Mercurial > repos > iuc > mothur_biom_info

diff test-data/sample2.fa @ 0:c664838f087c draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 3418f23b9768f5aafb86488f5ec1cb97530d4fb3
author iuc
date Tue, 20 Mar 2018 21:53:45 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample2.fa	Tue Mar 20 21:53:45 2018 -0400
@@ -0,0 +1,2 @@
+> seq1 This is the description of my first and only sequence in sample 2.
+AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC