# HG changeset patch
# User iuc
# Date 1623674890 0
# Node ID a92a632c4d9bd87c702bc9d38363b475600e80e5
# Parent b89b0765695d3344e26b8beb3f499c11e7ed6264
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/metaphlan/ commit f1c6f4fe1e572ace84cf9106bc253603f55aac55"
diff -r b89b0765695d -r a92a632c4d9b formatoutput.py
--- a/formatoutput.py Mon May 17 20:10:24 2021 +0000
+++ b/formatoutput.py Mon Jun 14 12:48:10 2021 +0000
@@ -57,7 +57,9 @@
# skip headers
if line.startswith("#"):
continue
-
+ # skip UNKNOWN lines in Predicted taxon relative abundances
+ if "UNKNOWN" in line:
+ continue
# spit lines
split_line = line[:-1].split('\t')
taxo_n = split_line[0].split('|')
diff -r b89b0765695d -r a92a632c4d9b macros.xml
--- a/macros.xml Mon May 17 20:10:24 2021 +0000
+++ b/macros.xml Mon Jun 14 12:48:10 2021 +0000
@@ -1,6 +1,6 @@
- 3.0.8
+ 3.0.9
0
20.01
@@ -21,7 +21,7 @@
- 1101/2020.11.19.388223
+ 10.7554/eLife.65088
diff -r b89b0765695d -r a92a632c4d9b metaphlan.xml
--- a/metaphlan.xml Mon May 17 20:10:24 2021 +0000
+++ b/metaphlan.xml Mon Jun 14 12:48:10 2021 +0000
@@ -195,8 +195,7 @@
--metaphlan_output '$output_file'
--outdir 'split_levels'
$out.legacy_output
-&&
-ls split_levels
+
#end if
#if $out.krona_output
@@ -211,26 +210,26 @@
-
+
-
+
-
+
-
+
-
+
-
-
+
+
@@ -245,10 +244,10 @@
-
+
-
@@ -273,12 +272,12 @@
-
-
+
+
-
+
@@ -296,8 +295,8 @@
-
+
@@ -369,6 +368,152 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
@@ -916,13 +1061,13 @@
- species-level resolution for bacteria, archaea, eukaryotes and viruses;
- strain identification and tracking
- orders of magnitude speedups compared to existing methods.
-- metagenomic strain-level population genomics
+- microbiota strain-level population genomics
MetaPhlAn clade-abundance estimation
------------------------------------
The basic usage of MetaPhlAn consists in the identification of the clades (from phyla to species and
-strains in particular cases) present in the metagenome obtained from a microbiome sample and their
+strains in particular cases) present in the microbiota obtained from a microbiome sample and their
relative abundance.
Marker level analysis
@@ -944,7 +1089,7 @@
- one or several sequence files in Fasta, FastQ (compressed or not)
- a BowTie2 produced SAM file
-- an intermediary mapping file of the metagenome generated by a previous MetaPhlAn run
+- an intermediary mapping file of the microbiota generated by a previous MetaPhlAn run
It also need the reference database, which can be locally installed or customized using the dedicated tools.
@@ -965,4 +1110,4 @@
]]>
-
+
\ No newline at end of file
diff -r b89b0765695d -r a92a632c4d9b test-data/no_taxon_input.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/no_taxon_input.fasta Mon Jun 14 12:48:10 2021 +0000
@@ -0,0 +1,4 @@
+> seq1
+ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA
+> seq2
+ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA