_rep02_2630 +AGGUAUGCCGAGCAGACAGCUGGAGGAGCCCGGGGCAGGGACACCUAGCCCGGUGCGUCUG +>U2AF2_K562_rep02_2631 +UGUAUUCUAGAUACAAAUCCCUUCUGUUCAUCAGGGUUGCAGGAUACAAGAUGAAUAUACA +>U2AF2_K562_rep02_2633 +GGUUUAAAUUUGAUGUAAGUUUUUUUUUUCCCCCCAGAAAACUUUAGAAACUGUUCCUUUG +>U2AF2_K562_rep02_2634 +AUUUGUGUUUUCUCUCCCUCUUUUUCUUGAUCAGCAUUAAUAAGGACUUAUAAAUUGUAUU +>U2AF2_K562_rep02_2635 +AUUUGUGUUUUCUCUCCCUCUUUUUCUUGAUCAGCAUUAAUAAGGACUUAUAAAUUGUAUU +>U2AF2_K562_rep02_2636 +CUAUUUCUUUUUUCCAGGAAACCAGGGCUUGCAGAUAUUGGUAAGUUGCCCAAGGUCACAC +>U2AF2_K562_rep02_2637 +UUUUUUUUUUAGGUACUGUCCAAGAAGCUGGAACAUUAUUAUCCAGCAAGAAUGUUCGUGU +>U2AF2_K562_rep02_2638 +AAAAUGUCACUUUUCAUCCCCAGUUUGCCUUUUGUCUGAAAUGCACCAGUGAAGCAAUCAA +>U2AF2_K562_rep02_2639 +CUUUGUUUUCUUCAUCUCCCCUGUAGGGCCAUGUUUAUGAGUGGACUAAGUGAAAGCAAAC +>U2AF2_K562_rep02_2642 +CUUGCCUCCCACCCAGACAUGAGCACCAGCCUCCAGGAAGGCCAGGAGGACGGGCCGGCAG +>U2AF2_K562_rep02_2643 +UUCAUUACUGCACAGGGGUGGCGUACACAUCAGAAUGUUUUCCUUGCAAGCCAGGCACAUU +>U2AF2_K562_rep02_2644 +GUCCCCCUCCCAUGCUCUGUUUUUCAUUACUGCACAGGGGUGGCGUACACAUCAGAAUGUU +>U2AF2_K562_rep02_2645 +GCGGCCUGUCUCCUCCCCGCCAAGACGCCGUGUGCGCCGCCUCGCGCAGCUCCGCCUGGCC +>U2AF2_K562_rep02_2646 +UGUUUUUCUUUCUGUAGCAUGGCAAGGUCACAAGACAUGUUUAAGUAAGGUAGGCUCAUGU +>U2AF2_K562_rep02_2647 +UUUCCAUUAAGGUUAAUGUUCGUGAAGAAAUUGAAGAGUUUUUUCCAAGAAUGUGGAAGAU +>U2AF2_K562_rep02_2648 +UAUAAAUGUGUUACUCACAGCGGUUCAAGUCCACACUGAAGAGCAACAGAAGAGUCAUCCC +>U2AF2_K562_rep02_2649 +UUCUGUAGACCUCGAAGUAGGGGGAAAACUGCAGUGGAAGAUGAGGACAGCAUGGAUGGGC +>U2AF2_K562_rep02_2650 +UUGUUGUUUUCUGAGAUGGAGUCUUGCUGUGUCACCAGGAUGGAGUGCAGUGGCAUGAUCU +>U2AF2_K562_rep02_2651 +AGAUCUUGGGGGCAAAGGAAACCUUGGGGAAGGCAGGCUGGUAAGGGCCUCCCAGGAGGAU +>U2AF2_K562_rep02_2652 +GCCUGGUCAUGAGGCAGGGAGGGGACGGGUGGUGCUGCGUGCAGGGCAAGGGCUGUGGACG +>U2AF2_K562_rep02_2653 +CACUUGAUCUUUUGUUUCCAUGUUUGUCACUAGAUGCCCAUAAAAUUUGUGGAUAAGUGUU +>U2AF2_K562_rep02_2656 +ACCCACAGUUGAAGAUUCCUGUCUCUGGAUCCAAAUCAGAGGGCCUUCUCUACGUCCACUC +>U2AF2_K562_rep02_2658 +UUUUCUUUUUUCUUUUUCAGUUGCAGGAAUUUAGCCAAUUCAGAGGUCUUGUUCUCCAUAA +>U2AF2_K562_rep02_2659 +UUUCACCUCUUGGUUCCUCCCACAGAGCACUCCAGAAGAGAGGCUGCCCGUGGAAGGGAGC +>U2AF2_K562_rep02_2660 +UUCCUGAUAUUGAUAAUUUGUGUUUUCUCUCCCUCUUUUUCUUGAUCAGCAUUAAUAAGGA +>U2AF2_K562_rep02_2661 +AUUCCUGAUAUUGAUAAUUUGUGUUUUCUCUCCCUCUUUUUCUUGAUCAGCAUUAAUAAGG +>U2AF2_K562_rep02_2662 +AUUCUCCUGUUUAGAUAAAGAAAGCCGCCCACCUCGGAAAUUUCCUUCUGAUAAAAUUUUU +>U2AF2_K562_rep02_2663 +UUUCCAUUCCUACAGAACUGAGAGAAGAUGGUUUCCAGCCUCAAACUUACCUAGUACAGGG +>U2AF2_K562_rep02_2664 +GUCCGUUUGCUCUUUUUGUCUCCCAACUAACAGUGGUUUAUCAGAUACUAUCAUUUUGGAU +>U2AF2_K562_rep02_2665 +GUAAACUAUUUGUAUUUUCAGGUCAUAGCCACCUUCCAUUCAUCUUUCAAACAAGUAAUUC +>U2AF2_K562_rep02_2666 +UUGUAGGAAAUACAACUGGAGCACGCAAAGCAAGCCUUUGUGCAACGGGACAAUGCUAGGA +>U2AF2_K562_rep02_2667 +GGCAGAGAAGCGUGGGGUGGGUGGCACAGAGAGGAUGGAGGGAUCAAGAAGGAUGUGUCUU +>U2AF2_K562_rep02_2668 +GUCAGUUCACAUUGAGUCUUCUUUUCCUUUACCCCUCUUCCUCCUGCAGGCAUCUCUAGGU +>U2AF2_K562_rep02_2669 +CUCUGUUCUUUCCUCCUGGCAGGUGACAGAGCUGAAUGAGCCACUGUCGAAUGAGGAACGA +>U2AF2_K562_rep02_2673 +AUGAUGCACUUUAUUCUCAUUCUUUGUGCCAUUUUCUUUUUUCGAUCUUUCUCAGGUAGGG +>U2AF2_K562_rep02_2674 +ACUUUUCUGCUUGACAGGCCGGACAGUGGCUGUGGAUUGGGCCGUGGCAAAGGAUAAAUAU +>U2AF2_K562_rep02_2677 +UUUCUUUUAUGUGUAGGACCUGGAGCCAUGGAAAGAAAACUUGAAGAUCUAUUUUAGCCCU +>U2AF2_K562_rep02_2678 +UAUUUUUCCUUUUUCUCCUUUCAGAUAAACAUCUCUAUUAAAUUAGGAGCUAUCAUUUUUC +>U2AF2_K562_rep02_2679 +UUUUCCCACAGUACUCUUUCCAUUCCUUACCCCAGUUUUUGAAGCAUUAAAUGUCUCUCUG +>U2AF2_K562_rep02_2680 +UCCCUUUCAGUAUUUAGUGUCUCUGAUCCGGGACAAGCUAGGAUGGAUGUGGGUUUUCUAC +>U2AF2_K562_rep02_2682 +CUGUUUUUCUUUCUGUAGCACGGCAAGGUCACAAGACAUGCUUAAGUAAGAUAGGGUCAUG +>U2AF2_K562_rep02_2683 +CUGUUUUUCUUUCUGUAGCACGGCAAGGUCACAAGACAUGCUUAAGUAAGAUAGGGUCAUG +>U2AF2_K562_rep02_2684 +UGUGUGUAUUUUCCUCCUAGGUUCAUUUUCCAGACACUGAAAGAGCAGAAUGGCUAAAUAA +>U2AF2_K562_rep02_2685 +UGGGAUUGGGGAGAUCAUGGAAAUGGAGGAGAGCCUGAGCACCGUAGAUCUUGGGGGCAAA +>U2AF2_K562_rep02_2686 +ACCUCUCUUUUUGUGUCCUUUAAUUAUCUCCCAAGUUUUCUUUAUGUGACUCUUGUACAUU +>U2AF2_K562_rep02_2689 +CUUUCCCUUCCAUUUUUCCUGGGGUGCCUCUCACCCUGCAUCUGCGCGUUCAGCAAGCUGG +>U2AF2_K562_rep02_2691 +CUUCCAUCUUUCAUUACUACAAUUUACCAUGCAGAGCUCACAAUGUCUCUCUGCACCAAGC +>U2AF2_K562_rep02_2692 +CCUGAGCUUUUGGGGCGCGGGUGGGAGCGCGGGGGAACCCUCAAGACGGCUUUCUUUUGGC +>U2AF2_K562_rep02_2693 +UUUUUUUUUCCUUCUCAUUCUAGGUAGAAGAUGUGUUACAACGUUGUCGAGAAUAUUUAAU +>U2AF2_K562_rep02_2695 +ACUAAUUUAGGAUCAACCACAGGUUUGUCUGCUACCCCCCCUGCCUCAUUACCUGGCUCAC +>U2AF2_K562_rep02_2696 +CCUCCUGCUGUUUAUUAGCUUUGUGCGACCCUGUCUGCCUCAAUGGUGGUUCGUGUAAUAA +>U2AF2_K562_rep02_2698 +CAGAACAUCUUCCUCUUUGGCAGGUCUUCAAACUUUGGUGCUGAAGCUUUCGUUAAAAGGA +>U2AF2_K562_rep02_2699 +UCCCCCAGGUUACCCUUAAGUUACAGGAGUCCCAGCUGCCUGGGCCAGACCAGUUACAGCA +>U2AF2_K562_rep02_2700 +AGGAUCUCCUUCUGUCCCCUAGGCCGGAGAGCAGUGGGGCAAUCAUGGCUGACUGUAGCCU +>U2AF2_K562_rep02_2701 +UGACUUUAUUUUCCUAGGGGAAGAAGAUGGCUCUCUGUACCAACAAUAUAACAGACUUUAC +>U2AF2_K562_rep02_2702 +UUUGUUUGUUCUUCACAGGAUGGACAACCGGAAAUUUUCUACACAUUUUGGAAUUCAGUUA +>U2AF2_K562_rep02_2703 +UGUUACAGGCUUCUCCCACCUGCCCAGUGGGCUGUACCCAUCCUACCUCCACCUGAACCAC +>U2AF2_K562_rep02_2707 +UUUAACUUUUCUUCCAUACAGAGGAGUUUGUUCUGGCAGCUCAGAAAUUUGGUCAGGUUAC +>U2AF2_K562_rep02_2708 +UCUUCUUUUCAGGGUGUUCUAAGGAUACAUUUUAUUGAAGCUCAGGAUCUUCAGGGGAAAG +>U2AF2_K562_rep02_2709 +UUUGGGCCUUGCUUCUCCAUGCCCAGAGGCAAGCCCCCCGCCCCAUCCCCUAGGGGACAGA +>U2AF2_K562_rep02_2710 +UUCCCACUUUUUUGUUUCUAGACUGAGUGUACUUGGUCUGGUAUUUGUGGCAUAACUUACG +>U2AF2_K562_rep02_2711 +UCCUUUCUUCCAGGUUGUUUUUGAGCACGUUCACUCUCGCAGUGUCAGCUGGGGCUGUUUU +>U2AF2_K562_rep02_2712 +GAUUAGGGAACGACAGUGGGUAGAUGAUUUUCCUCUCCACCGAAGCGCCUGUGAAGGAGAU +>U2AF2_K562_rep02_2713 +UAUCUUUUAAUUACAGACGCAGGGACAGAGCUCAUCGGGAAAUCAAGGAUAUUUUCUAUAA +>U2AF2_K562_rep02_2714 +UAUCUUUUAAUUACAGACGCAGGGACAGAGCUCAUCGGGAAAUCAAGGAUAUUUUCUAUAA +>U2AF2_K562_rep02_2715 +UUUUGCUUUUUCUCUUUUAGGACGCUAUUGAUAACGGAAUGGUUGCAAUUAAGGACAUUUU +>U2AF2_K562_rep02_2716 +GGGAUUGGGGUGGGUGUUUGUCUUCCAUGUAGUUUAUAUCCUGGAACCUGGAGAUCCUCCU +>U2AF2_K562_rep02_2719 +AUUUCUAGGUAUUAAACUUGCUGCUGCUGUUGGGCUUUUUCCACAUUUUGUCUUCUGUUUU +>U2AF2_K562_rep02_2720 +CCCCCUUUUCCUUCCAGCCUUUCAUUCUACAGACCUGGACUUCUACUCUUUGCUGCUUUUG +>U2AF2_K562_rep02_2721 +AUUAAACAUUUAUGAAGAAUCACCUGUGCACAGCGCUACGCAAGAAGAUACAGAGACAUAA +>U2AF2_K562_rep02_2722 +CCUUUCUUCCUUCCCUUCCUUCCUUUCCCCUUCUCCUUCCUUUCUCCCUCCUUCCUUCCUU +>U2AF2_K562_rep02_2723 +CUUUUUUGUUCUUUUUAGGCUGGAGGCUCCCAGGUGAUUUUCACAAAUCCUUUAGAAAUCG +>U2AF2_K562_rep02_2724 +UCUUUUUAGAUUUUGUGGUGGAUGCAACCCGCAAGGGUAACAAAAUUCGUUUUGCAAAUCA +>U2AF2_K562_rep02_2725 +UACCUGAUUGCCUCCUGCUUAUUUCUUCUGCCUGUCUACUUUCCAUUCUGCUUUUACAAUG +>U2AF2_K562_rep02_2732 +UCUUUUUUCCCAGUGCCCUUCUUCAUUCCAGACAUGGUGCUUUGAACAAUUUGACUUGGAG +>U2AF2_K562_rep02_2733 +UAGCUUACAGUGCUUGAAUGAAACACUCACAUCAUGCACAAAAGAAGUAGGAAAGGCUGCU +>U2AF2_K562_rep02_2734 +UUCCUAAUUUGGCAGCAGAAGGGGGAAAAACCAGGGCCUUUCACAGACAAGGCUUGUUUUA +>U2AF2_K562_rep02_2736 +CCUUUUCCUUUUUUUGGUCCUUAGGUUCUGAGUUACUUUCACCAUCAAAAGAAAGUUCGGC +>U2AF2_K562_rep02_2737 +UUUGAAUCCUUUGCAGCCCACACCCCACCUCCAGUUCCAACUCCUCCACUUCCUUCCAUUU +>U2AF2_K562_rep02_2741 +ACUCUGAUUCUGCCCCGGCUGCAGCAGGAAGGGGAGCGGAUCCGCAGUGUGCUGGACGGCC +>U2AF2_K562_rep02_2742 +CUCAAGUGUUUUUUAAGGUACACCCAAGCCCCUUCAAGAUGUAACUUGACAAAUUUUUUAA +>U2AF2_K562_rep02_2747 +ACACACUUUUUUUUAGGGGCUGGGCCUGUAUGCUGCUCGAGACAUUGAGAAACACACCAUG +>U2AF2_K562_rep02_2749 +UAAGUAUACUUAUCACUGCAGGUGGGUUCACCUAGAGUGUGACAAACCAACAGAUCAUGAA +>U2AF2_K562_rep02_2750 +UCUUUCCCAAAACUAUUCAGGAUUUUUUUCCUCAAGUGGCAAGUUGCCCCAUUUUAUAACA +>U2AF2_K562_rep02_2751 +UGUAGCCAUCAGCCAGCAAAGACCUCGUCAGUGUCUUUAACUGCGACCUUUCGUCCUCAGG +>U2AF2_K562_rep02_2757 +CUCCCAUCUUCACCCCACCAAGGCCGAAUGGGUAAUAGCCGAAGUGCCCUGAAGAUGAUUA +>U2AF2_K562_rep02_2761 +UGGGACUUUAUCUCUACUUUUUCCUUUCCUUUCCCAGCCAUUAAAAUAGGGUGAGAUGGUU +>U2AF2_K562_rep02_2762 +AUUUUCUAGAUCCCAAGCAGGUCUGUUCCAGCCUCUGAUUGUGUAUCGGGGCAAGAUUUGC +>U2AF2_K562_rep02_2763 +UUCCUCUUCUAGCCUUUCAGUGCUACCUUCAUCUCUUUCAGUUUUUCAAAAUCCCACAGAU +>U2AF2_K562_rep02_2765 +UACUUUUCUCAUUUUGUUUGCAAUCUUGGUUGAACAUUACAUUGAUAAGCAUAAGGUCUCA +>U2AF2_K562_rep02_2766 +UCUGCCACAGGAAGCUGGGCCGGGCUGCUGUGCCUGGGAGGAGGGAAGGAGGAAUGAGAAA +>U2AF2_K562_rep02_2767 +UUUUUCUCUCAUCAGUUUAGGUCUUAGGAUCUACCAUCUGUUACUUUUCAGUUUCUCAUCU +>U2AF2_K562_rep02_2775 +CUUUUCUCCCUUUUGCUUCACUUUCCCUAGGUCUGUUUCAUUCACCUUUUUAAAUAAAAAU +>U2AF2_K562_rep02_2776 +UUUGUUUUUUUAUACAGGUAUGGAAAAGUUGAGGCCACUCGCAUAUUGUUAGAGAAAGGAA +>U2AF2_K562_rep02_2777 +CCAGGCUUUUUCUCCCUUUCUCUCACACUCAAGGAAACAGGUGAAUAAAAGUGACAUGAAG +>U2AF2_K562_rep02_2778 +UCUUGUCCACUCCCCCAAGGCGUGCCCCACUUCCGCAGUGCUGAGUCCCAGCGGGGAGCCC +>U2AF2_K562_rep02_2784 +UUCUUUGUUCAGGUGGAGUACAUCCUGCUGCUUCAAGGGUAGAAGACUCCUCACUGCUUUC +>U2AF2_K562_rep02_2791 +UUACCUCCCUCCAUAGGUGAGGAAAAGAGCCAUGAAUCUAAACAUCAGGAAUCAGUUAAAA +>U2AF2_K562_rep02_2792 +AAUAUUCUUCCUUCCUGACAGGGGGAGUCGGUGAAGUACUUCCUGGACAACUUGGACCGGA +>U2AF2_K562_rep02_2797 +UGCCUUAUCUUUUCAUUUGAUCUCACCCUUAAAAGGAAAAAAAUGUUAUGAAAUAAGAGAA +>U2AF2_K562_rep02_2798 +CUGUCCUCUUUUCCCCCACAGACCUGGCGCACUGUCAUGCCUACCUGGUAGAAAUGAGCCA +>U2AF2_K562_rep02_2799 +CGUCCCCUUUUGUACAUUAGCAUAUCCCAGCAGCUCGUGGAAGCAUUUGUGAACGAAGAAA +>U2AF2_K562_rep02_2806 +GUUACCCUUUUUAUAGGUUUGUGGAAUCUUGCUUCCCUUUUUUCCAACCUUUGUUUAUUUG +>U2AF2_K562_rep02_2807 +UUUGUCACUCAGCACUUUUUCUCCAUAUUCUUCAAGACGAUUGUGAGUAUGGUACGUAACA +>U2AF2_K562_rep02_2808 +UGUUGUCUUUCUCCCACCCCGUGCAGAGUACAUCCAGAAAUACGCCACGGAGGAGGCGCUG +>U2AF2_K562_rep02_2809 +UUUUAUUUUUUUUGCAGGAAAUGGGGCAGCCUUGAGGUCAGACUUGGAAUUAUGUCCUAGC +>U2AF2_K562_rep02_2810 +CUUUCUGCCUUCCUCCUCUCCAGGAAGCUCAAAGGCCCUGUGGCCCCCCAAGAAUGGCAGG +>U2AF2_K562_rep02_2813 +ACACUGCGGAUGCUGGGGGGAGGGGGGAUUCCACUCCUGUUUUGUGAGUAGGCGACCCAUG +>U2AF2_K562_rep02_2814 +UUCUCUUUGCUUUUCAGGAUUCCCGAGAAAGCACCAAGAGGGUAGAGAAGGACAUUGUCUU +>U2AF2_K562_rep02_2823 +AUAAUUUUCUUCCUCCCUUCAUUCAGGUUUCCACUAAAAUGUCAACUCAGUUCUGAUCACA +>U2AF2_K562_rep02_2824 +UAUAUUCCUCCUCCUAGAAGUCUCAGGGGAUCCAGAACUGCAGCCAGUCCUUGCUGGGCUG +>U2AF2_K562_rep02_2825 +UAUCUUCUUGUUUUUGGACAGUUCUGCUCAGAAGGAAAGGUGUAUUUGUCCAUGUUGGAAG +>U2AF2_K562_rep02_2826 +GACCCUCCGGCUUUUGCUUGUCCUUUUCCCUUCUAACAGGUUAUCAAGACUCUGAUUCUGC +>U2AF2_K562_rep02_2827 +GCUUUUUUCCUAUCUUCUCCAGGUCUGUGAAACGUAAGUAUAGCUACCCCAGGCUUAAACU +>U2AF2_K562_rep02_2830 +UUUAUGCUUUUUGUCCCUAGCUGCUACUGUUUGAACGGUCUUGGAUGAACAGAUGGAAGUC +>U2AF2_K562_rep02_2831 +AUUUUAUUUUAUUUUCAGAGAACGAUCUCCUCAGCAGAAUAUAGUAUCUUGUGUAAGUGUA +>U2AF2_K562_rep02_2832 +CCUUUUUUUCUCCUACUGGGGUGUUUACAGGGCAUGGUAAAAGGAAUAAAGGUGAAAAGAA +>U2AF2_K562_rep02_2833 +UUUCCUCUCUCCCUCCUCCUCCCACAGGAGGAAAUCCUGAGCAGCCUGUUCAACUAGAAAA +>U2AF2_K562_rep02_2844 +CCUUACUCUUGUAGAUAUUGGUCCUGUCACUGAUGAUCCUUCCUCUUUGCCUCAGCCAAAU +>U2AF2_K562_rep02_2845 +AUUUCCUUAGGCUCACGCAGCCCUAGCAGGAGCCAACACAGGUAGGUGCACUGAAGAUCAA +>U2AF2_K562_rep02_2846 +CUGUCCACUAUUAUCCCAUAAUCUCUUUUCACCUUAGUUUCAUUAAACAUUUAUGAAGAAU +>U2AF2_K562_rep02_2847 +GACUGACUUUUCCACAGGGGAAGAAGAGGUGAAGGUUUCGACCAUGCCACUGUCAACCUCU +>U2AF2_K562_rep02_2848 +UAUUUUCUCAACUGCCAUAUCCUAGGGGGCUUGGAGUACCCAUAAUACAGUGAGCCCACCU +>U2AF2_K562_rep02_2849 +AUUGUUUUUGUUUCCCCUGAUAGCCUCUGAGUUCCUUCCGGAUAACACUGCAUCAACAAUG +>U2AF2_K562_rep02_2850 +CUGAAAAGUGUCUUUCUCCCACCCCAGGGGCCUGGAAUAGGAAAUGCCUCUCUUUCUACGU +>U2AF2_K562_rep02_2851 +AACAUUUUUUCUGCCUUCAGGAAGCCCUCAAUCUAGAAGAGUAGAGGUCCAAAGGUGCCAU +>U2AF2_K562_rep02_2857 +CAGUGCUUCCUCAUUCUCUUUUAAAACCCGCUUCCCGCUGAGUCUGCACCCAGGAGACCAG +>U2AF2_K562_rep02_2858 +CUCCUAUUUUUUUCUCAUUCUCCUGUUUAUUCCUCUGUUUGCUUAGUUUACAGAAAACGAG +>U2AF2_K562_rep02_2859 +AGGUACGUAUUUGGGUUUGCCUGUGGGUGCCUGCCCUCCUACAUAGAGCCUUGAUCUUCCA +>U2AF2_K562_rep02_2860 +GUUUUUGCCCCCUCUCUCUUUCUGACAGCACACACAUGCCCUCUUGGUUCUGUUUCUUUGA +>U2AF2_K562_rep02_2861 +UUUGUUUUUUUGCUGUGCCCUAGACCGUUACAUAACUGAAGACUCCCACCUUCAGGCAGGA +>U2AF2_K562_rep02_2862 +UUUCAUGCUUCCUUCCAUUUUCGUUUUCGUCAUUUAAGGUGUAAAUGUACAUAAUUUAUCC +>U2AF2_K562_rep02_2882 +AUUGGGGAGAGGUGGGGGUGGGGGGUUCCCACUCCACACUGGUCACCCACCCACAGGGCUA +>U2AF2_K562_rep02_2883 +GUUUUCUUUUUAUAGCCCCAUUGACAAACCUUCAGAUUCUCUCAGUAUAGGGAACGGUGAU +>U2AF2_K562_rep02_2884 +CAAAUGUCUUUUCUCUAGCCUUCCAGCAUUGGGUCCAUGGCUCUGACUGAGAGUGCACUAU +>U2AF2_K562_rep02_2885 +AUAUUUAUUUAUUUAUUUUAGGCUGAGCCAUUGAAAGUAAGUGCAAAAGCCCCUCUUUGGU +>U2AF2_K562_rep02_2886 +UUACCAUAUUAAUGUUGAAUAGCAUCUCAGGUUUCAUUUCACAAUGCACGCAUGGAGUUGG +>U2AF2_K562_rep02_2887 +CCUUCAUCCCACGUUACCCUCUUCCCCUCCCCUUAUGUCUCAAUAUGCCUCUGCCUUUUGC +>U2AF2_K562_rep02_2888 +GGAGUGAACUUUGCGCACUUUCUUCCUUAUGGCAGUGGCCAAUUUAAUAGUGGGAAUCGAC +>U2AF2_K562_rep02_2889 +UCAGAGUUAUCAGGUCUCUUUUGCCCCUACAGGUUUUUAUGUGAUAGUCAAAAGGAGCUGG +>U2AF2_K562_rep02_2905 +UUUCCCUUUUCCUUACCUAGGCUAUUAGUCCUUAUUUGCCAAGAGGUGAUCCAGUUCUGAA +>U2AF2_K562_rep02_2906 +GGAUAAAUAUAAAGAUACACAGUCUGUUUCUGCUAUAGGUAAGAUGUGGUAGUGUUGGGUG +>U2AF2_K562_rep02_2907 +AUUUGGUUUUAUUUGCAGGUCCUAAUCUACCCAUGGCUACAGUUGAUAUAAAAAAUCCAGA +>U2AF2_K562_rep02_2908 +UCUUUUUCAUUCUGCAGAUUGCAGGAAUUGACGCUGUAUAAUCCAGAACGCACUAUUACAG +>U2AF2_K562_rep02_2909 +UCCUUUUCUUUUCCUCUUUCUCCUCCUCUUUUUUCCCCUUCUUCGUCCUCUUCAUUGUUGU +>U2AF2_K562_rep02_2910 +CUACUUUUAGGAUUCCUAAGGGAUUUGUGUGAGGUCUUACUAUAUUUAUUGCUACCUCCUG +>U2AF2_K562_rep02_2912 +UUUAGAACAUUAGCAGUGUUGUGGCUGCAUUUUCCGACCUUCUUCACGUCCGAAUCCCUAA +>U2AF2_K562_rep02_2928 +UUCCCCUUAAUCACACAGCAUUGGCAUCAACAAAAGUCAGAAUUCCCGGGAACUUGAACAG +>U2AF2_K562_rep02_2929 +UUUCUUUCUAGGGGUUUAGUGGUUACUCUCCUGUUUGGAAAAACAAACUCAGAGAAGUACC +>U2AF2_K562_rep02_2930 +UCAGCUCAGGUACCUGACAAUGAUGAGCAGUUUGUACCAGACUAUCAGGCUGAAAGUUGUA +>U2AF2_K562_rep02_2931 +UGUUUUUGUCUUUGUUCCCUCAUUCCCAGGUGCUAGUGUAUGAGUUGUUGUUGGGAAAGGG +>U2AF2_K562_rep02_2932 +AGUGGGGUGCCAUUUUCUUCCUGCAGGUGCUGGGUGAAGUUCAGAAGGCUCUGAGAGGCUG +>U2AF2_K562_rep02_2933 +UUGAAUUUUCUCUUGUUCACAGGUGGAGAUACACUACGCCUUGACACACUUAUAGAAUGGU +>U2AF2_K562_rep02_2934 +UUAUUUGUACGUUGUGUUCUGGUAGUAGGGGUUUAGGAAUAUGGUUUUGAGUAAGAGACUC +>U2AF2_K562_rep02_2935 +AUGUUUAAUUUCCUUUUUCCCUGUAGCUUUUACAAAGUUGAUCACAGUAAAUGGACAAGAA +>U2AF2_K562_rep02_2936 +AUUACUUCUAGGUUGGGAGGUGGCUGGAGAUCAUAUCCAGAGUGGGGCUGGAGGUUCUGAC +>U2AF2_K562_rep02_2937 +CUUUUCCCACCCCUGCCCCUUUUCAACUUUCAGAGCACUAGACAAACUGAAUGGAUUUCAG +>U2AF2_K562_rep02_2938 +UUCUUUUCUUUUUUCUCUCAGGAACUAAACAACUUAAGCAUAUUUUAUUAAAAGAUGUGGA +>U2AF2_K562_rep02_2939 +ACCUCUUUUCCCACAGUCGGAGUCUCAGGACCAGGUCUUCCUACGCUGGAGCAGCGGGGAG +>U2AF2_K562_rep02_2940 +UUUGUUGCUUGUGUUUGUUUUUCCCCUACAGACGUAUGACCUUAGCAGACAUUGAACGGAU +>U2AF2_K562_rep02_2941 +AAUGACUUCAUUUUUCCAGGCCCCAAAUUCUCACCAGUCCGUCUCCUUCAAAAUCCAUUCC +>U2AF2_K562_rep02_2957 +UUUGUCCUAGUUUUCCUAAAAUUCCCUUUUCCACUGGUGUGUGGUGCAAGAUGAGGCACAU +>U2AF2_K562_rep02_2958 +UCCUUGUAUUUUGUGCAGGUCUGCAGACUCGUGAAUGAGGUCUACCACAUGUAUAAUCGAC +>U2AF2_K562_rep02_2959 +UUAAUUAAUGUAUUACUUUCUCCCUUAUUUUUUCCUUGGAUUCAUUUUACUAUUAUUCAUG +>U2AF2_K562_rep02_2960 +AAUCUUUAUUUCCUUUAACUCCUCAGCACUUGUUUUAACUUGCUUAUUUUCUUUAGUUUUU +>U2AF2_K562_rep02_2961 +CCUCCCCUGUGCCUUCCACAUUCUACACCCUUUACCACAGGAGAGGUCUCUGUUAGCUUGC +>U2AF2_K562_rep02_2962 +GCUGUCUUAUUUCUCCCUUCCUUUAGAAUCCCUUCUUUUUCAAAACACUAGAAACCUCCCA +>U2AF2_K562_rep02_2963 +UAGGUAGAUAAAGUGGUAAUAAAUCCAUACUUUGGUCUAGGAGCUCCAGACUACUCAAAAA +>U2AF2_K562_rep02_2964 +AACUCUCUUUUUCCACCCCCUAAGUCUCUGGCAACCACUGUUCUGUCUCUGAAUUUGAUAC +>U2AF2_K562_rep02_2965 +GUCUUUCAAUAUCUCUUCCCUGUUUGGACCACAUUACCCUUCAUCAUAUGAAGCCUUGGGU +>U2AF2_K562_rep02_2966 +UUCUCUUCGUUUUUCUCUUCCUCUAGUGAACACUGACUCGGAAACUGCAGUUGUAAAUGUA +>U2AF2_K562_rep02_2967 +UUUUUUUUCUUUACUUACAGGCAGUACUUAAUUUUCCUAAAUAUUGUGAACCCGUGGUUAA +>U2AF2_K562_rep02_2968 +UUUUGAUCCUUUGUUUCAGACUCUGCCACAACUGAAAGCUCACCAACAGCCUGCCAAUAAA +>U2AF2_K562_rep02_2969 +UCUCUCCUUUCUCUGCAGGGCACCCUCCCCCAGGAGACUUCAUUGCUCUGGGCUCAAAGGG +>U2AF2_K562_rep02_2970 +UCUAACAUUUACCAGUUUUGCUUCCCUGCUUUCUUCCUAACACUGAUGAUGAUUUUUAUUU +>U2AF2_K562_rep02_2971 +CUCUCUCCCUUCCUCCCAUAGAGACCAGUCUUGGGGAACCACCUUUGAGGUUUGUGUGGAG +>U2AF2_K562_rep02_2972 +UUAUUUCUACCCUCUUCUCUCCUCACUCCCCAGCCCCCCAACUUUACCAUCUCCUCAAGAA +>U2AF2_K562_rep02_4839 +UUCCUUCCUCUGACGCCUGCUCUUACAAUAGGCGUCCCUGCGAGAAGAGUCACCCAGUGGC +>U2AF2_K562_rep02_4840 +CCUUCCUUUCAAAUAGAUGUCUGUGGACUUUAUCCCCAGGAAUGGUCUCUUGGUUAAAGUG +>U2AF2_K562_rep02_4841 +CACUGCUUAGCUUUGCUGGUCCAUUUGUCCCUGUGUUUUCCAUUUGCAUUCAGGCCUUUGA +>U2AF2_K562_rep02_4842 +AUGGUUCACCAUCUGCCACUUCUGAAAGUGAUGGGUCUAGUACAGGCUCUCUGCCGCCGAC +>U2AF2_K562_rep02_4843 +AUGGUUCACCAUCUGCCACUUCUGAAAGUGAUGGGUCUAGUACAGGCUCUCUGCCGCCGAC +>U2AF2_K562_rep02_4844 +CCCUCCAGGUGCCUCAAUGGUCCGGCCACCAGUUGUGCCUCGGCGCCCCCCGGCCCACAUC +>U2AF2_K562_rep02_4845 +AGAUGCGAGCCACCCCUCUGGCUGCUCCUGCGGGUUCCCUGUCCAGGAAGAAGCGGUUGGA +>U2AF2_K562_rep02_4846 +UUCCUUUUCCCCUCUUCUUACCCAGAGUGAGCACAAAUGGAUCAGAUGACCCUGAAGAUGC +>U2AF2_K562_rep02_4847 +UUCCUUUUCCCCUCUUCUUACCCAGAGUGAGCACAAAUGGAUCAGAUGACCCUGAAGAUGC +>U2AF2_K562_rep02_4848 +UUUCUUCUCCUGUGACAUUAUCUAGCAUGCUUUGCAGUGGGUCCAGAGUUGUCUGGGGAUC +>U2AF2_K562_rep02_4850 +CUUUCUUUUUGCCUAGGAGCCAUAUGGGGGUGCCGUUGGUCUCUGGUCACCGACAUCCUUU +>U2AF2_K562_rep02_4851 +UUUGCAUUUCUUCCCAGGCUGCCAGCGGGACCAGGAUGGCUAUUACUGGAUCACUGGCAGG +>U2AF2_K562_rep02_4852 +UAACAUGGCAGACCAGAGACAGCGCUCACUGUCUACCUCUGGGGAGUCAUUGUACCACGUC +>U2AF2_K562_rep02_4853 +CAACUCAUUGUUUGUCCACAGGUGCUGGCUUAUUCUCAGACUCUGUAUAUUGGGAGAGAAA +>U2AF2_K562_rep02_4854 +UUGGAUUUCUUGCUUAAUCAACUCAUUGUUUGUCCACAGGUGCUGGCUUAUUCUCAGACUC +>U2AF2_K562_rep02_4855 +UUUUUCUUUCCUUCCCCACACCCCAGGGCUACCAAGAAAAGAACAAAUUCAUUGCUGCACA +>U2AF2_K562_rep02_4856 +UUCUCCUUUGCAGCAUCAUGGCCAGCCCAAGAACCAGGAAGGUUCUUAAAGAAGUCAGGGU +>U2AF2_K562_rep02_4857 +CCUGUUUUGUCUUUAGGGUGUACAACUAUGAGCCUUUGACACAGCUCAAGAAUGUCAGAGC +>U2AF2_K562_rep02_4858 +AAGAUUCUUUUCCUAUUUUCCCCAAAUCUUUUAUAGCAUCUGUCAAUGGUUCACCAUCUGC +>U2AF2_K562_rep02_4859 +AAGAUUCUUUUCCUAUUUUCCCCAAAUCUUUUAUAGCAUCUGUCAAUGGUUCACCAUCUGC +>U2AF2_K562_rep02_4860 +GAUGCUUUUUCCUCAGGUCCUGGGGACCUGGCCUCCCUCUGUCAGCAGUUUCUGACCUAAU +>U2AF2_K562_rep02_4861 +GGUCUUUCCUUGUCCAGUUCCAGGUCGCGGAGCAAAGGUCGAUCACGUUCUCGAUCAAAAG +>U2AF2_K562_rep02_4862 +UGUAGCUUGCUGAUGACCGUAUGGCACUGGUGUCAGGCAUCAGCUUAGAUCCAGAAGCAGC +>U2AF2_K562_rep02_4863 +CUGUAGCUUGCUGAUGACCGUAUGGCACUGGUGUCAGGCAUCAGCUUAGAUCCAGAAGCAG +>U2AF2_K562_rep02_4864 +GAAAACUUCCUGUUGCCUGCAGCCGCCCACGCAGAACAUGAACCUGGGCCCUGGAGCCCUG +>U2AF2_K562_rep02_4865 +UUGUCUUUCAGGAUUUUAUGCGACAAGCAGGUGAAGUAACCUAUGCGGAUGCCCACAAGGA +>U2AF2_K562_rep02_4868 +CCAGCAUCUUCGGCCUCUUGUCCGCUUUGUUUUCAGGGCCCAGGGGAAUCGCUACGUGGGG +>U2AF2_K562_rep02_4870 +CCUUUCCUUUUUCUUUUCUCCUCCCCCUUCUGUUUUGAAAAUCAGGUUGCUUUUCUGUUAC +>U2AF2_K562_rep02_4871 +UUCAAAUUCAGGUGUGCACUCUCCCAUGGCAUCUUCUGGCAAUACUGGGAACCACAGCUUU +>U2AF2_K562_rep02_4872 +CUUAAUUUUACAGGUGUGAGCCACUGCACCAGGCCCCUUCAUCUUAAUUUUAAUAUAUCUU +>U2AF2_K562_rep02_4873 +UGUGUCCUUCUGUCCACAGUCCCUGAGACGGCGGGCAACAGCAUCGGCAGGAACGCCAUGG +>U2AF2_K562_rep02_4874 +UCCCUGAUUUUCUUUUCAGACGUCUUUUUACAAGGGAAACGGUUCCACGAAGCCUUGGAAA +>U2AF2_K562_rep02_4879 +UAAGUUUUUGUUCAAGGUGACGUUACUGAGGCAGUGCUCUACUGAGAAUGAAAAUGACAUG +>U2AF2_K562_rep02_4880 +UAAGUUUUUGUUCAAGGUGACGUUACUGAGGCAGUGCUCUACUGAGAAUGAAAAUGACAUG +>U2AF2_K562_rep02_4881 +AAUUUGUGCUUUCUUUUUGCUCCCCCAGGGCCUGGUGAAAUCCCCAUGGGAAUGGGGGCUA +>U2AF2_K562_rep02_4882 +CCAGGACCUACUUGCUCAGAUCUCCAAGCAAGCAUUUCUUUUCUUUUAGGGAUGUCUGAAA +>U2AF2_K562_rep02_4883 +UCUCCUUUCCCCCCUUUCUACGCCUUUUCCCUUAGUCUUACCUGCAGUGGUGAAAAACGGA +>U2AF2_K562_rep02_4884 +UUUCUUUGCCAGAUCCCAUGAGCUGCGUUCCAAGGUGGUUUCCCUGCAGCUGCUCCUCUCU +>U2AF2_K562_rep02_4888 +UCUUGCUUUUCUCCUAGGCUUGGCACUGCUGCACCACCAAAGGCAAACUUCAUUGAAGCUG +>U2AF2_K562_rep02_4891 +UACUUUGGCCCCCUUCCCUGCUGUGGUUCUGGCCACCCCAGAGAGGUGAUCGAGAAGAAAC +>U2AF2_K562_rep02_4894 +UUUCUUUGACAAUUUUAAGCCUUGUCCUAGGUUAAGACUGAUGAACAGGAGCCAAAGAAGA +>U2AF2_K562_rep02_4895 +UGCAGCCAACAUUGGUACUCAGACCACAGGACCCAGUGGGGUAGGAUGCUGUACACCAGGC +>U2AF2_K562_rep02_4896 +CUCUUGCUUUCUUCCAAUCCAGGACUCCAUUAUUACAGUCUUUGAUUGGUCUUUUUGAGUU +>U2AF2_K562_rep02_4897 +UAGAGACUGCCUGCCUUUUCUCUCCUGGUCCCACCUCAGCUGACCCUCUGUCAGCUCGAAU +>U2AF2_K562_rep02_4904 +UUUUUAGAUAAUGAGCUUCAGUCCCCAAGAUCUGCGAAGACGUUUGUGGGUGAUUUUUCCA +>U2AF2_K562_rep02_4905 +UUUUUAGAUAAUGAGCUUCAGUCCCCAAGAUCUGCGAAGACGUUUGUGGGUGAUUUUUCCA +>U2AF2_K562_rep02_4911 +CAUCUUUUCUCUCCUGUAGUCUAAGGUUGUGGGUGACAGAGAGAACGGCAGUGACAACCUC +>U2AF2_K562_rep02_4913 +CCUUUUAGGUCCUUUUGGUGUGAACCAUGGGGUGGAACUUCACUCAGAUGUGAUAGAGUAU +>U2AF2_K562_rep02_4914 +UUUUUCAGAUAUGAGGCCCCAGGAUUCCUGGCGAGGUCCUCCUCCCCUUUUCCAGCAGCAA +>U2AF2_K562_rep02_4916 +UUAUCUCCUUAGGAAUACAAACAGAAGCUUGCACGAGUAACCCAGGUCCGCAAGGAACUGA +>U2AF2_K562_rep02_4922 +AUUUUUUCUUCCUAUAACUUUUCUUCUCUCAGGUAAACUAUCCUUUAAACUUUUGUGGAAC +>U2AF2_K562_rep02_4923 +AGUUUUGUUUCGUUUCUCCUUUUAUUCUCUGUAUUGAGCAAGUCUUAGACAUCAUACGUUU +>U2AF2_K562_rep02_4928 +GUGUGUUUUUCCUCCCCAGAAGAGGCGACAAAGGCCGUGACAGAGAUGAACGGGCGCAUCG +>U2AF2_K562_rep02_4929 +AGCUUAUUCUCUUGGGGGCCAAGAGAAUCUUGGUCUGAUCUCAGCUUCUCCACAAUCAGAU +>U2AF2_K562_rep02_4935 +UUUCAGGGUUAUUUUGGAGCUGUUGGAGCACUCCUUGAGCUGUUGAAGAUCCCGUGAUCAU +>U2AF2_K562_rep02_4936 +CCUUGUGCUUGUCCCCAGCGGCAAGCCUGCACGAGCUGUGUGCUGCCAGAGUGUCAGAGGU +>U2AF2_K562_rep02_4937 +UCUCAUAUUUCUAAUCCUCAGGGGUGGCACACACUCUGCAAGCAUGGUGCUAGGCACACGG +>U2AF2_K562_rep02_4941 +UAAAAUGUUUAAUUCCCUUGCUAGCUUGUGAGAAGAAUGAGUUGAUGACAUGCUCCAUACC +>U2AF2_K562_rep02_4942 +UUUUUAACAUAGGCAUACUGCAACCCAUGGGUUGUGUUCCCCAAGUGAAGAUUCUGUGUCU +>U2AF2_K562_rep02_4951 +UUUAUCUUUUUUGGUCCUCUGCCAGCGAACACUUGCCAAGUAUUUCAAUCCUUGCUAUGCC +>U2AF2_K562_rep02_4952 +UCCAAGGGGCAGUUGAAAGCACUUUUUUCGGAACACGAGGUAAGCUGACUUGUUCGUUGUG +>U2AF2_K562_rep02_4953 +AUUCCCUUUUUUCACAUGGCUGCCAAGAAGCUCAGGUUUACAUUUUUUCUCUGUGACUAAG +>U2AF2_K562_rep02_4954 +UUUUGUCCUCAGAAAAGGAAAUCCUCGCUUCCAUGGCUGCCAAAAGGACAGUGUUUCUGGC +>U2AF2_K562_rep02_4965 +GUCUUCAUUUACUAUAUUAUGUAGGGUUUCUGUCCAACAAGAGUACUUGUAUAUCUUUGCU +>U2AF2_K562_rep02_4966 +GCCCCUUUCUUCUGUCCCCAGGGCCUCGGCUUCACAGGAUGGGGCUGCCAGUGUCCUGGGC +>U2AF2_K562_rep02_4967 +GCCCCUUUCUUCUGUCCCCAGGGCCUCGGCUUCACAGGAUGGGGCUGCCAGUGUCCUGGGC +>U2AF2_K562_rep02_4973 +CCUAAUGUGUUUUUUCUUCCUUCCUUACCAGAUGAAAUUAAAGCAGAAAUAGAAAAGCAGA +>U2AF2_K562_rep02_4974 +GCUUCGCUAUUCUUGCAGGUGGAUGGGCAGGUGGUAGCACUGCUGGUACAGAAUCUGGAGC +>U2AF2_K562_rep02_4975 +UGUGUGACUUCGUCCCUUAGGAGCUCAGCCUGAGGAAGAAAGGCCUGGAGUGCCUCGUGUC +>U2AF2_K562_rep02_4976 +GUCCCCCCUUUCCUGUGGCAGGGCCGGAUCGUGGCACCCAGAGGCUGCCAGGACUUUGGCU +>U2AF2_K562_rep02_6000 +UUCCAUUGUUUUUUUUAGAUUCUCUCGGGCCUAGCCGUCCUUGGAACCCGAUAUUCGGGCU +>U2AF2_K562_rep02_6001 +CUCGGGCCUAGCCGUCCUUGGAACCCGAUAUUCGGGCUGGGCGGUUCCGCGGCCUGGGCCU +>U2AF2_K562_rep02_6002 +CCGCGGCCUGGGCCUAGGGGCUUAACAGUAGCAACAGAAGCGGCGGCGGCGGCAGCAGCAG +>U2AF2_K562_rep02_6003 +CCGUCCUUGGAACCCGAUAUUCGGGCUGGGCGGUUCCGCGGCCUGGGCCUAGGGGCUUAAC +>U2AF2_K562_rep02_6004 +UAUUCCUGUUCCCUUUACCCUUUGACAACUUGAAAUGUUACCACUUCGUCCUCAUGAUGUU +>U2AF2_K562_rep02_6005 +UUCAGCUUUAGCUGCAGCUGCCUCUGUUCAGCCACUUGCAACACAAUGUUUCCAACUCUCU +>U2AF2_K562_rep02_6006 +UAGCACCCCAGAUACUCGCCCAGCUGGUCUGGAAGAGGCUGAUCAGCCACCGUUGCCUGGA +>U2AF2_K562_rep02_6007 +GUUCCUCCCUCUUUUUUCCUAUGAAAGUUGACUAUAUAAUUAUUAAGCCAUUACCAGGAUA +>U2AF2_K562_rep02_6008 +CCCCCUUCUUGAGUGUUCCCCAUCGGUUUGUCCCCAGGGCUGCGCUGGCCUCGGCACACCA +>U2AF2_K562_rep02_6009 +CAUCGGUUUGUCCCCAGGGCUGCGCUGGCCUCGGCACACCAGUGCCACCCGCUGCCCCGGA +>U2AF2_K562_rep02_6010 +CCUUUUCUUGGCAGGCCCCUCGGGAGGCAUUGGCACAGACCGUGCUCGCAGAAGUGCCCAC +>U2AF2_K562_rep02_6011 +UUUUCUUCCCCCACAGUUCAUCCAUGAGCUCGGAUUUCCCACAUUACAACUUCAGGAUGCC +>U2AF2_K562_rep02_6012 +UCUCUUCUUCCCUUCUUUCUGGUUGGUGCUGCUGGGCCAGGUGGGAAUUUCUGAUUAAAUC +>U2AF2_K562_rep02_6013 +UCUAAUGCACUGUUUUAUCCUUAGCUUUGUUUGUUAUUAUGUUUUGGAAUGAAAUUUGGUC +>U2AF2_K562_rep02_6014 +UCUAGAAAGCGAAAUUAUUAUUGACGAUGGACAAUUUGGAAUCCACAGUAAGUGAGACUGA +>U2AF2_K562_rep02_6015 +UUUCUUUUAGGAGCUUACUCCACGGGAACAGCCUCUAGAUAAUCUGAGUUGUUGAAAAUAC +>U2AF2_K562_rep02_6016 +UGCGCUGGCCUCGGCACACCAGUGCCACCCGCUGCCCCGGACGCUGAGCGUCCUGAAGAGC +>U2AF2_K562_rep02_6017 +CCAUCACCCGCCUCUGUUUUCUCCCCAAGCUGAGGCAACUUCUCCUAGAAUCUCAAUCUCA +>U2AF2_K562_rep02_6018 +AGGCUAACUCCUUUCUGACCCGUUCAUCCCACAGGCCCUGGAUUAUUGUCACAGCAUGGGA +>U2AF2_K562_rep02_6019 +UCAUCCCACAGGCCCUGGAUUAUUGUCACAGCAUGGGAAUUAUGCACAGAGAUGUCAAGCC +>U2AF2_K562_rep02_6021 +UUUGUUUGCCUUGUUGUAGGUGGACCCAAGAGCCAUAUCAGUGCUAGCAAAAUGGCAGAAU +>U2AF2_K562_rep02_6022 +UUUGUUUGCCUUGUUGUAGGUGGACCCAAGAGCCAUAUCAGUGCUAGCAAAAUGGCAGAAU +>U2AF2_K562_rep02_6024 +CUCUGUUUUCACUCUCAGGCUCUGGUAAGUAUUCGUAUUCUCUUCAUCCCAGUCUGAUUGC +>U2AF2_K562_rep02_6025 +CAAAUCAUCCUACUCCCAAAUAGGCACCCACUCACUACCUUGGCGUCGUUUUUUGGGUCUG +>U2AF2_K562_rep02_6026 +UUUUUCUUCUCAGGAGGAAAAAAAGCAAGAGCAGAAGUCGUAGUCAUGAACGAAAGAGAAG +>U2AF2_K562_rep02_6027 +CUUCCCUGUUACCCCCAGAGCAGAUGCCCUCAUGUGUUCUGCGUAGAUCCCCAGCUGAGAA +>U2AF2_K562_rep02_6028 +AGCUUUCCUUCCAGGUGGGAGCAGCCUGCAUCCUGGAACUGCCAUCCCAGGGUAGGUCUGC +>U2AF2_K562_rep02_6033 +GUAUUUUAUUUUGCUAGGUGAGGCCCUGGUGACCACGUGAGAAAUGAUACCUGUCUAACCA +>U2AF2_K562_rep02_6035 +UUCUAUUUUUUUUUUCCCCCAAGCAGAGACCUAGAUGAAAUCGAAUUACCAAGCAUUCUUU +>U2AF2_K562_rep02_6037 +ACUAAAUUUUCUAUUUUCCUUAAAUUCUAGAAAGCGAAAUUAUUAUUGACGAUGGACAAUU +>U2AF2_K562_rep02_6039 +UCUCUAGCCCUAACCGGCAGCCAUUUGUUCUCUUUGGUAAUCACUCCACACGAGAAAACCU +>U2AF2_K562_rep02_6040 +ACUUCCUGGGACCUGGAGUGGGCCUCCUGACCUGGGGCUCGCUGGGAAGGGAGGGUUCCCC +>U2AF2_K562_rep02_6046 +AGUCAUCCCACAGGCCUCGCGGACGAAGGGGUGCCUGAAGCUGUGGAGAGGGUGCACAGGG +>U2AF2_K562_rep02_6047 +CUGAUUGCAUAGCCACACUGCCCGGCACGCCACAUCCACCCCUGUCUGCACAUGAGUUGUU +>U2AF2_K562_rep02_6049 +UUGUUUUCUUAAUUCCAGACUUUCUGUUCCAGAUCUCACUCCAAACAUUGGUCUUUUCUGG +>U2AF2_K562_rep02_6052 +ACUUCAGCAUUCCUUGAAGAAAAGAGGAACCCGCUCCCUGGGGAAGGCCGAUAAGAAGACU +>U2AF2_K562_rep02_6053 +UGUUUUUGUUCUUUUCCCCUAGUCACGAACCCCCGCCUUGGUUUUUGAACACGUAAACAAC +>U2AF2_K562_rep02_6054 +CAGGCUUAUCCCGUCCUGGGGCCCCAGUCCUCGGCCCUGUGAGCCUCACUUCCUCUAGGUC +>U2AF2_K562_rep02_6057 +GUCAUUUUGUUCAUAGGUUUCUAGACCAACUGGGGAGAUUCCCGUUAAAAAGUAUGUAUAC +>U2AF2_K562_rep02_6058 +CUCACAGCUGUCAGCUUCCCCUGGGUCAGGCCAGGGCCUCCUCAUGGCUCUGGGGUGGUUG +>U2AF2_K562_rep02_6059 +UCCCUCCUUCCUUCAUCAGUGUCCCCCAGAGCUCUGGACCUAACAGGUACUCAAUAUGUGC +>U2AF2_K562_rep02_6060 +UUUUCUUUUUACAGGAACGGCAGAGUCGAAACAAACAAUGAGGGCGAACCAGUUUCUUACA +>U2AF2_K562_rep02_6063 +UUUAACUCGUUCAGCAAAGCCUGUGCGGAGCGAGCCAGAGCUACCUGUGGAAGGGACCUCA +>U2AF2_K562_rep02_6064 +CCUCUGCCCUUCCUACACUGUCAAACUAGGUUUACCAUCUGAUUUUCAUACUGCUGACUUU +>U2AF2_K562_rep02_6067 +CCUUCUGUGCUGCCUCCCACCAGGUGCACCCCAGACAUGGAUGUCAUCCUCAACAUUCCUG +>U2AF2_K562_rep02_6074 +CUGUCAGUUUUCUCCCAUGAUCAGGGCUGAGCAGUACCAGUUCCGAAGGAAACAUCAUAGG +>U2AF2_K562_rep02_6075 +UAAUACUUUCUUACAGAGAAGAAGAAGUUGGAUGGGAUACCGAGAUUAAGGAUGAUGUGAU +>U2AF2_K562_rep02_6076 +GGAGAACAUGCCUGUAUUAAGGGCCGAGGUGGAAGAGCUCCAAGCCCAGACCCGGGAACCC +>U2AF2_K562_rep02_6080 +CUGCUUUCUCCCCUAUCCCCUGUCUCUACCCCCAGGCACAUGGCCACCCACUCAGCCCAGA +>U2AF2_K562_rep02_6081 +GGGUGUCUUCCAACCUUUUCUUUGUAGAACACAACUUUCCUGAACAGGAAAUCCAAGAGGG +>U2AF2_K562_rep02_6082 +UUUAUUUUGUGACUACGCCACAUGCUGGGUUUUCUUUUUGAAUUUAGGCAUAAAUGAAAUC +>U2AF2_K562_rep02_6085 +UUUUUCUGACAUCCAGGUAGCCCAGUGUGUCUCACCAAAGGGACCUCUUGCUUGUUCGAGA +>U2AF2_K562_rep02_6087 +UUAUACAAGCAAGAGCAACAGCUCUAUAUCUGGAUCACUGCAGUGCCUAGAAGAUACAACA +>U2AF2_K562_rep02_6090 +GACUCUUCUUCUUCCCAGGCUCAGGCCCGAUGUCACCGCAUAGGCCAGAGCAAAGCUGUGA +>U2AF2_K562_rep02_6098 +CUCCUCCCUUCACUUCACCAGGGGCGACCUGACGGAAGAUAACAUGGAGACAGAAAAUGCA +>U2AF2_K562_rep02_6099 +AUUUUGCUUUCUCUUUCACUAGGAUGGAAUGUGGGAUGGUAACUUAUCAACAUAUUUUGAC +>U2AF2_K562_rep02_6105 +UGCAGGUUAUUGAGGUGGUGAUCCGCUCAGAAGAGGGGCUCUCAAGGGACAUGGUGAAACA +>U2AF2_K562_rep02_6106 +UCUUGUUUUUUUUUCCGUUUGACAGAAACUGAUAAAGCUGACUUGAGUGGUAUUUAAAUAU +>U2AF2_K562_rep02_6107 +UUUUUUUUCCUUGCCUUAGCCCCGUCGCAGAAUUUAGUCUCAAAGGAAACUUCAACCACAG +>U2AF2_K562_rep02_6108 +CGCUCAACUGUUGGCCCCACAGGGACAAGGAGACCAGUCGCGACGAGUUCAUCUUCUACUC +>U2AF2_K562_rep02_6109 +AGCCCCAGGAAGCCUUGGUCGGGGGCAGGAGGGAGGGUCAGGCAGGGCUGGGGGCCUGAC +>U2AF2_K562_rep02_6110 +CAGCCCCAGGAAGCCUUGGUCGGGGGCAGGAGGGAGGGUCAGGCAGGGCUGGGGGCCUGAC +>U2AF2_K562_rep02_6117 +CCCUGAUUUUUCUGUACCUUGGCUACCACAGGUUCUGCUGAAUGUCCUGACCUUGAACCGG +>U2AF2_K562_rep02_6118 +AUGUUUUUGCCCUCUGUUGCAGUUGCAGGAUGUGAGUUUGAAUCUAUGGAAUGUCUACAGC +>U2AF2_K562_rep02_6119 +CUUUUAGGACUUGGCAGCAUUAGGCUGGUGCUCAGACGAAGAGGAGAAGAUCUUCAGGAAG +>U2AF2_K562_rep02_6120 +UUUAAACUCUCCUUAUCUUCCCCCCCACUUUCUUCCUCACAAAAAGAAUCUUACAGCUGCU +>U2AF2_K562_rep02_6879 +UCUCCUUCUUUCUUCCAGGGGCCGGGCUAGAGCGACAUCAUGGUAUUCCCCUUACUAAAAA +>U2AF2_K562_rep02_6880 +UCUCCUUCUUUCUUCCAGGGGCCGGGCUAGAGCGACAUCAUGGUAUUCCCCUUACUAAAAA +>U2AF2_K562_rep02_6881 +GGCCCAGGGAGUGGGGCAGGGGGCUGCUUAUUCACUCUGGGGAUUCGCCAUGGACACGUCU +>U2AF2_K562_rep02_6882 +AACUGCUGAGGAGGGACCUGCUUUGGGGAGUAGGGGAAGGCCCAGGGAGUGGGGCAGGGGG +>U2AF2_K562_rep02_6883 +CUUUGCAGGUUUCUGUAGCCGGAAGAUCUCCGUUCCGCUCCCAGCGGCUCCAGUGUAAAUU +>U2AF2_K562_rep02_6886 +GGAAGGGGGGAGAAUCCCAUAACUAACUGCUGAGGAGGGACCUGCUUUGGGGAGUAGGGGA +>U2AF2_K562_rep02_6887 +CAACAGGCCACAACAUCUAUUCCAAUAUAUUAGGUUUCCUCGGUGGUGUUUCCUGGGCUAU +>U2AF2_K562_rep02_6888 +UCUUGGCCUCAGGCUCCUGUUCUGGAUGUCAGAUAUGCAUCUGCCUCCUGAGAAACUGGUG +>U2AF2_K562_rep02_6889 +UUUUCUUUCAGAGCUGUUGCGCAGCCAUUGGUACCUGUAUUGGGGAAACAUAGCAUACAAG +>U2AF2_K562_rep02_6890 +CUGCAUAUUUUCCCCUUUUGUGAACAGGUACUGGUGGAGAAUGGAACAAAAGCUGGGCACA +>U2AF2_K562_rep02_6891 +UUUUUUUUUCCCCUCAGGUGGCGACAUGUCUAAGAAUGUGAGCCAGUCACAGAUGGCAAAA +>U2AF2_K562_rep02_6892 +GUCAAGAAGCAGGUCUCGAUCCCGGACCAGAAGUUCCUCUAGGUCUCGUAGCCGAUCCCGU +>U2AF2_K562_rep02_6893 +UUUUUUCCUCUCUUUUGACCUCCCCAGACCGAGUGACGGUUCUCUACAGGAGCAAAGCCAU +>U2AF2_K562_rep02_6894 +CAGCGGCUCCAGUGUAAAUUCCCCUUCCCCCUGGGGAAAUGCACUACCUUGUUUUGGGGGG +>U2AF2_K562_rep02_6895 +CAGCUACCAUUCAUUUCCUGAUUUCAUUUAUAGGUCUUACCAGGCAAGAAGGCCAAGCAGA +>U2AF2_K562_rep02_6896 +UGAUGUUAAACCUGGGGGGAUUUUUGUGUGUUCUUUCCCUUUUUCUUUCAGAGCUGUUGCG +>U2AF2_K562_rep02_6897 +GCCUUUUUUCCCUUUUAUUUGGAGGGAAUGGGAGGAAGUGGGAACAGGGAGGUGGGAGGUG +>U2AF2_K562_rep02_6898 +CCUUCACAGUAACUGGGGCAGGGGCCUACGGGGAGGGGCUUGUACUGAACUAUCUAGUGAU +>U2AF2_K562_rep02_6899 +CCUUCACAGUAACUGGGGCAGGGGCCUACGGGGAGGGGCUUGUACUGAACUAUCUAGUGAU +>U2AF2_K562_rep02_6900 +UUCUCCCAAGCCAAACUGGCAAGACGCAGUCAAGAACGGGACAAUCUUGGCAUGUUGGUCU +>U2AF2_K562_rep02_6901 +UUUUAAAAAAAAGAUAUACUGUGGAAGGGGGGAGAAUCCCAUAACUAACUGCUGAGGAGGG +>U2AF2_K562_rep02_6902 +AUUUGGAGGGAAUGGGAGGAAGUGGGAACAGGGAGGUGGGAGGUGGAUUUUGUUUAUUUUU +>U2AF2_K562_rep02_6903 +UUCUCUUAGCUGGAUGCUAGUGAUUCCAGUUCUAGCAGCAAUCUUUCACUUGCUAAGGUUA +>U2AF2_K562_rep02_6904 +CUCCUCCUUCAUCCUUAGUUCCAAACUGCUUAUCACUUCCCUGUUCCAUAGGCCACUUAGG +>U2AF2_K562_rep02_6905 +ACAAAAGCUGGGCACAGCCUUCUCAUGGAUGCCAGGGAUCUGGUCCUUAAGGUAAGGCUUC +>U2AF2_K562_rep02_6906 +UUCUUUAAUUAGGCUCACGAGGCCCAGGGAAUCCUCUGGACCAUCAGAUUACCAAUGAAAG +>U2AF2_K562_rep02_6907 +UUCUUUAAUUAGGCUCACGAGGCCCAGGGAAUCCUCUGGACCAUCAGAUUACCAAUGAAAG +>U2AF2_K562_rep02_6908 +ACCUCUUUUCCCCUAUGCAGCAGGAACUCCAGAAGAUAAAAUGAGGUUGUUUCUUAUCUAU +>U2AF2_K562_rep02_6909 +UUUUUUUUUUUAACCAGCAGGAGAGCAAAGGGAGAAAGCUCUAGGCUAAAGGCCAGAAGAC +>U2AF2_K562_rep02_6910 +UCUUCUUAGGUUUAUCGGCGGGGGCUUCAGGCAAUACCUCUUAGUGUUGACCUUUGGAUAC +>U2AF2_K562_rep02_6911 +UCCUUCUCCAUGGACGGUGCGGAGGCCUGGGCCAGGGCUGACUCCCUUCAGGAGUGGAGGC +>U2AF2_K562_rep02_6912 +UUCCACCCCACUUCUUUUGGCAGCUAGGUGCUGAGACAGGUGUGCAAAGUUCUGACCUUCA +>U2AF2_K562_rep02_6913 +CAGACCGAGUGACGGUUCUCUACAGGAGCAAAGCCAUUCGCUAUACCUGGCCUUGUCCAUU +>U2AF2_K562_rep02_6914 +GAGACUGAUGUUGACACACUUUUUUUCCAUUUGGCAGGAAUGGGAGUACAGUGCCAUUAGG +>U2AF2_K562_rep02_6915 +CAUUUGGCAGGAAUGGGAGUACAGUGCCAUUAGGACCAGCAAGUGACACAGGAAUUCUGAA +>U2AF2_K562_rep02_6916 +UCUUUUUUUAGGAAAAUGUCUGAUGAAUUUUCGGUAAGUUGAUCAGUUUAUCUGUGAUAAG +>U2AF2_K562_rep02_6917 +AAACUUCCUUUUGGCAGAUGUGGCCUCAUGGAUGAGCUGGUACACGACUUAGCCUCAGCCU +>U2AF2_K562_rep02_6918 +CCCUUUUCUUCCUUCAGCAGAGGCCAGGCUAUGGAGCAGGGCCACUGAAUUUGCUGUAAUC +>U2AF2_K562_rep02_6920 +AGUUAUGUUUCACUCUAGGGAACAAGUCCUGAAGAACCCUCAAGCCCUAAAGUACCACCUC +>U2AF2_K562_rep02_6921 +GUAAAAAAUUAUUUUUUCCUGAUAGCUGGCCCGGUGAUCAUGUCCAUUGAGGAGAAGAUGG +>U2AF2_K562_rep02_6922 +GUAAAAAAUUAUUUUUUCCUGAUAGCUGGCCCGGUGAUCAUGUCCAUUGAGGAGAAGAUGG +>U2AF2_K562_rep02_6923 +AUUCUCUCUUUCCCCUUAUUUCAGGUCAGAAGAGGCCAAGUGAUGGAAAUAGUGGAUUAAU +>U2AF2_K562_rep02_6924 +UUUGCCUUCUAGGAUUCUUACAGAAGCAGAGAUUGAUGCUCACCUUGUUGCUCUAGCAGAG +>U2AF2_K562_rep02_6925 +UUUGCCUUCUAGGAUUCUUACAGAAGCAGAGAUUGAUGCUCACCUUGUUGCUCUAGCAGAG +>U2AF2_K562_rep02_6926 +UUUUUCUUCCGUGUCCUCUCCUCUCCCGCAGUGAAGUUAUUCGAAGUCAUUGAAACUGAAA +>U2AF2_K562_rep02_6927 +ACGUUUUUUUCAGGAUGGCACUGGAUCUUUAAAACGCAGUGGUUCCUUUAGCAAACUCCGG +>U2AF2_K562_rep02_6929 +ACUCCCCCUUUCUUCCAUCCCUCAUCCAUUCCUUUAGGUAACUACUAUCCUGAAGUUGAGA +>U2AF2_K562_rep02_6930 +UUUUCACCCUUCCUGUGUUCUUGGUGGGGUUUCCCCGACCUAUUCAGAGUUGGCCAGGAGC +>U2AF2_K562_rep02_6933 +CUCUUUGUUGGCAGGUGCGUUAAACCUCUACAGUUUGUCAAGCUUUGCAGUGCAAGCCUCU +>U2AF2_K562_rep02_6934 +UUUUGUCUUGAUGUUUUCCCUCUAGGCUGAAAAUCUAUUGUUAGAUGCCGAUAUGAACAUU +>U2AF2_K562_rep02_6936 +UCCUUCUAUUUCUGCCCUAUUUUUUUCCAGGAAGAAAAAAUGCUGGGCAUCUUGGUGCAGC +>U2AF2_K562_rep02_6939 +CACAGUGUCCCCAUGAACUCCCUUGUCCCCAGUUGACCAACCUGGCCUGUAGCUUCUCACA +>U2AF2_K562_rep02_6940 +CUUAGAAUGGUCCUUCUCUUUUGCCCCUACCUAGUCUUUUAUCACGAGUCAUGAAUACAGG +>U2AF2_K562_rep02_6942 +UGCCCCUACCUAGUCUUUUAUCACGAGUCAUGAAUACAGGAUCACAGUUUGUGAUGGAAGG +>U2AF2_K562_rep02_6945 +GCACUUUGUACUUAGAAUGGUCCUUCUCUUUUGCCCCUACCUAGUCUUUUAUCACGAGUCA +>U2AF2_K562_rep02_6955 +GUCAUGUUCCUUGUCUUGGUCCUCAGGUGCAGUUUGAUGUAGUAGUGUCAGCUUUUUCCUU +>U2AF2_K562_rep02_6960 +UAUUUUCUAUGACAGGCUGGGCGGGGAGCGUCGGACCAGAAGAGAAUCACGCCAGGAAAGC +>U2AF2_K562_rep02_6961 +UUUGCCAUCUUAGGGCUGCUCACAGUAUUUGGGGCCAGAGCCUACGUGAAUAUAUGUGUGU +>U2AF2_K562_rep02_6962 +AUUUAUUUCUAUUUUUAGUGGGAAGAUCCUGGCUGUAAGGAUGAAUAAUGUUAAGUUUAAA +>U2AF2_K562_rep02_6963 +UAUUUUAAUUUUAGGUUCUAUUUUGUGGGUGAUGAAGAUUUGCUUGAAAUCAUUGGAAACA +>U2AF2_K562_rep02_6964 +UUCUUUUUAGGACUCCUUCUCCCUCUAUGAUUGCUCUUACACAGCUACUGACAUUUAUACU +>U2AF2_K562_rep02_6966 +UCUUUUCCCCCUUCCCCAUCCUCUUUGUCUCACAGGAACAACUUGAUACAGAGACAAGUAC +>U2AF2_K562_rep02_6967 +UCUUAAGUUUUAAGCAGGGUCUGAAAACCCUUGGUGUUUUGGAGAAAAUUCAGGCUUAUCC +>U2AF2_K562_rep02_6968 +UACGGCUCUGUGUUUGUCCCUCAGACAAGUUGGAUGGCUUGAGGACUGGUACUAAAAGGAA +>U2AF2_K562_rep02_6969 +UUUUCUUCAGCUCCCAUUGCUAUCACAUGUUUUACCAGAGGCUUGGACAUCAGGAAAGAGA +>U2AF2_K562_rep02_6970 +UUCCAUUUAAACAGGGUUAAUUUGGAAGAAUCUUCAGGAGUGGAAAACUCUCCAGCUGGUG +>U2AF2_K562_rep02_6971 +UCCUGUUAUUCUCUCCCUCUCUUUAGUUUCUGGUUACCAUCAGCUGGGAAAAGAGAACGAA +>U2AF2_K562_rep02_6978 +UCUCUCCUUCCCUCCUGUGAACGUCUGUGUCAGGCAGUGUGUUAGUCACUGAGGUUUUGCU +>U2AF2_K562_rep02_6986 +UUUUAAGGUAUGAUGAGUGGGUGAAGGCUGACAGGAUAAUCUGGCCUUUGGACAAAGGUGG +>U2AF2_K562_rep02_6987 +UAACUGACCUUGUCUACAGAACUAGACAGUACGGAUGGUGCCAAAGUUUUUAGUAAACAAC +>U2AF2_K562_rep02_6988 +UCUUAUUUCCACAGGCAUUCGUUUUGCUCAUCUUUGGAAUUUUGGUUGGGAAUUUUAGUUU +>U2AF2_K562_rep02_6989 +AAUCUCUUUGUACCUGCAGGCCGCAUUGACAGGAAGAUUGAGUUCCCCCUGCCUGAUGAAA +>U2AF2_K562_rep02_7000 +UUCAUAUUUGUCUUCAGUUACAGGUUUAUGAUAAUGGAUCGCUUUGGGAGUGACCUUCAGA +>U2AF2_K562_rep02_7001 +CUGUUUGUCUUUCCAGGCUUGUUUUGCAGAGGGAGAAGCACUUCCAUUAUCUGAAAAGAGG +>U2AF2_K562_rep02_7002 +CUGUUUGUCUUUCCAGGCUUGUUUUGCAGAGGGAGAAGCACUUCCAUUAUCUGAAAAGAGG +>U2AF2_K562_rep02_7003 +UUUCCAGGUGGUUCGCUUUGAGGUGGUCUGAAGCCAAGGCCUCGCGGAGCUUCUUUGUGUG +>U2AF2_K562_rep02_7004 +UGAUUUCUUGCCCGUCCCCUCCCUCCUUCCUGCUGCGACUGUGGGACUGUGGCCCAGGUGU +>U2AF2_K562_rep02_7005 +ACUGUUAUUUUACAGGCUUUCUUGGCUACACAAGUAGUUUAUCAUUUUUCUUUAUGAUGUU +>U2AF2_K562_rep02_7008 +CCACUCCCAUCUUGCAGGUGCAGGAGCUCCAGUCUCUAGGCUUUGGGCCUGAGGAGGGGUC +>U2AF2_K562_rep02_7009 +CACUCCCAUCUUGCAGGUGCAGGAGCUCCAGUCUCUAGGCUUUGGGCCUGAGGAGGGGUCU +>U2AF2_K562_rep02_7010 +UUAGGUCUUGCUAUCACAGAUGAAAUUUUGCUGAGUAAGGCAGAGUGGUCCAAACUUUUUG +>U2AF2_K562_rep02_7011 +CUUUCUCCCCAGGAACGACUGAAGCUGGUGACUGUUUUGGGUGCUGGCCUUCUCUGUGGAA +>U2AF2_K562_rep02_7012 +UUUUUUUUUUUUAGAUUACAGGUCCACCAGGUUGUGGAAAAACUCAGUUUUGUAUAAUGAU +>U2AF2_K562_rep02_7013 +CUUUUCUUUGCAGAAAAAGAAAGAAGAGGGUGUUAUUGAUUCAUCUGACAAAGAAAUCGUU +>U2AF2_K562_rep02_7014 +GUAGCUCUGUUUUCAUAAACAGGAAGAAGAGGAGGAUGAUGACUGGGGAGAAGAUACAACU +>U2AF2_K562_rep02_7015 +UCCAUAACAUUCCCUUUUUAGCCUCAAGAACUUGCUGCUUUUUCUGGAAGAAAUAAUUCAU +>U2AF2_K562_rep02_7016 +UCUUAUGUUUUCCUUCCCAGGAGUGGACCUACCCUAUGAGACGAGAGAUGCAGGUAUGGCA +>U2AF2_K562_rep02_7017 +UACUUUUUCACUGUUAGCUUGUGUUUUCUGUCGAAAACAUGAUGACUGUCCUAAUAAAUAC +>U2AF2_K562_rep02_7018 +GCCAAUUUGCUUUAUCCUUCUCUUCAUAGGUUUCUUCUGAAAUGUUUUGCUAGUAAGUUGC +>U2AF2_K562_rep02_7019 +AUUCUCCCACCCCCCAAACGUUUUCUGCUUUUUUUAGCUCAGCCUCUUUAACCUUGAUGGA +>U2AF2_K562_rep02_7020 +UUUUUGUUUUUUUUUAUGAUGUGGGUUAGGGAUAGAACUUCAUUUUCUUUUAAAUUUAUUU +>U2AF2_K562_rep02_8478 +CCCCUUUUUCUUCUUCAUACAGAGCUCGCUGCCCAAAUCAUUCAAGAGGAAGAUCUCCGUU +>U2AF2_K562_rep02_8479 +CGCUGCCCAAAUCAUUCAAGAGGAAGAUCUCCGUUGUCUGUAAGUCCAGCCCCAAAUCCCU +>U2AF2_K562_rep02_8481 +UUUUUUAGGUACCAGCAUCAAGAUGAUUUAUGGUAAUAAGGUACUCAGUCUUUGCUUAAAA +>U2AF2_K562_rep02_8482 +UUUUUUUAGGUACCAGCAUCAAGAUGAUUUAUGGUAAUAAGGUACUCAGUCUUUGCUUAAA +>U2AF2_K562_rep02_8483 +CCUUUCAUUUUCUACGACCGCGAGGACUACGGGAUCAUGAAAAUGAAGAUCGUGAUGCUCA +>U2AF2_K562_rep02_8484 +UGCUAGAUUUCUAACGACCCAAGUCCAGGAUACAACAUUGAACAGAUGGCAAAGCGGUAAG +>U2AF2_K562_rep02_8486 +UUCAAGAGGAAGAUCUCCGUUGUCUGUAAGUCCAGCCCCAAAUCCCUGAUAAAAGUCAGGA +>U2AF2_K562_rep02_8487 +UGUGGGGUGUCUCUCUUUCUCUUUUUUUUCCCCUUUUUCUUCUUCAUACAGAGCUCGCUGC +>U2AF2_K562_rep02_8488 +UCUAGCAUUUGCUUUCCCUUCUAGGUCUCCUUAACAGCAGCAGCAGUGUUUUAAGGUAGAU +>U2AF2_K562_rep02_8489 +AUCUUUAUUCCCUUCUUUCCUCUUCCAGCUGAGCAGAGUUGGAUAAUUGAAUUAGUCAUUC +>U2AF2_K562_rep02_8490 +GCCUUUUUCUGGUGUGUGUUGCGGGGGUGGGGGCCGGUGAAAGUGAUUUGAUGUGCAGAAU +>U2AF2_K562_rep02_8491 +UAUAAUCCCUUUAGUCCUCUUUUUUUCAGUUUUUAUGAAGAACAGUUUGUCAGCAUCUUCA +>U2AF2_K562_rep02_8492 +UCUUCCCAUUCUCUUUCUAGGAUCUUCUGAGGUCGGAGCUUCCAGAUUCAAUUGAAAGUGC +>U2AF2_K562_rep02_8493 +UUUUUUCCUUCGCACAGGUCCUCUGGUGAUGUUCUUGAGACGUUCAAUUUCUUAGAAAAUG +>U2AF2_K562_rep02_8494 +UCCUUCUUCCCCGUAAAACUUUGUCCAAGUACCUCAUGUACGGUAAUCCGCCCGUAAAAUA +>U2AF2_K562_rep02_8495 +CUUCCAUUCCCUCCUUCCUUAUUUUUUUCUUCUGCUAGAUUUCUAACGACCCAAGUCCAGG +>U2AF2_K562_rep02_8496 +UUCUGCUUUUCUUAUCAGCACUGUUCUGCAGGCAAAGUCAUGGCAAUUUCCUUAAAGUUAU +>U2AF2_K562_rep02_8497 +AGACCAUGGUUGGUCUGCUUCCCUCACUCGGGCUCCUUGACAGUCUUCUAGAAGAGAGAAG +>U2AF2_K562_rep02_8499 +AACCCAACCUCAGGUCCAGAUACUUCGUCUGCUUCGGAUCCUGGGCCGGAACCACGAGGAG +>U2AF2_K562_rep02_8501 +CUAUUGGGGCGGGUGGGCAGGAAUGGACCUAGGGGAAAGAGUAGAGCACUCUAGUGAUCCC +>U2AF2_K562_rep02_8503 +UUUUCCCCCACCAUUAGAUAUUGAAAAAGUACUUGUUUCUCUGCAGAAAGCAGAAGACUAU +>U2AF2_K562_rep02_8504 +UUUUUCCUCUCUUCCUACAAUAGCGGCCCUGUUCUGUCAUUAGCUAUUAGUUCUAAUGGAG +>U2AF2_K562_rep02_8505 +GUUUUCUUCUUUUUCCUCUUCCUCUCCCUCCCUUUUUUCUAAAAAAUUAUAGCUAAAGCCU +>U2AF2_K562_rep02_8507 +UUAUCUUCUAUUCCCUCCUCCUAGGGUCAUCACACUGAAACGGUGUUCAACCGGGUUUUGC +>U2AF2_K562_rep02_8510 +CUUUCUUUUCCUCCAUCCUGCCCCUUUUCUUCAGUAUUUCAUAGCCUUAAUUGAACAAGUU +>U2AF2_K562_rep02_8511 +CUUUCUUUUCCUCCAUCCUGCCCCUUUUCUUCAGUAUUUCAUAGCCUUAAUUGAACAAGUU +>U2AF2_K562_rep02_8512 +CCAUAGUGGACAGAGUUCACAGACCGCACUUUGGCACGUUGUCCUCACUGCAGGAAAGUGU +>U2AF2_K562_rep02_8513 +CUCUCUUAUUCCAGGAAGAGCAACCGAGGUUUCAAUCUGCGGUACGUCUCCUACUCUCCAU +>U2AF2_K562_rep02_8514 +UUUAUUUUUCCUCCCAACUUUUACUUUAGGUUCAGAAGGUAUGUGUGCAGAUUUGUUUCAU +>U2AF2_K562_rep02_8515 +UGUUUUCAGCUGCCCUAUGAUGACUGUGUGUUUGGAGGCCAGCGUCUGACGUUAUGAGCGC +>U2AF2_K562_rep02_8516 +UAUUUGAUUCUUUGACAGGCCAGCCACAUCCUGAAGAUGUACUACUGUUUGCCAUUCCAAU +>U2AF2_K562_rep02_8517 +AAAAAAUUAUAGCUAAAGCCUGGAGAAAAGCCUGUUCCAGGUAUGGUUCAUGUAAUAUUCU +>U2AF2_K562_rep02_8518 +UGGCCUCACACACCUCUGUUCCCCUCCUAGGACCAAGGGACCUGUGGAGGUGAGGAGGUGG +>U2AF2_K562_rep02_8519 +UGCCUUGCUUAAUCCCAGGAACCUGGCCACUGCUCCUUGGUCCUUGGCAUUAUGACGGGAU +>U2AF2_K562_rep02_8520 +AUUUUUCUUUUGAUUUCAGAGAACACUUUUUACAGUUGGCUAGAAGGUAAUUAGAAACUUU +>U2AF2_K562_rep02_8525 +CUUCUUCAUUCAUGUUCAUCUCUGCUAUUCCUUCUCCCUCCAGAAGGGAUGGAAACCCUAU +>U2AF2_K562_rep02_8533 +UUUAGCUUCUCCUCUUAUGGGUGCUCAGAGUUUCCCUAAUUUGACCACACCUGGUACUACA +>U2AF2_K562_rep02_8534 +AUUUUUUCCCUUCCCCUCCUAAAACAUCUCUAAAGCAGAAAAACUCAAUAUUGAUCAGGUG +>U2AF2_K562_rep02_8537 +GUUUGUUUUUUCCCCAGAGCCAAAUGUUCUAGCUGGCACUUUAGUUGGUCAUACAGAUGCA +>U2AF2_K562_rep02_8538 +UUUCUGUUACUUCCCCCCAGGAGCGAAUCCGUUUAGCUCGACAGAUUGAGAAAUCUGAGUA +>U2AF2_K562_rep02_8539 +UCUUUUAUAGCUUCAGCCCACUUGGGGAGAGUUCCUUGAUCAUCAUAAAGAACAGCCAGUA +>U2AF2_K562_rep02_8541 +UUUGUCGUUAAGGGUGAUCUGCCAGAUUGCGAAGCUGACCAACUCCUGCAGAUGAUUAGGG +>U2AF2_K562_rep02_8545 +UGUUCUUUUAUUUUGCACUAGGGAGAGGAAAUUCGAUGUCAGUAUGUUGUGACAUGUGCAG +>U2AF2_K562_rep02_8550 +GUCUUUAUAGGAUCUUUAAUGACUUGCUACUGUGGGAACCAACAGCUCCUUCACCAGUGGA +>U2AF2_K562_rep02_8552 +UUUUUUUUUCUUAGACGUUCCAUCCUCAGAGCAGCCUGAACUGUUCCUAAAGAAACUUCAG +>U2AF2_K562_rep02_8558 +UUUCUUUUUUAUAGAGGACCCACAGGCAUGAAUUAUUUACUCCUCCGGUGAUAGGUUCUCA +>U2AF2_K562_rep02_8559 +AACUGUGACUUUGCCUUCAGUGAAGGCCGCCCUCCGUUUGGGAUUUCAUUCUCGUUGUCUU +>U2AF2_K562_rep02_8560 +UUAUGUUUUAGAUGGUGAUGCCAGGAGACCCUGUAGAAAUGACAGAAUUUCAGGAUAAAGC +>U2AF2_K562_rep02_8561 +AACUACUUUGCCUCCCUUCUCUGGUCUGGUGUCGUCCUCACAUAACAUGAGGGCCUGGAGA +>U2AF2_K562_rep02_8562 +CUGCAUGGAAACCUCUUUCUCCUGCCAGGAGAGCCCUGGAACUAAGCCUGGCUCUGGUAAA +>U2AF2_K562_rep02_8563 +UUUUUUUUUCUUGGCAGGGACUCACUCUGUUGCCCAGACUGGAGUGCAGUGGCACAAAGGA +>U2AF2_K562_rep02_8564 +UUGUUUCUUCCCAGUUUUGGAAUUCAAGAACACCUAAGGAUUCCACUGAUUUGCUGAUCUG +>U2AF2_K562_rep02_8565 +CCUACUUUAUAUAAGGGCAACUUCCUGGGAGCUAAGGCUACUAAAAGGUAGAAGCCACAGU +>U2AF2_K562_rep02_8566 +CCUACUUUAUAUAAGGGCAACUUCCUGGGAGCUAAGGCUACUAAAAGGUAGAAGCCACAGU +>U2AF2_K562_rep02_8572 +UCAGCCUUUGAAGUAAAUUUUAUGGAUGAUGUAGGUCAGACUCUAUUAAACUGGGCCUCUG +>U2AF2_K562_rep02_8573 +AGUCACUGCUUUUUCUUAGGUCUCUGUGUAGAAAAAAGAGCAUUCUACAGACUUAUAUCUG +>U2AF2_K562_rep02_8574 +AAUGUCCUUUUUUCGCUCUUCCUGUGUUAACGGCUGCUUUCCUUUCAUUUUCUACGACCGC +>U2AF2_K562_rep02_8575 +UAUUUCCUAGGUUCGUUCCACCAGUCAUAAACCAGAUGAAAUCUAUGGCAUGAUUGAAAGA +>U2AF2_K562_rep02_8579 +CCCCUUCCUCCCAACUUUUUCCGCAUUUCCCCUCCAGUUUCUAUCCUUUUCCCAAGGAAGA +>U2AF2_K562_rep02_8580 +UUCUCAGCCUUUUUUAGCAAAACUUCAGUCUCCGAUUAAAGAGGAGAAUACAACUGCUGUU +>U2AF2_K562_rep02_8581 +UUCCCCUCCCUUGCAAUGUAACCCACAGGCUGAGGAAUUCCUCUACAGAUUCUUGCCACAG +>U2AF2_K562_rep02_8582 +CUAUUUCAGUUGCUAGUGAUAUCUCGCUAACAGGAGGCUCAGUAGUACAGAGAAUACGGCU +>U2AF2_K562_rep02_10076 +CAUUUCUUCGUUUAUCCCCCCAGCAGCGCUGGAGAGCGAGGUGGCUUCAAUAAGCCUGGUG +>U2AF2_K562_rep02_10077 +CUUUAAGGCAGUAUUUUGAUCCCAUAGUAGGUGGAGCAGCCCUGCACACCCCCUCCUGUAU +>U2AF2_K562_rep02_10078 +UGAAUGGGCAAGAGGGCACAUGAAGUACGGCGUCCUCCACAUUCACGGCCUCUACACGGAC +>U2AF2_K562_rep02_10079 +UUAGGUGGAUUCUUGCUCUGUCACCCAGGCUGGAGCGUAAUGGCACAAUCUUCGCUCACUU +>U2AF2_K562_rep02_10080 +UUUGCAGGUAGAAGAAGAAAGGUGCCACUCCGGCAUGAAGACAGACUCGCUUAGUCGCCAG +>U2AF2_K562_rep02_10081 +UGUGUUUCUUUUUCUUGGCUUGAUGUUUGGUAGGUCCUUGAAUGGGCAAGAGGGCACAUGA +>U2AF2_K562_rep02_10082 +CCUUUCAUUUCGUUCCCCAGGGCACCGAAGCCAAAGCACUGUCCAUGCCGGAGAAGUGGAA +>U2AF2_K562_rep02_10083 +UUAUUUCUCCUCUUAGACCGCAGGAUGGAAACAAGCCCACUGAGACUAGUCAACCUCAAUC +>U2AF2_K562_rep02_10084 +AUGAUCUUUCCUGGUUGGCAGGACCCAUGGAUGAAGGACCAGAUCUUGAUCUAGGUAAUUU +>U2AF2_K562_rep02_10085 +UCCCUUGAUGACAUGGGGCUGGCUCUGGUUUUCCAGGUGUCCCCUCGUCCCAGCCACCUCC +>U2AF2_K562_rep02_10086 +UCUCUCUCUUUCAGCUAUUCCUCUACACAGCCGACUAGUUAUGAUCAGAGCAGUUACUCUC +>U2AF2_K562_rep02_10087 +UUCCUCCUUCUCCCCUCAGACCGAAGCCAGGACAGCACAGCCGUAGCACUCUCAGACUCUA +>U2AF2_K562_rep02_10088 +UGUCUUCCUGUGCAGGUCGUGGCCGCCCACCUACAGAGCCGCUGCCCGACGGGUGGAUCAU +>U2AF2_K562_rep02_10091 +CAUCCUGUUUGUUUUUCAGAUGAUCAUGCACCCUAAGGGCACAUCUAGGCCCCCUGAGAGC +>U2AF2_K562_rep02_10092 +GUUCACAGAGAUGCUGCAAUUUGUCAGUAAUCAAGUGGGAGAGUUCCCUGACUUGUUUUCA +>U2AF2_K562_rep02_10093 +GGGCACAUCUAGGCCCCCUGAGAGCACCUCCUUUCUGUGUCUGUUCUCAGGAAUGCUGUUG +>U2AF2_K562_rep02_10094 +AGGCCCGAGCAGGUACUGACCCCUUGUCCUUCCCCACAGCCGAGCCCAGGAAGUGCGUCCC +>U2AF2_K562_rep02_10095 +CCUAGCAUCUGUCCUGCCCGAGGUGCUGCCGGUUAGCCAGCGCCCUGUUGUGCCACAGAUU +>U2AF2_K562_rep02_10096 +GUUUGGCCCAUGGGUAGGCCCUGCAUCCCUGAUCUAGCGCGUGGGGCAGCAGGUGCUGCUG +>U2AF2_K562_rep02_10097 +CAGAUGUAUUUGGGUUGGUCGUCCUCCCAUUGGAACUGAAACUACGGAUCUUCCGACUUCU +>U2AF2_K562_rep02_10099 +UUUUUAAAGUUUCCUAAUGAAAAGUUUGGCCCAUGGGUAGGCCCUGCAUCCCUGAUCUAGC +>U2AF2_K562_rep02_10103 +GUCCAUGUUUGCCACACAGGGUCGGGUGUGCUGACAGCCGGCUGUUAAGCCCUGCCUGCCC +>U2AF2_K562_rep02_10105 +UUUUUAAACAGAUCUCCCACAAACAAAUUUUCGUCGUUUACCUUUUGACCACUGCAGGUAA +>U2AF2_K562_rep02_10107 +GUGUUUAGGAAUGUUCAACGCUCCAAGCCCCAUAGGCUGAUUCAAGAAGAUAAAGUGAGAC +>U2AF2_K562_rep02_10108 +GUGUUUAGGAAUGUUCAACGCUCCAAGCCCCAUAGGCUGAUUCAAGAAGAUAAAGUGAGAC +>U2AF2_K562_rep02_10110 +CUUCUCCACCUCUUGCCUGGUCCAGCUGGAGCAGAGUGAAGCCAAGUGUGAGGAGGCCUUG +>U2AF2_K562_rep02_10114 +UUUUCCUUUAGGUAGAUGCCCAGACUGCUGGAUUGAAUGCAGAUCUACUUCGAAAAAGUCU +>U2AF2_K562_rep02_10115 +CCACCACUUCUCUCCAUCCUGCAGGCAGCUGCCAGACCCGGCCAUCGAGGACCAGGGUGGG +>U2AF2_K562_rep02_10118 +UUCCUGUUUAACUCGUGCAGGUGCAGUGGUCUGGUGUCUUUCAGUCCGCUGACGUCUUCUG +>U2AF2_K562_rep02_10119 +CUCUAAUUUUUUCCCCAGGCCGUGGAGGAGCUCCUGGAGACCCUGGAUCUGGAAAAGAAGG +>U2AF2_K562_rep02_10120 +CCUGGGGACAGCUGGAGUUCCGGGGUCCCCUGGGCAGCCUUGGGGGCUAAUGACCUGCCCU +>U2AF2_K562_rep02_10121 +UCGUUUUUUUUUGGAGCAGGCAUAUGGGCAACAAAGCUAUGGAACCUAUGGACAGCCCACU +>U2AF2_K562_rep02_10125 +CCUUUGUUGUUCUUUCAGGAGGAGACUCGAAAGAAGCCCAAGAUGUCCAUUGUGGCGUCCG +>U2AF2_K562_rep02_10126 +AUCUUCCUACCCAGAUGCACAAGUCUGGCGUUCUGAGGAAGGCCAUUGAUUACAUCAAAUA +>U2AF2_K562_rep02_10128 +GCGAUUGUUAAAUCUAUUCGUGCCCUGAGAUGUAUGGCUUUAUGCUGAAGAUUGGCUGGAU +>U2AF2_K562_rep02_10129 +CCUUUUUCCCACAGAUCAUCACAGGUGCUAAAGUUUGGCAUUUGGGAACCACAUCCUAAUU +>U2AF2_K562_rep02_10130 +UCUUUCCAGUCUUCCCCUGAAGCAGGUGAAGCAGAAGUUCCAGGCCAUGGACAUCUCCUUG +>U2AF2_K562_rep02_10131 +UAACUGUGCUUCUUCCAGAAGCUGGACGGGAGGUCCCUGAUCAAGCUGAACUUUUCCAAGA +>U2AF2_K562_rep02_10133 +GAAACAUUUCCCCUUGAUCUCCCUAGGGGCAUCUGGUCUCCAAUAAGGCUGCUAUGGAUGA +>U2AF2_K562_rep02_10137 +GCAUUUUGUGACCGACUUAUUCUUAGAUCAUUGGUUUUCCAAAGGCUUUGUGGCCAUGAAG +>U2AF2_K562_rep02_10138 +CCAUCAUUGUGUCCUUUGAUCUUCACACAGCAGGUAUCAUCUGCAUUUUAUGGAUGAGGAA +>U2AF2_K562_rep02_10139 +AUUUUCUCUUUUGAAGAUGCCUUGCCCAGUGGCAUGGAAAGAAGCCCACUUGAUGAUAGGA +>U2AF2_K562_rep02_10142 +UCACAAGGGGCUGGGGUCAGGUUUGGGCUGUUGACGCCUCGGGUCUUCCCUCCAGGUUUGG +>U2AF2_K562_rep02_10143 +GUUUUUAUCUUGCUGUACCUGUAGGGAAUGUUUAAUUCAGCCUUGGAAGUGGCCAAAUUUG +>U2AF2_K562_rep02_10144 +GUUUUUAUCUUGCUGUACCUGUAGGGAAUGUUUAAUUCAGCCUUGGAAGUGGCCAAAUUUG +>U2AF2_K562_rep02_10145 +CUCCACUGCCUUCUCUUCUUCCAGGUGGGCCAUCGUUGGACUAACAGACCAGUGGGUGCAA +>U2AF2_K562_rep02_10152 +UCUCUCCCCCAUAGAGGAGGAGCUCCGGAAGCUGCGAGAAGAAACCAACGCGGAGAUGCUG +>U2AF2_K562_rep02_10160 +UCCAGCUGCACUGGGCACAUUCCUCCCCUCACCCUGACUCACAAGGUGUUAGCAAUAAUGG +>U2AF2_K562_rep02_10161 +UCUUUCCUGUUUUUCUUAGGGUCAUAGUGUGCUGAAUUAUAUUGUUAUGAGAUAACACUAG +>U2AF2_K562_rep02_10163 +UGGGCAUUCUCUUUUUGCCACAGGACCCCACCAAUUUGGACAAGUUCAAUGUCUCUAACUU +>U2AF2_K562_rep02_10164 +CCUUGGUAUUUGUUGUAAAUUCUCCUUUCACAGCGAUUGUUAAAUCUAUUCGUGCCCUGAG +>U2AF2_K562_rep02_10165 +UGGAAAUUGCCUUAUUGGAAAAACAUUUCUUACGUGAGUACCAGAAAGCGCUUGGAGGGGA +>U2AF2_K562_rep02_10173 +ACCACAUCAGCAUCGAGGACUCGCGGGUCUACGAGCUGACCAGCAAGGCUGGGCUGUUGUC +>U2AF2_K562_rep02_10174 +UGGCUGUAGAGGGUGGGCAGCUCCUGGUGUGCUCUUAGGCAGGCCAGGUGCAGAAGGUGCC +>U2AF2_K562_rep02_10182 +CAUUCACGGCCUCUACACGGACCCCUGCGGGGUGGUGCUGGACCCAUCGGGGUAUAAAGAC +>U2AF2_K562_rep02_10183 +GCACUUCCCUUGCAGGGCUCCCUGCGGACUGCCGUGGCCGCUGGGAGAGCUUCGUGGAGGA +>U2AF2_K562_rep02_10194 +UCUCAUGAUCUUCUUACAGAUGGAGGGCCGGCGCGACAGCAUGCUAGAGACAGCCAAGCAC +>U2AF2_K562_rep02_10195 +GGUAGAAAAACUACAUAGUGGUGGCUACUGUGCAUCUCUUCCUAACUCCACAUUUGACAAC +>U2AF2_K562_rep02_10196 +GGGCCUGAGGUCGACCAGGAAAGGCCUGUGCCCCCUCCAAGGGCCCCUCUCUUCUACCCAG +>U2AF2_K562_rep02_10197 +AGGGUGACAGCUGUGUUUGCUCCCAUGACAGGAUGAAGGACAUGCGCGUGCAGACUUUCAG +>U2AF2_K562_rep02_10198 +UUCCUUCUUUUUUCCAUUGGUUUAGAUUUUUGUUCUUGGUCUUCAGUUUUAGUAUUAAAAU +>U2AF2_K562_rep02_10208 +CCUUCUUCCCUCCGGCAGAACCAGAGCUGGGGUCUGGGGCGGGCCCUGCCGGCACAGGCAC +>U2AF2_K562_rep02_10209 +CCUGUCUUUUCCCUUUCCCCCGCUGUCACCCCUGUCUCCGUCCAGCCCUUGUCCCUGUGGC +>U2AF2_K562_rep02_10210 +UUUUUAUUUUGUCUCCUCUGUUUUUGUUGCUUAUCUCCUUGUAUUUUUAUUAUUAGUUUUG +>U2AF2_K562_rep02_10211 +UUUGUUUCUCAUUUCCUCCCUUAAUGACUUCUUUUGAGGUAAACACAUACUGUUCUAAUAU +>U2AF2_K562_rep02_10212 +AGCUACACUAAAAAUCAACAAUGAGAUUAGAAGUGUGAAAAGAUUGCAGCUGCUACCAGAA +>U2AF2_K562_rep02_10213 +UCUCUCUUUUCCCUCCUCCCCACCAGAGAGGAGCUGCGGAGUCUAUUCCAGGCCCGGGCCA +>U2AF2_K562_rep02_10214 +UUCCCCCAUUCUUAAUCUUGCAGCUCCUGGAUCUCCCAGGUAUCAUUGAAGGUGCCAAGGA +>U2AF2_K562_rep02_10215 +GGGAGGGAGGCGUCGCGGAGUUUCUCUCGGCCUUUUGUGCCAUCCGCCGAGGCGCCUUGAG +>U2AF2_K562_rep02_10216 +GGGAGGGAGGCGUCGCGGAGUUUCUCUCGGCCUUUUGUGCCAUCCGCCGAGGCGCCUUGAG +>U2AF2_K562_rep02_10217 +CUUCUUUCCUUCCUUCCUUCCCUGUUUCCUUCCCUCUUUCCUUCCUUCCUCCUGGUCUGUU +>U2AF2_K562_rep02_10218 +CUGAAUACACUCACUUUUAUGGUGGCAAGAAGCCAGGUAAGGCAUGCAGUCUUUCUGUUCC +>U2AF2_K562_rep02_10219 +CUGAAUACACUCACUUUUAUGGUGGCAAGAAGCCAGGUAAGGCAUGCAGUCUUUCUGUUCC +>U2AF2_K562_rep02_11141 +CAGUCUUUUCUCUCUUUCUCCUGCAGGGCUACACCAAGUCCAUUGAUAUUUGGUCUGUAGG +>U2AF2_K562_rep02_11142 +UUUGAUUAUUACUCUCAGACGUGCGUGGCAACAAGUGACUGAGACCUAGAAAUCCAAGCGU +>U2AF2_K562_rep02_11143 +CCAGGCAAGCCGAUUUUUUCAGUUGAUAUUCACCCUGACGGGACCAAGUUCGCAACUGGAG +>U2AF2_K562_rep02_11144 +CCAGGCAAGCCGAUUUUUUCAGUUGAUAUUCACCCUGACGGGACCAAGUUCGCAACUGGAG +>U2AF2_K562_rep02_11145 +UCACCUUCUUUCCUCUUGCUGUCAUCUGCAUUCGUGCUUCCCACCUGUUGUUGGCAUGUCC +>U2AF2_K562_rep02_11147 +GUUUCCCUCUUCCUUCCGUCUUGUUUCCUAACUUCUUACCAAAGUUUAGAGUCUGAGUUUU +>U2AF2_K562_rep02_11148 +CAAACCUAGGAUGAAGCUGGAGGCAGAUUCGUCGCUUUCUCUGGAGAAGGACAGUCAUUGC +>U2AF2_K562_rep02_11150 +CUUUUUUGAGACAGACACUGGGCAGCAUCGUGUUCUUCCAGCGGACGUGUCUAGAACAUCU +>U2AF2_K562_rep02_11151 +CAAGUCCAUUGAUAUUUGGUCUGUAGGCUGCAUUCUGGCAGAAAUGCUUUCUAACAGGCCC +>U2AF2_K562_rep02_11152 +GAUAUCAGCUGCAGAUCACUCAAUACAUGGCCGAGACAAAUCUACAUUGGCCGGAAGCAGC +>U2AF2_K562_rep02_11154 +CGCUGUCUCUGCUCCCUCUAGGAAAGGCCACCUGCCUGAGCUUUGAAAUGGCCCACACCGU +>U2AF2_K562_rep02_11156 +UAAUAGCAUUGCUGAUGACAUUUUCCCUGUUAUCAGUUACUUAUGGGGCCAUUCGCUGCAA +>U2AF2_K562_rep02_11158 +UUUAUGUUUCCUAGGGAAGUGCCCGACAGGGUGGCACCACUACGAAGGCACGGCCAGCUGC +>U2AF2_K562_rep02_11159 +UUCCCCACCCCCUGUCUUACAUCCACCCUGGCCCUGUAAAUUCUUUUUUCCUUUGUUGCGU +>U2AF2_K562_rep02_11160 +CUCCUUUUUUUUUCUCCUGAGACAGGGUCUUGCCCUGUUGCCUAAGCAGGCAUGGAGUGGC +>U2AF2_K562_rep02_11164 +CUUUUUUCUCUAAUUGGACUGCAGCGUCAACUAUUCUGCCUCGCUAGAAAGUUCUUGGUAU +>U2AF2_K562_rep02_11165 +UGGAGCCUGGUGGGGAGCUGCUGGAGGGCUUGGGGCCAGGGAGGGAUGUGGCCUGACUUGG +>U2AF2_K562_rep02_11167 +CACCUUCUUAUCUGUGGUGAGGGCCACCCGCUGCCCCUCCCUCCUUCCUAUCCCUGUAUCU +>U2AF2_K562_rep02_11169 +UUCACUUUUAGCUUGUUCCAGCUGCCAGGCUGAGGGGACACCUUACGUCCCUCCCUCCUGA +>U2AF2_K562_rep02_11172 +GACCACUGCCUCUCUCCCCACAGGGACCACUGAAGAAAGACCGAAUUGCAAAGGAAGAAGG +>U2AF2_K562_rep02_11176 +CCACUUGUGUCCACACAGGCCCUGGGAGGAGCGGGGACACUGAGGACCUCUCUCCAAAUUG +>U2AF2_K562_rep02_11177 +UGUAUUUCUGAAUUGUAGAGUCAAAGGAGAAGUUCAGAGUCCCAUCAGCAAUGCACCUGUC +>U2AF2_K562_rep02_11183 +CUCCCGCUGCAUGCAGGGAUUCGGGUUCGUAACUUUCGAGAAUAGUGCUGAUGCAGACAGG +>U2AF2_K562_rep02_11184 +GCUCCCUGGUCUUGAGCAUCUGGGGCCCGAGCUGCCUGGGCAUUGGUUGGAAGUAGCCCUG +>U2AF2_K562_rep02_11187 +UGUUUUCAGAGACUCCCUACGGGAGAGGAUGCCCCGCAGGAACAUGGUAAGUAGUGAGGCG +>U2AF2_K562_rep02_11192 +UAACGAUGUGCAUGUUUUCCCCCCUUCUCCCGCUGCAUGCAGGGAUUCGGGUUCGUAACUU +>U2AF2_K562_rep02_11195 +CUUUGGUUUUUCAGGGCAGCCGAUGAAGUGCAACCUUCACAUGAAUGGGAAUGUUAUCACC +>U2AF2_K562_rep02_11196 +UUCUUCUCAUACCCCUACAGGACAAGAGGACCCUGCCUUGGUGUGAGAGUGAGGGAAGAGG +>U2AF2_K562_rep02_11199 +UCCAAAGCUGGGAGUCAUGUUGCCUGCAGGGACUCUUUCCUUACUGGGCCCAGGAGUUCGA +>U2AF2_K562_rep02_11201 +UUUGCUAUUUUCCCUCACCUCCCAGGGUAAGAUAAUCAGGAGCAGAAUGUGAAGAACUUUC +>U2AF2_K562_rep02_11205 +ACUCUAGCUAGAAGACAGAAGGCCAGCUCCCAAGCAGAUCAGAGGGUGGAAUUUUCAUUCU +>U2AF2_K562_rep02_11206 +UGAUGUGUCUUUUGCAGGUGAAGGUGGGAGACAAGGUCUCUGCUGACGAUGAGGCAGAGCC +>U2AF2_K562_rep02_11207 +AUCAUUUAUUGGAUUUCAGUUCAACAGACACUCCUAUGAGAAGCCCUUUGAGAUACGCCAG +>U2AF2_K562_rep02_11208 +ACGUGGUUUUUGGAUCCGUAGCACCCCGAGCAGAAGGCAGACCGGUAUUUUGUGUUAUACA +>U2AF2_K562_rep02_11211 +UCUCCACAUCUCCCCACAGCGCUGCGCACAUUGUCAGUGACUCUUUGUUGCAUGGUGAGUG +>U2AF2_K562_rep02_11215 +UGGCCCCUUUGCUGUCCAUCCUUUUUCAGGGCGUGGACUCCCUGGUGCUAGAAAGCGUGAU +>U2AF2_K562_rep02_11216 +UGGCCCCUUUGCUGUCCAUCCUUUUUCAGGGCGUGGACUCCCUGGUGCUAGAAAGCGUGAU +>U2AF2_K562_rep02_11226 +GCUUUUUACUUUCUCACGCAGGUCUGGCCUAAGAAGGAAAUGGAAAAUGAAAAGGCUUGAA +>U2AF2_K562_rep02_11227 +UGGUUUCUCUCCCUCGGCACCUGUUGCCUAGGAGUGGUCCGCAGACCUGAAUCGAACCCUC +>U2AF2_K562_rep02_11228 +ACUAAAUGUUAUUUCCUGAGUCACUUUUUUAAAGAGCUGCAUAAGCAACAAAGCUGCAUCA +>U2AF2_K562_rep02_11229 +CGUCUGCUCCUACUCCACAGCCGCGUCGUGUGACUCCUUCAAGAACCAGCUGGUCACCCGG +>U2AF2_K562_rep02_11234 +UUCUCUCUUUACAGGUGCUGGGCUGUGCUGUGGAGCUCCCUGAUGUCAGCUGCAAGCGGUU +>U2AF2_K562_rep02_11240 +UUUUCUCCUUUCAUUACCUACCUCUCCAUUAUGCCUCAGUUGUAACGGUGAGUAAAACUAU +>U2AF2_K562_rep02_11241 +CACUUCCUGUCACCUCCCAGGGCUCCCCCAUCCUGCUGGCUGCCAGGCGGGUUGGCCGCUC +>U2AF2_K562_rep02_11253 +CUUCCUUAGUUUUUGUCUUUUUUGAUCUGACUGUAGAUGAUCAGUCAGUUUAUCCUAAGGC +>U2AF2_K562_rep02_11254 +UUUAUUUCCUUCGGGACCUGGGGACAGGGUUUGGUCAGCACCUGCAAGGUCUGUAGUUGCC +>U2AF2_K562_rep02_11255 +AUUGCUUUGCAAUUCCAGGAGCGGCAUUGCCCCCGAAUGUCCAGAUUAUCCCUGUUUUUGU +>U2AF2_K562_rep02_12216 +UUCCCUUUUGUUCCCAGUGCCCCUCGCUGCCUUGUGUUCUUUGACAUUGGAAAGAAGGUCU +>U2AF2_K562_rep02_12217 +CUCCUUUCUUCCUUCCCUUCCCUUCCCCUCCCCUCCCCCAGGCUGGAGUGCAGAGGCACGA +>U2AF2_K562_rep02_12218 +CUCCUUUCUUCCUUCCCUUCCCUUCCCCUCCCCUCCCCCAGGCUGGAGUGCAGAGGCACGA +>U2AF2_K562_rep02_12219 +AGAUUUUCCACAGGUGUGGGCCCCAUUAGCUCUGGCCACCUGAGAAAGCCCUCAGGCAAAG +>U2AF2_K562_rep02_12220 +GGAUGUUAAUUCUUCUCUAUUUUAGAUUUUCCACAGGUGUGGGCCCCAUUAGCUCUGGCCA +>U2AF2_K562_rep02_12221 +UUACAGGUAUCACGCUCAUUGCUGUGGAUGAGGCUCACUGUAUUUCUGAGUGGGGGCAUGA +>U2AF2_K562_rep02_12222 +CUUUUCACAGUCCUCUUACUCCCAGUUACUGGCAGCUACAUGCCUUACCAAGCUUGUAUCA +>U2AF2_K562_rep02_12223 +CCUGUUUUUUUUUCCCCCUGGCAGAGUUAGCCACUUCUUCCUAUGUGUAAGCAUAUCAUCA +>U2AF2_K562_rep02_12224 +UUUAUGUUUUUUUUUCAGGGGAGCGGAAUAUUGGUUUCUUUUACUUGUUGUUUUCAGUUUU +>U2AF2_K562_rep02_12225 +CCCUCUUUCUCUCUCAGCUCCCACAGGCCCAUUCUGGUGACUCAUGACUUGUAUACACAGA +>U2AF2_K562_rep02_12226 +UUUUUUUUUUUUUUUUUAAUAGGGUCUCACUCUGUUGCUCGUGCUGGAGUGACAGUGGUGU +>U2AF2_K562_rep02_12227 +CCUUCCUUUCUUUUUCCCGCUUCCUUAAUGUAAUUUAAACCCUGGCAAACAUUCUUUAGAA +>U2AF2_K562_rep02_12228 +UUUUUCCAGGAGCUGGAGGAGGGAAUGAUAUUCAGUGGUGUUUUUCUCAGGUGAAAGGAGC +>U2AF2_K562_rep02_12229 +AUCCUUUCCUCCGUUUAGGAGCUGCAGUGAACACUUUUCAUUGAACAUGUAGCAUGAAGAG +>U2AF2_K562_rep02_12230 +CAUUAUUUGUUUACUCAUUUGGAGUGUUCCUUGACUUUUAUCCCCUCUUACCUAGUGACAU +>U2AF2_K562_rep02_12231 +AGAUAGAUCCAUUUAUCCUGCCUCCUAGGGAGAAGUUUCUGCCUGGAUUGAAACAAAAAAA +>U2AF2_K562_rep02_12232 +AACAGUGUAAAUUUGAUGGCCAGGAGACAAAAGGAUCCAAGUUCAUUACCUCCAGUGCGAG +>U2AF2_K562_rep02_12233 +CCUUUUUCUCCUCUUUACCGCAUCUUUCGUCUUGCAACACAGAGACCUAAAGGGCAAGGAA +>U2AF2_K562_rep02_12234 +UAUUUUCCAGGCCAGAGAUCCUCAGCAGGAGCCUAUGGAAGAGAUAGAAAAUUUGAAGAAA +>U2AF2_K562_rep02_12235 +CUGUUGCUCGUGCUGGAGUGACAGUGGUGUGAUCUUGGUUCGCUGCAACCUCCGCCUCUUG +>U2AF2_K562_rep02_12236 +UCAGAUACAAGUAUUGUUGGUCUUAUUUUCCAGGCCAGAGAUCCUCAGCAGGAGCCUAUGG +>U2AF2_K562_rep02_12237 +UUGUUCCCCUUUCCCAUUCCAGGGAGCUCUGGGCUCUGUUCUACUUAUUCGUAUUGGCAGG +>U2AF2_K562_rep02_12238 +CCUUCCUUUCUUUUUUUUAGAAGGCAUCUCACACUGUCACCCAGGCUGGAGUGCUGGAGUG +>U2AF2_K562_rep02_12239 +CCUUCCUUCCUUCCUUUUCUUCCUUUCUUUUCCUACCUUCCUUUUCCUUCCUUCCUUUCUU +>U2AF2_K562_rep02_12243 +UGUUCUCUUCUUGUUUCUUCUUCCCCACCAGCCAAAAAUCUAUGAUGUUAUAGCAAGGAUC +>U2AF2_K562_rep02_12244 +CUUCUUUUUCUGCACAGGCAGACACCACCCAUCCUUUAACCAAGCACAGAAAAAUAGCCUC +>U2AF2_K562_rep02_12245 +UCAGAGAUCUGCAGCGAAUAACCCUGCCCAGCAUUAACCGCCUCAGGCACUUCACCAAUGA +>U2AF2_K562_rep02_12249 +UUUUAGGCGUAAUUUUCAUUUUUUCAGAUGUUUUUCUACUUAAAUAGCACAUAUGCAGAAG +>U2AF2_K562_rep02_12250 +UUGAUUUUUUUUCCCCCUAGAGGAAGAAAUCCUACUUAGCGACAUGAACAAACAGUUGACU +>U2AF2_K562_rep02_12251 +CAGUGGUGCGAGGCAUAAUUUCUUCCUUAGGUUCCAGCAGAAAUGGAAGGGUUAGGACGAU +>U2AF2_K562_rep02_12252 +UUUUCCAGUAUGACAUGAUGGGAAGAAAUCAGACUGCUGUGAGAGAAGAGAUGAUUCUCCU +>U2AF2_K562_rep02_12253 +AUUCUUCAGUUAGCUUCAUCUUCAGAGCAAGCUGAUGAUGGCUUGUGUGUGCUAGCAGGAU +>U2AF2_K562_rep02_12254 +CCUUUCUUCCUUCCUUUCCUCCUUCCUCUUCUCCUCCUCCCCUUCCUUCCUUCCUUCCUUC +>U2AF2_K562_rep02_12255 +AUUCUUUCUCUUUUAGGUCCAGGUCCUAACAUUUGAUAGUCAUUUAAAGGCAUGAAGAUUC +>U2AF2_K562_rep02_12256 +UUUUUUUUUUCCACCUACAGCAGCUGUUUUUACCCUGUGGUCAGUCAGGUACUAUAUUUAG +>U2AF2_K562_rep02_12257 +CAGCUGUCUCCUUCUCUUACAGGGUGGGGAGAAACAGCGGGUCUUCACUGGUAUUGUUACC +>U2AF2_K562_rep02_12258 +AGGACAGGACCUUGCUGGGAACCUUCAGUAAGUUGUCCUUUUCUUUCUCAAACUUCCCAUG +>U2AF2_K562_rep02_12259 +UUCUUCUUCAUCUAGGGGCUCUUGGCCAGCUGGGAGUGGGGCUUGCUAAUCUUUUGAGGUA +>U2AF2_K562_rep02_12260 +ACCAACUAGGAUUUUUCUCAGGAGCACAUGGAUGAAGUAUGCUCCUCGCAGCUUCUAACUU +>U2AF2_K562_rep02_12261 +UUUUUUAAGGGACAGGGUCUUGAUCUGUCACCCAAGCUGGAGUGCUGAGGUGUGAUUGUAA +>U2AF2_K562_rep02_12262 +GUCUUCUGUUUUCCCCAGGCAGGGUGCCUGAGCUGUAUUCCCCAGCACACCCACUCCCGCA +>U2AF2_K562_rep02_12263 +AUUUCUGCACAUCUAGGAUGACAGUACGAGCCAUAGUGACCACCAAGACCCCAUCUCAUUA +>U2AF2_K562_rep02_12265 +UGGAUUUGUACAUUAUAGGUUCAUUGCCCUCAAGUGGCAGAAGGAAAAGCACAUGGAAUAU +>U2AF2_K562_rep02_12266 +UUUACUUUUUUUCUUUAAGGAUGGAUGUUGUGUUCUCUUUAUUUUUUUCCUACUACUUUAA +>U2AF2_K562_rep02_12267 +CCUUCCUUCCUCCCUUCCUUCCUUUCUGUUAUUCAGCCAGAAGUAUCAGCAUCACUGUUCU +>U2AF2_K562_rep02_12268 +UUUUGUUGGUUCUUUGAGCCUCUCACAGGUUGCAUCAUAGUCUAUGUGGAUAGAUGAAGAA +>U2AF2_K562_rep02_12269 +UUUUUUUUUUUUUUUUUUUUUUUUUUUGGUAGGAAACUCAACAGUGUAAAUUUGAUGGCCA +>U2AF2_K562_rep02_12274 +UGAUUUUGUCCCCUAGAGCAAGGUCCGUGGUCCUGUCAGUGGAAGCCCGGAUAGCAUGAAU +>U2AF2_K562_rep02_12275 +GGUGGGGUGGGGGCGGGGAGGGCUCCCGGGAGGCAAGUGGUCACGGUGAGAGUCACUGGGC +>U2AF2_K562_rep02_12276 +UACCCAUUGCUUUUACUGAUUAGGUAUGAAUUUCAGCCCUUUAUUUCCUUCUAAUUUUGGA +>U2AF2_K562_rep02_12279 +CCUCAUUUCACCCAGGAGGAAGGUGCAGCUCAGAGCUGUUACGACUAGUCAGAGAGAGCGA +>U2AF2_K562_rep02_12281 +AUAAUUCUUACCUGCCUCCUUUCUCUUCCCGGACCUUCCUAAUUUGAAGAGGUGAUUUGGA +>U2AF2_K562_rep02_12286 +UUUCUCUCCCUAAUCUUUUCUCCAAUCAGGCUUCAAUGUUAGCUGCAGAAAAUGACCCUUA +>U2AF2_K562_rep02_12287 +UUUUUGUUUUUCAGCCCUGGUACCUGACAGUGUAAAGAAGGAGCUCCUACAAAGAAUAAGA +>U2AF2_K562_rep02_12292 +UUUACCUGGGUAACAAUUUUACUUUUUACCACAGUCACCAAGGAGCUAGUUAGCUGGAUGA +>U2AF2_K562_rep02_12293 +UAGUUUGCAGGUCGAAGUAAGAAGGAAACCAAAUAUUCUCUUAAGGCUGUCGAAGACAUGU +>U2AF2_K562_rep02_12299 +UUUGUUUUUCUUUUCAGGUAUGGAACCCUUCAGAUCAAAGCUUACCAAUAAAUUCAGUAUG +>U2AF2_K562_rep02_12300 +UUUGUUUUUCUUUUCAGGUAUGGAACCCUUCAGAUCAAAGCUUACCAAUAAAUUCAGUAUG +>U2AF2_K562_rep02_12302 +CUCAUUUUUCUCUUGCCGCCGCCAUGUAAGAGGUAACUUUCACCUCCCGUCAUGAUUCUGA +>U2AF2_K562_rep02_12303 +UUAUUUUUCUUAUUUAGGGAAGGUUACCGCCACCUCUCUGUAGGAAAUCAAGUGUACAUGA +>U2AF2_K562_rep02_12305 +ACUUGCUAUCCUUCCCUUGCAGGAAGACACGUUUCAGCAGUAUGUAAGACCAGAGAUUAAC +>U2AF2_K562_rep02_12306 +CUUGUGCAAUUUCCAGGUGAUGAACAGCCUCCUUCUAAAUCAUUGACCACAUUUCUUAUUC +>U2AF2_K562_rep02_12307 +UUCUCUUUUUGUGCCAGGUCAUACUUUAAGGAGCCCAAGAGCUUUAUAACAUAACAAAAGA +>U2AF2_K562_rep02_12308 +UUCUCUUUUUGUGCCAGGUCAUACUUUAAGGAGCCCAAGAGCUUUAUAACAUAACAAAAGA +>U2AF2_K562_rep02_12311 +UCCCUUAAACUUUAUACCACCAGAAUACCAACAGAAGCUAAAUGUAGCAAAUGUGACUGCC +>U2AF2_K562_rep02_12312 +AAAAUUAAGUUCUUUUAUUAGCUGGCCGUUCUCUCAUUAUCUCAAAUUUAUUUAAGUAUUU +>U2AF2_K562_rep02_12316 +UUUUCUUCUUUGUAGCAUGGAGCAGAUCCAACUAAAAAGAACAGAGAUGGAAAUACACCUU +>U2AF2_K562_rep02_12317 +CUUUUCUCUAGGUUAGUAACACUGAAGAAAUCACUUUUGAAGCAUUGAAGAAAGCAAUUGG +>U2AF2_K562_rep02_12318 +UCAUAGCUCCUUCUCCCCCUGCUUCUUUCCCAAAUGAAUGAGUAUUUCUUUUAGAUAAAUU +>U2AF2_K562_rep02_12321 +AUUAUUUUUUUGUGUUGGCCAGGAAGUGAACCCAGGUCAACUGCUUGGAAGGUGGCUAUGC +>U2AF2_K562_rep02_12322 +ACAGGCCCAGACCUUCUCUUUCCCUUUCCAGCAGCCGGAGAAGUGCGACAACAACCAGUAC +>U2AF2_K562_rep02_12323 +CCCACCGCCUUGACACCCCCACCCCCGCAGGGAAGCAGCUGGUGCACUACACAGCGCAGCC +>U2AF2_K562_rep02_12324 +UUUUUUCAUUACAUUACAGGAAGCAGAAUCUGGUAAUAUAAGUCAAAAGUCUGAUGAAGAA +>U2AF2_K562_rep02_12325 +GUUUUCUUUUUUCCCUUUCCCAGUUUGACUUUUGCCAUCUAGAGUUUGUAAAUUAAGUGGU +>U2AF2_K562_rep02_12326 +CUUUCCCUUCCACAGCCCAGGGUCCGUCUGCAUUUUGUGGAGCUGGGCUCCGGCCCUGCUG +>U2AF2_K562_rep02_12334 +UUUGACUUUGCUUUGCUUUUCCCCUUUUGUGUUUGCAGUUGAAUGGAGAGGUUUUCAUAUU +>U2AF2_K562_rep02_12335 +AUAUUAAACUCUUCAGAAGGAAGUCACUGUGCAUAGCCAUCCCCUAAGAAGAGGGCAUUCC +>U2AF2_K562_rep02_12336 +ACACUUCUGUUCCUUUGUCUGCAGGAGAGCUGGAGGUGUUUCAGAAAGAUGGGGAACGAAA +>U2AF2_K562_rep02_12337 +UAAAACUGUGGUUUGCAAGCAGAAGGCGCUGGAACUGUUGCCCAAGGUGGAAGAGGUGGUG +>U2AF2_K562_rep02_12338 +CUAUCCUUCUACCUCCACGCACGUUUUUUAAGGCAGCGGCAAAAGUAGUAGAAAGCAAAAG +>U2AF2_K562_rep02_12339 +UCAGCUUUUUAAUUAAAUGAAGCCAAGUGGGAUUUGCAUAAAGUGAAUGUUUACCAUGAAG +>U2AF2_K562_rep02_12340 +UUUUCCUCCUCAAUCUUCCUUUGCCCUACCUAUGUGUUACUAGAGAACAUUUCUACAAAUU +>U2AF2_K562_rep02_12341 +UCUUUUUCCUUCCUCCCUCCCUGUCUCCCUCCCUCUCUGCCUCCCUCCCUCCCUCCCUCUU +>U2AF2_K562_rep02_12342 +UGUCUUUUUUUCUUUAGUGCUCCAGACAAUGAAACAUCCAAAUCUGCUAAUCAAGAUACCU +>U2AF2_K562_rep02_12343 +CUUUGUACCAAUAGGUAAUUUGUCGUCCAGAUGCUCUGCUAUAUGUGAAGUAUCAUUUUUC +>U2AF2_K562_rep02_12344 +CUUUGUACCAAUAGGUAAUUUGUCGUCCAGAUGCUCUGCUAUAUGUGAAGUAUCAUUUUUC +>U2AF2_K562_rep02_12352 +UUUUUCCUCUGAAUUUACAUGGAAGGAGCGGUAGAUGAUGAGACAUAUAAGAUCCUCACAU +>U2AF2_K562_rep02_12353 +AGAUGCCACUGCCUCCUUUCCAUUGUCAGCUGGCGGGUGACGCGACUGUUGUUGCACUGGG +>U2AF2_K562_rep02_12354 +AGAUGCCACUGCCUCCUUUCCAUUGUCAGCUGGCGGGUGACGCGACUGUUGUUGCACUGGG +>U2AF2_K562_rep02_12355 +CUAACUUCUCUAGCCAAAUACAGAUAGUCUUUCCCACUGAGUGUCUGUCAACAACUAGAUU +>U2AF2_K562_rep02_12356 +UCCCUGAUUCUUUUUCAAGGGCCGCUUGAAGAUGCCAUUGAAGAUGAGGAAGAAGAAUGUC +>U2AF2_K562_rep02_12357 +AUUUUAAUUCUAGUCUAGGUGAUGGCUGCUCCUUUCCAACUUGCCUUGUUAACCAGGAUCC